ID: 1176230086

View in Genome Browser
Species Human (GRCh38)
Location 20:64028116-64028138
Sequence GCGTCCAGCTCAGGGTGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176230075_1176230086 30 Left 1176230075 20:64028063-64028085 CCCTGGAGGTGGACAGGAGCCTG 0: 1
1: 0
2: 4
3: 49
4: 517
Right 1176230086 20:64028116-64028138 GCGTCCAGCTCAGGGTGACGGGG 0: 1
1: 0
2: 0
3: 8
4: 88
1176230079_1176230086 11 Left 1176230079 20:64028082-64028104 CCTGCTAGGTGCAGGCTCTGTTC 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1176230086 20:64028116-64028138 GCGTCCAGCTCAGGGTGACGGGG 0: 1
1: 0
2: 0
3: 8
4: 88
1176230076_1176230086 29 Left 1176230076 20:64028064-64028086 CCTGGAGGTGGACAGGAGCCTGC No data
Right 1176230086 20:64028116-64028138 GCGTCCAGCTCAGGGTGACGGGG 0: 1
1: 0
2: 0
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176230086 Original CRISPR GCGTCCAGCTCAGGGTGACG GGG Intronic
900121089 1:1049047-1049069 GCGTGCAGCTCAGGTGGGCGGGG + Exonic
900209858 1:1449929-1449951 CCAACAAGCTCAGGGTGACGAGG - Exonic
900222265 1:1515560-1515582 CCAACAAGCTCAGGGTGACGAGG - Intronic
901393665 1:8964730-8964752 GGGGCCAGCTCAGGGTGGGGTGG - Intronic
901867632 1:12117521-12117543 GCCTCCATTTCAGGGTGATGGGG - Intronic
902951047 1:19882878-19882900 GCGTCCAGCTGCGAGTGAGGCGG + Intronic
904227030 1:29030406-29030428 GACTCCAGCTCAGGCTGACTTGG + Exonic
904316988 1:29671902-29671924 GTGTCCAGCTCAGCATGAAGGGG + Intergenic
915512547 1:156394277-156394299 GAGTCAAGGTCTGGGTGACGCGG + Intergenic
1065522841 10:26588844-26588866 GGGGCCAGCTCAGGGTGTAGTGG + Intergenic
1067974809 10:51012211-51012233 GTTTCCAGCTCAGGGTAAGGAGG + Intronic
1070798101 10:79228829-79228851 GCTTCAAGATCAGGCTGACGTGG + Intronic
1072031862 10:91529086-91529108 GCATCCAGCACAGGATGATGGGG + Intergenic
1075193984 10:120338773-120338795 GGGTGCAGCCCAGGGTGATGGGG - Intergenic
1076991852 11:279748-279770 GCGTGCTCCTCAGGGTGACTCGG + Intronic
1077065907 11:640842-640864 GCCGCCTGCTCAGGGTGAGGGGG + Intergenic
1082160138 11:48881662-48881684 GCGTGGAGCTCATGGTGACTTGG - Intergenic
1082162228 11:48898744-48898766 GCGTGGAGCTCATGGTGACTTGG + Intergenic
1085739779 11:79068981-79069003 GCGGGCAGCTCTGGGTGAAGGGG + Intronic
1091221832 11:133934327-133934349 GCGTCCAGCACAGAGGGACGGGG + Intronic
1092737731 12:11599122-11599144 GTGTCCAACTCAGGGTCAAGTGG - Intergenic
1096597574 12:52706487-52706509 GCCTCCAGCACAGAGTGACAAGG + Intergenic
1101736263 12:107465571-107465593 GCGTCCTGCTCAGGGGCAGGGGG + Intronic
1104465091 12:128983790-128983812 GCCTCCATCTCAGGGTCACGCGG - Exonic
1105591025 13:21792903-21792925 AAGCCAAGCTCAGGGTGACGAGG - Intergenic
1110412483 13:75219855-75219877 GAGCCCAGCTCCGGGTGCCGCGG + Intergenic
1114259093 14:21024933-21024955 GCCTCCAGCTCCAGGGGACGCGG + Exonic
1121368166 14:93333116-93333138 TCGTCCCGCTCAGGGTCACGTGG + Intergenic
1123061824 14:105597971-105597993 ACGTCCAGCTCTGGGGGACCTGG + Intergenic
1123086562 14:105719702-105719724 ACGTCCAGCTCTGGGGGACCTGG + Intergenic
1124250495 15:28103949-28103971 GCCTTCAGCTCAGGATGACCCGG - Intergenic
1124901052 15:33822891-33822913 GCGTCCAACTCAGTGTGGCTGGG + Intronic
1131290170 15:91100274-91100296 GCGTGCAGCTCCGGCTAACGCGG - Exonic
1131837886 15:96408882-96408904 ACGTCCAGCTCAGGGGCACTTGG + Intergenic
1135101968 16:19613765-19613787 GCATGGAGCTCAGGGTGAGGTGG + Intronic
1136519639 16:30787169-30787191 GGGACCAGTTCAGGGTGACTGGG + Exonic
1139953363 16:70682264-70682286 GGGCACAGCTCAGGGTGAAGGGG + Intronic
1148566610 17:48636685-48636707 GCGTCCCGCGCCGGGTGAAGGGG + Intergenic
1152113214 17:78368741-78368763 GCTTCCAGCTCAAGCTGAAGTGG + Intergenic
1152726511 17:81949295-81949317 GTGTGAAGCTCAGGCTGACGTGG + Intergenic
1157572975 18:48725161-48725183 GCTTCCTGCTCAGGGTGACCAGG - Intronic
1157848944 18:51030110-51030132 GCCTCCCGCTCCGAGTGACGGGG - Intronic
1161810151 19:6466845-6466867 GCCTGCAGCTCAGGGTGCTGGGG + Intronic
1162336147 19:10061767-10061789 GGGCCCAGCTCTGGGTGACAAGG + Intergenic
1165330429 19:35138798-35138820 GCGTCCAGCTCTGGGCCAGGGGG + Intronic
1165961053 19:39534572-39534594 GTGTCCATCTCAGGGAGACCTGG + Intergenic
1167505832 19:49870643-49870665 AGGCCCAGCTCCGGGTGACGGGG - Intronic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
937216880 2:120318599-120318621 GAGTCCAGGTCCGGGTGACCCGG + Intergenic
938105452 2:128526935-128526957 GGGCCTAGCTCAGGGTGACAGGG - Intergenic
940866159 2:158819607-158819629 GGGTCCAGATCAGGGTGGTGGGG - Intronic
942641606 2:178066727-178066749 GCTGCCAGCTCTGGGTGAGGAGG - Intronic
947229445 2:227870512-227870534 GCGTCCATCTCAGGGAGACCTGG - Intergenic
1175990949 20:62788866-62788888 GCTTCCTGCCCAGGCTGACGGGG - Intergenic
1176230086 20:64028116-64028138 GCGTCCAGCTCAGGGTGACGGGG + Intronic
1176298160 21:5085372-5085394 GCCTCCAGCTCTGCGAGACGAGG + Intergenic
1177481049 21:21689066-21689088 GCATCCAGCTGATGGCGACGCGG - Intergenic
1178980877 21:37263877-37263899 GCAGCCAGCTAAGGGTGAGGAGG + Intronic
1179858869 21:44176577-44176599 GCCTCCAGCTCTGCGAGACGAGG - Intergenic
1180078752 21:45476394-45476416 GCCTCCAGCCAAGGGTGGCGTGG - Exonic
1181648781 22:24247638-24247660 GCGTCCAGCTCACCCTGCCGAGG - Intergenic
1182100593 22:27654978-27655000 CCTTCCAGCTCTGGGTGGCGAGG - Intergenic
1184022951 22:41833219-41833241 CCGTCCCGCTCAGGGAGACGCGG - Exonic
949296635 3:2532285-2532307 CAGTCCAGCCCAGGGTGACAGGG - Intronic
950628206 3:14264008-14264030 GCGGCCAGTTCAGGATGTCGGGG + Intergenic
955408034 3:58637837-58637859 GCATCCAGCTCACTGTGAAGAGG + Intronic
962516331 3:136155546-136155568 GTGTCCATCTCAGGGAGACCTGG + Intronic
968815116 4:2818098-2818120 GCCTCCCGCGCACGGTGACGCGG + Intronic
968965249 4:3766250-3766272 GCGTCGAGCCCACGGCGACGCGG - Intergenic
971092454 4:23361097-23361119 GCGTCCAGCTCTCAGTGAAGAGG - Intergenic
982484773 4:155953745-155953767 GCGGCCAGGTCGGGGTGAAGGGG + Exonic
984933530 4:184869505-184869527 GCCTCCAGCTCATGGTAAAGAGG + Intergenic
985070460 4:186162524-186162546 GCCACCAGCCCAGGGTGACCTGG - Intronic
985434675 4:189917238-189917260 GGGGCCAGCTCAGGGTGCGGTGG - Intergenic
989592119 5:43121487-43121509 GCGTCGAGCTCCGGCTGACGCGG - Intronic
997443417 5:133924865-133924887 GCCTCCAGCTCAGGGTGGGTTGG - Intergenic
1018029626 6:159831681-159831703 GCTGCCAGCTCAGGGTGATAAGG + Intergenic
1019593108 7:1845543-1845565 GCGTCCGGCTCTGGTTCACGGGG + Intronic
1019593117 7:1845607-1845629 GCGTCCGGCTCTGGTTCACGGGG + Intronic
1019593125 7:1845671-1845693 GCGTCCCGCTCTGGTTCACGGGG + Intronic
1029751517 7:102545179-102545201 GCGTGAAGGTCAGGCTGACGGGG - Intronic
1029769469 7:102644270-102644292 GCGTGAAGGTCAGGCTGACGGGG - Intronic
1032389160 7:131544568-131544590 GCCTCCAGATCAGGGAGGCGTGG + Intronic
1035261143 7:157662429-157662451 GTGCCCAGCTCTGGGTGGCGTGG - Intronic
1035579194 8:729319-729341 AGGTCCAGCTCAGGGTCATGGGG - Intronic
1035583789 8:756750-756772 GACTCAAGCTCAGGGTGAGGAGG - Intergenic
1037787638 8:21912125-21912147 GTGTCAAGGTCAGGGTGATGGGG - Intronic
1037901347 8:22691225-22691247 GCAGCCACCGCAGGGTGACGTGG - Exonic
1039064939 8:33599585-33599607 GCGCCCAGCTAGGGGCGACGGGG - Intronic
1041064878 8:54073116-54073138 GCGTCCATCTCAGGGAGACCTGG + Intronic
1045271408 8:100664945-100664967 GGGTCCGGCTCAGGGTGGGGAGG - Intergenic
1048868167 8:138776101-138776123 GCTTCCAGCCCAGGGTGGCAGGG + Intronic
1061018000 9:127993902-127993924 ACATCATGCTCAGGGTGACGAGG + Intergenic
1061874672 9:133537685-133537707 GCGTCCAGCAGAGGCTGATGGGG - Intronic
1061996676 9:134189725-134189747 GCGTCCGGCGCAGGGTGGCTGGG + Intergenic
1062497489 9:136838614-136838636 GGGCCCAGCTCAGGGCCACGGGG - Intronic
1187257924 X:17658020-17658042 GCCTCCAGCTGATGGTGAAGAGG + Intronic