ID: 1176231307

View in Genome Browser
Species Human (GRCh38)
Location 20:64034403-64034425
Sequence GGTCCCCAGAACCACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 330}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176231307_1176231315 5 Left 1176231307 20:64034403-64034425 CCTTCCCTGTGGTTCTGGGGACC 0: 1
1: 0
2: 0
3: 40
4: 330
Right 1176231315 20:64034431-64034453 GACATGGTCAATCCCGGGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 77
1176231307_1176231321 27 Left 1176231307 20:64034403-64034425 CCTTCCCTGTGGTTCTGGGGACC 0: 1
1: 0
2: 0
3: 40
4: 330
Right 1176231321 20:64034453-64034475 GGACCTGCCACCCCTGTATGGGG 0: 1
1: 0
2: 1
3: 10
4: 125
1176231307_1176231320 26 Left 1176231307 20:64034403-64034425 CCTTCCCTGTGGTTCTGGGGACC 0: 1
1: 0
2: 0
3: 40
4: 330
Right 1176231320 20:64034452-64034474 GGGACCTGCCACCCCTGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 139
1176231307_1176231313 -1 Left 1176231307 20:64034403-64034425 CCTTCCCTGTGGTTCTGGGGACC 0: 1
1: 0
2: 0
3: 40
4: 330
Right 1176231313 20:64034425-64034447 CTTGAGGACATGGTCAATCCCGG 0: 1
1: 0
2: 1
3: 5
4: 107
1176231307_1176231319 25 Left 1176231307 20:64034403-64034425 CCTTCCCTGTGGTTCTGGGGACC 0: 1
1: 0
2: 0
3: 40
4: 330
Right 1176231319 20:64034451-64034473 AGGGACCTGCCACCCCTGTATGG 0: 1
1: 0
2: 1
3: 9
4: 126
1176231307_1176231316 6 Left 1176231307 20:64034403-64034425 CCTTCCCTGTGGTTCTGGGGACC 0: 1
1: 0
2: 0
3: 40
4: 330
Right 1176231316 20:64034432-64034454 ACATGGTCAATCCCGGGCAAGGG 0: 1
1: 0
2: 0
3: 2
4: 84
1176231307_1176231314 0 Left 1176231307 20:64034403-64034425 CCTTCCCTGTGGTTCTGGGGACC 0: 1
1: 0
2: 0
3: 40
4: 330
Right 1176231314 20:64034426-64034448 TTGAGGACATGGTCAATCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176231307 Original CRISPR GGTCCCCAGAACCACAGGGA AGG (reversed) Intronic
900214450 1:1473915-1473937 GTTCCCCAGCACCCCGGGGAAGG - Intronic
900410641 1:2511007-2511029 GGACCCCAGAGGCACCGGGACGG + Intronic
900799249 1:4727322-4727344 GGACCCCTGAAACACAGGGAAGG - Intronic
901480356 1:9520744-9520766 GGTTCCAGGAAGCACAGGGAGGG - Intergenic
902613121 1:17608645-17608667 CTTCCGCAGAACAACAGGGAAGG - Intronic
902643589 1:17782145-17782167 GGTCTCCAGAGGCCCAGGGATGG - Intronic
902744684 1:18465772-18465794 GGCCTCCAGCACCACAGAGAAGG + Intergenic
903194167 1:21672553-21672575 TGTCCACAGAGCCACAGGTAAGG + Intergenic
904004793 1:27358090-27358112 GGTGCCCAGGTCCCCAGGGAGGG + Intronic
904013782 1:27405362-27405384 GGGCCCCAGGGCCACAGGAATGG + Exonic
904031429 1:27535897-27535919 GGTCCCCTGAAGGACAGGGATGG + Intronic
904812561 1:33172779-33172801 TGTCCCCTGGACCAGAGGGAGGG - Intronic
906125000 1:43422372-43422394 AGTCCCCATAACCTCAGGCAAGG + Intronic
906953702 1:50355014-50355036 GGTTCCCAGAGCCAGAGCGATGG - Intergenic
907475662 1:54703735-54703757 GCTGCCCACAACAACAGGGAAGG - Intronic
907489342 1:54799215-54799237 GGTGCCCAGCACTCCAGGGAGGG - Intronic
907903531 1:58763360-58763382 GGACTCCTGACCCACAGGGAGGG + Intergenic
909413366 1:75378894-75378916 TGCCCCCAGCACCACAGGGCAGG + Intronic
910598104 1:89001516-89001538 GCTCCTCTGATCCACAGGGAAGG - Intergenic
915075592 1:153306134-153306156 GGCCCCCAGCACCCCTGGGATGG - Intronic
915402522 1:155634015-155634037 TGCCCCCAGCACCACAGGGCAGG - Intergenic
915472719 1:156135435-156135457 TGTCCCCACAACCACAGAGAAGG + Intronic
915556406 1:156663315-156663337 GGGCCCCAGAGCCCCAGGAAGGG - Intergenic
915795678 1:158731260-158731282 CATCCCTAGACCCACAGGGAGGG - Intergenic
916009574 1:160692585-160692607 TGCCCCCAGCACCACAGGGCAGG + Intronic
916988693 1:170218812-170218834 GTACCCCAGAGACACAGGGAGGG + Intergenic
918429421 1:184443715-184443737 CTTCCCCCTAACCACAGGGAAGG + Intronic
921247038 1:213255174-213255196 GGGTCCCAGGACCACAGGCATGG - Intronic
921899510 1:220435493-220435515 GTTGCCCATAACCACAAGGAAGG - Intergenic
922301215 1:224302748-224302770 GCTCCTTAGAACCACTGGGAGGG + Intronic
922713961 1:227856442-227856464 GGTCCCCCAAAGCACTGGGAGGG - Intergenic
922787839 1:228292008-228292030 GGGCCCGAGAACCTCAGAGATGG + Exonic
923195471 1:231662353-231662375 AGTCCACTGAACCACAGAGATGG + Intronic
924294867 1:242576557-242576579 GCTCCACATAACCACATGGATGG + Intergenic
1062909081 10:1200302-1200324 TGTCCCCAGAGCCCCAGTGATGG - Intronic
1063180495 10:3594114-3594136 GGTCCCCAGCAGCACAAGAAGGG + Intergenic
1064296015 10:14079854-14079876 TGTACCCAGAAACACAGTGAGGG + Intronic
1065343117 10:24724102-24724124 GGTCCCGCGACCCACGGGGAGGG - Intergenic
1067030324 10:42875340-42875362 AGACCCCAGAAGCACAGGGAGGG - Intergenic
1067749318 10:48959762-48959784 GGTCCCCATCAGCCCAGGGAGGG - Exonic
1067788535 10:49270775-49270797 GGTGCACAGCAGCACAGGGAAGG + Intergenic
1068900866 10:62268414-62268436 GGTGGCCAGAAACAAAGGGAGGG - Intronic
1069360231 10:67633269-67633291 AGTCCACTGAACCACAGAGATGG - Intronic
1070303969 10:75227061-75227083 GCACCCCAGCTCCACAGGGATGG + Intronic
1071264527 10:83953191-83953213 GGTGACCACAACCACAAGGAGGG + Intergenic
1072021495 10:91407975-91407997 GGTCTCCAGAAGCACACTGATGG + Intergenic
1072947917 10:99827096-99827118 TGCCCCCAGCACCACAGGGCAGG - Intronic
1073130112 10:101182909-101182931 CCTCCACAGAACCAGAGGGATGG - Intergenic
1073773236 10:106758418-106758440 GGTGCCCAGAACTAGAGGGTAGG - Intronic
1074185612 10:111097597-111097619 GGTCCGCAGAGGGACAGGGAGGG + Intergenic
1075544928 10:123348117-123348139 GGTCCCCAAGCCCACAGGAAGGG - Intergenic
1076070167 10:127482682-127482704 AATCCCCAGCCCCACAGGGAGGG - Intergenic
1076342099 10:129756282-129756304 GGTACCCAGCACCACAGGACAGG + Intronic
1076837189 10:133027096-133027118 GGTCCCCAGGCTCACAGGGTTGG - Intergenic
1076837198 10:133027128-133027150 GGTCCCCAGGCTCACAGGGTTGG - Intergenic
1076837216 10:133027192-133027214 GGTCCCCAGGCTCACAGGGTCGG - Intergenic
1076998388 11:310505-310527 GGTCCCCAGCACCACAGAGCAGG - Intronic
1077000354 11:319253-319275 GGTCCCCAGCACCACAGAGCAGG + Intergenic
1077294750 11:1820944-1820966 GGCCCCCAGGGCCACATGGAGGG - Intergenic
1078930815 11:15910887-15910909 GGCCCCCAGAAAGTCAGGGAGGG - Intergenic
1080418880 11:32092822-32092844 GGCCCCCAGGAGCACAGGGATGG - Intronic
1083709490 11:64539305-64539327 AGTGCCCAGAACTACAGGGCAGG + Intergenic
1084419322 11:69052537-69052559 GGGCACCAAAGCCACAGGGAGGG + Intronic
1085014870 11:73167312-73167334 TTTCCCCAGAACTACTGGGAAGG - Intergenic
1085295037 11:75426713-75426735 GGCCCCCAGATCCAAAGGAAGGG + Intronic
1087723907 11:101696871-101696893 TGCCCCCAGCACCACAGGGCAGG + Intronic
1088291457 11:108242770-108242792 GTTCCCCAGTACCAAAGGCAAGG - Intronic
1088746313 11:112807784-112807806 GGTCCAGGGAAGCACAGGGATGG - Intergenic
1089086803 11:115826667-115826689 GGTCCCCAGGTCCCCAGGTAGGG - Intergenic
1089471931 11:118728344-118728366 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1090171151 11:124605820-124605842 AGTCCCCATACCCACAGGGAAGG - Intergenic
1091080748 11:132665359-132665381 GGTCCCCACAAGCACAGTGAGGG + Intronic
1092512369 12:9170619-9170641 AGTCCTCAGAACCACAGAGATGG - Intronic
1095702453 12:45204386-45204408 CATCACAAGAACCACAGGGAAGG - Intergenic
1096693438 12:53334835-53334857 TGTCCCCAGCACCAGAGGCAAGG + Intronic
1096867727 12:54575236-54575258 GGCCCCCATAGGCACAGGGAAGG - Intronic
1096889234 12:54749979-54750001 GATTCCCGGAACCACAGGAAGGG - Intergenic
1097271866 12:57780438-57780460 GGTCCCCAGCAGCAGAGGGAAGG - Exonic
1097331274 12:58335085-58335107 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1097624828 12:61987431-61987453 GGTACCCAGACCCAGAGAGAAGG - Intronic
1098212553 12:68181875-68181897 GGTAGGCAGAAGCACAGGGATGG - Intergenic
1103342634 12:120229171-120229193 GGTCCCCAGAGCCACAGTCTGGG - Intronic
1103508346 12:121456215-121456237 GGCCCACAGACCCACTGGGATGG + Intronic
1103613716 12:122139282-122139304 GGTCCTCGAAGCCACAGGGAGGG + Intronic
1104143773 12:126012706-126012728 GGTCCCCAGAGGCACGTGGATGG - Intergenic
1104841521 12:131828234-131828256 GGTCCGCGGCATCACAGGGAAGG - Intergenic
1105626409 13:22117277-22117299 GGGCTCCAGAAAGACAGGGATGG + Intergenic
1106628132 13:31441985-31442007 TGTTCCCAGCTCCACAGGGAGGG - Intergenic
1106816339 13:33411528-33411550 GTTCCCAAGAAACAAAGGGAAGG + Intergenic
1106938494 13:34750327-34750349 CGTCTGCAGGACCACAGGGAGGG + Intergenic
1107299911 13:38954912-38954934 TGTCCCCACAACCACATGGAGGG + Intergenic
1107806320 13:44157083-44157105 GATCCCCAGAAACACAGTGAGGG + Intronic
1109220530 13:59636755-59636777 GATCCCCTGAGCTACAGGGATGG - Intergenic
1111952246 13:94718004-94718026 TGGCCCCAGAACAGCAGGGATGG - Intergenic
1112330900 13:98476319-98476341 GCTCCCCGGAACCACAGAAACGG + Intronic
1112990836 13:105512447-105512469 AGTCCCTAGAACCAAAAGGAGGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1113956214 13:114101076-114101098 GCTCCCCACACCCACATGGATGG + Intronic
1116144180 14:41042198-41042220 GGAGGCCAGAGCCACAGGGAAGG + Intergenic
1118093009 14:62503500-62503522 AGTCCACACATCCACAGGGAAGG + Intergenic
1122652603 14:103233658-103233680 GTTCCCAAGAGCCACAGCGAAGG - Intergenic
1122715443 14:103694158-103694180 GGGCCCCAGGGCCACAGGCATGG - Intergenic
1123060325 14:105591508-105591530 GGACTCCGGAACCACAGGGCAGG - Intergenic
1123084802 14:105712479-105712501 GGACTCCGGAACCACAGGGCAGG - Intergenic
1123132684 14:106000571-106000593 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132721 14:106000729-106000751 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132745 14:106000810-106000832 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132788 14:106000988-106001010 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132812 14:106001069-106001091 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132836 14:106001150-106001172 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132860 14:106001231-106001253 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132884 14:106001312-106001334 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132908 14:106001393-106001415 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123582935 15:21731839-21731861 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123619585 15:22174435-22174457 GGTGCACAGAACCACCAGGAGGG - Intergenic
1127223753 15:56909042-56909064 GGGCATCAGAATCACAGGGAGGG + Intronic
1129176979 15:73847315-73847337 TTTCCCCAAAACCAAAGGGAAGG + Intergenic
1129183053 15:73888954-73888976 GGTGCCCAGACCCACTGGGATGG - Intronic
1129514301 15:76147689-76147711 GGACCCCAGGACTACAGGAAAGG - Intronic
1129743153 15:77999980-78000002 GGCCTTCAGAAACACAGGGAGGG - Intronic
1129842329 15:78751460-78751482 GGCCTTCAGAAACACAGGGAGGG + Intergenic
1129876781 15:78980808-78980830 GGCCCCCAGATCCCAAGGGAAGG - Intronic
1130332573 15:82933654-82933676 GGTGCCCAGAACCAAACGCAGGG + Intronic
1130923611 15:88368939-88368961 GGTCCCCAAAGCCAGAGGGCAGG - Intergenic
1131466581 15:92660424-92660446 GGTCACAAGATCCACAAGGATGG + Intronic
1131521895 15:93122665-93122687 AGTTCCCAGAGCCGCAGGGAGGG - Intergenic
1132639706 16:972178-972200 CGGCCCCAGCAACACAGGGAAGG - Intronic
1132668041 16:1090811-1090833 GGGCCCCACAGCAACAGGGAGGG + Intronic
1133061521 16:3177858-3177880 GCTCCTCAGGACCACAGGAACGG + Intergenic
1133131750 16:3680423-3680445 GTTCCCCAGAACCACAGCCAGGG - Intronic
1134438566 16:14283793-14283815 AGTCCCCAGAACCACGTGGAAGG + Intergenic
1137252813 16:46752161-46752183 GGTCACCAGAAGGCCAGGGAAGG - Intronic
1137491494 16:48936852-48936874 TGTCCCAAGATCCACACGGAGGG + Intergenic
1137586430 16:49666709-49666731 GCTCACCAGACCCCCAGGGAGGG + Intronic
1138029293 16:53547103-53547125 GGGCCCCAGACACACAGGGAAGG + Intergenic
1138089387 16:54161760-54161782 GCTCGCCAGCACCACAGGAAGGG - Intergenic
1138421118 16:56899789-56899811 GGTCCCCTCAGCCCCAGGGAGGG - Intronic
1141196040 16:81862031-81862053 GCTTCCCAGAACCACAGGAAAGG - Intronic
1141368786 16:83468283-83468305 GGTGCACAGAAGCACAGGCAAGG + Intronic
1141817043 16:86418105-86418127 GATCCCCAGAAGCACAGAAACGG - Intergenic
1142343181 16:89537275-89537297 GGACCCCAGAGCCCCCGGGAAGG + Intronic
1143020476 17:3914921-3914943 AGTCCCCAGAACCTCAGAGCCGG - Intronic
1144169984 17:12650060-12650082 GGTCACTGGGACCACAGGGAGGG + Intergenic
1144710505 17:17398664-17398686 CCTCCCCAGGACCACATGGAGGG - Intergenic
1146274860 17:31510146-31510168 TGTCCCCAGGTCCACAGGGAAGG - Intronic
1148919230 17:51015278-51015300 GGTACCAGCAACCACAGGGAGGG + Intronic
1149010888 17:51855009-51855031 CTTCCCCAGAACCAAATGGATGG - Intronic
1149545645 17:57501535-57501557 TGTGCGCAGAACCACAGGGATGG - Intronic
1151048106 17:70945563-70945585 GTTGGCCAGAACCACAGGGTGGG + Intergenic
1151739519 17:75970450-75970472 GGCTCCCAGACCCACAGGGCAGG + Intronic
1151969937 17:77452383-77452405 AGTCCCCAGAGTCACTGGGACGG - Intronic
1152164991 17:78697811-78697833 TGTCCCCATAACCACTGGGAGGG - Intronic
1152500451 17:80705100-80705122 GGAGCCCAGGGCCACAGGGAAGG - Intronic
1152828260 17:82481000-82481022 GGTGCCCAGAACAAGAGGGATGG - Intronic
1153031684 18:719249-719271 GGTCTCCAGAAGCACTGGAATGG + Intergenic
1154303453 18:13214364-13214386 GGTCCACAGGATCCCAGGGAGGG + Intergenic
1154500322 18:14992816-14992838 GGTCCAAAGAAGCACAGGCAAGG + Intergenic
1156903712 18:42330419-42330441 GGCTCCCAGAACCACAAAGAAGG - Intergenic
1157702096 18:49767875-49767897 GGTGCTCAGCACCTCAGGGAGGG + Intergenic
1159304746 18:66626233-66626255 GATTCCCAGTACCACAGGGCTGG - Intergenic
1160444444 18:78915918-78915940 GGCCACCTGAACCACAGGGTGGG + Intergenic
1160502241 18:79407406-79407428 TTTCCCCAGAGCCACAGGCAGGG - Intronic
1160820149 19:1054117-1054139 GGACCCCAGGGCCACTGGGAAGG - Intronic
1160874538 19:1291005-1291027 GGGCCCCTGACCCACAGGGCAGG - Intronic
1160951961 19:1672057-1672079 GCACCCCCGGACCACAGGGAGGG - Intergenic
1161007449 19:1943697-1943719 CGTCCGCAGAGCCACTGGGACGG + Intronic
1161516614 19:4700044-4700066 GGTCCAGAGACACACAGGGAAGG + Intronic
1161740679 19:6019151-6019173 TGTGCCCATAACCACAGGGAGGG + Intronic
1162766639 19:12923959-12923981 GGACCCCAGATTCAGAGGGAGGG + Intronic
1163235925 19:16030563-16030585 GGAACACAGCACCACAGGGAGGG + Intergenic
1164371172 19:27645591-27645613 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1164635355 19:29787567-29787589 GCTCCCAAGAAGCACAGGGTGGG + Intergenic
1164679000 19:30121598-30121620 GGGCCCCAGACGCACAGAGAGGG - Intergenic
1164997407 19:32732423-32732445 GGTTCCCAGCCCCAGAGGGATGG - Intronic
1165086009 19:33347910-33347932 GGTCCCCAGCATCCCAGAGAAGG - Intergenic
1165852785 19:38859981-38860003 GGAGCACAGCACCACAGGGAGGG + Intergenic
1166090170 19:40503503-40503525 GGTCTCCAGGACAACAGGGGAGG + Intronic
1166739124 19:45103611-45103633 GTTCCCCAGGACAACAGGGAGGG + Intronic
1167030620 19:46957357-46957379 GGCCTCCAGAAGCACTGGGATGG - Intronic
1167235519 19:48312265-48312287 GCCCACCAGAACCACATGGAGGG - Intronic
1167281239 19:48570145-48570167 GGTTCCCACAGCCACAGGGAAGG - Intronic
1168115035 19:54217625-54217647 AGAGGCCAGAACCACAGGGAGGG - Intronic
1168120727 19:54251317-54251339 AGAGGCCAGAACCACAGGGAGGG - Intronic
1168181954 19:54667465-54667487 AGAGACCAGAACCACAGGGAGGG + Intronic
1168251663 19:55145661-55145683 GGCCCCCAGGACCCCAGGGAAGG + Intronic
924972346 2:140249-140271 TGTCCCCAGAGCAACAGAGAAGG - Intergenic
925501595 2:4511175-4511197 GATCCCCAGAAAGACAGGTAAGG - Intergenic
925631269 2:5895699-5895721 GCTTCCCAGAACCTGAGGGAAGG + Intergenic
927724457 2:25410643-25410665 GGTCCCCAGAGACACAGGTATGG + Intronic
928245083 2:29619904-29619926 GGTGCCCATACCCACAGTGAGGG + Intronic
929608147 2:43249449-43249471 GGTCACCCTGACCACAGGGAAGG - Intronic
930214973 2:48685884-48685906 GACCCCCAGCCCCACAGGGAAGG - Intronic
933972848 2:87484089-87484111 GGTCCCCTGCACCCCTGGGATGG - Intergenic
935383234 2:102474999-102475021 TGTCCCCACACCCACAGGGAGGG - Intronic
935420643 2:102865683-102865705 GGTCCCCACATCTAGAGGGAAGG + Intergenic
936320873 2:111466124-111466146 GGTCCCCTGCACCCCTGGGATGG + Intergenic
937868161 2:126769274-126769296 TTTCCCCAGAACCACCGGTAGGG - Intergenic
937919173 2:127118261-127118283 GGTCCACCCAACCTCAGGGAAGG + Intergenic
938194376 2:129314144-129314166 TGCCCCCAAGACCACAGGGATGG + Intergenic
938499525 2:131823162-131823184 GGTCCGAAGAAGCACAGGCAAGG + Intergenic
940694397 2:156959988-156960010 GGCCCCCAAGAGCACAGGGATGG + Intergenic
946240907 2:218355057-218355079 GGAGCACAGCACCACAGGGAGGG - Intergenic
947543361 2:230993544-230993566 GGTCCCAAGAAGCAGAGAGAGGG - Intergenic
948566337 2:238889522-238889544 GGACCCAAGAAACACAGGGATGG - Intronic
948666769 2:239539741-239539763 GGTAGCCAGCACCACAGTGAAGG + Intergenic
1168930372 20:1618686-1618708 TGACCCCAGAACCACAGGGCTGG - Intronic
1168938039 20:1685065-1685087 TGACCCCAGAATCACAGGGCTGG - Intergenic
1169703199 20:8472368-8472390 GGTCACCAGAACCCCAGTGATGG - Intronic
1171135960 20:22694575-22694597 GGTCCACAGAACCCGAGAGAAGG + Intergenic
1172164408 20:32890199-32890221 TGGCCTCAGCACCACAGGGAGGG - Intronic
1174084265 20:47994244-47994266 ACTCCCCAGACCCACAGGGAAGG - Intergenic
1174189697 20:48731613-48731635 GGTGCCCAGCACAACATGGATGG + Intronic
1175422023 20:58840656-58840678 GAGCCCCAGAGCCCCAGGGAAGG + Intronic
1175970970 20:62686770-62686792 AGTGCCCAGCACCACAGAGAAGG + Intergenic
1176231307 20:64034403-64034425 GGTCCCCAGAACCACAGGGAAGG - Intronic
1177248962 21:18567978-18568000 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1178167019 21:29990959-29990981 AGTCCCCAGAAATAAAGGGAAGG + Intergenic
1178409700 21:32353027-32353049 GGGACACATAACCACAGGGAAGG + Intronic
1178436898 21:32567693-32567715 GTGCCCCAGTCCCACAGGGAAGG + Intergenic
1178667309 21:34559850-34559872 GGACCACAGAATCACAGGGCAGG - Intronic
1178704032 21:34858204-34858226 TGTGGCCAGGACCACAGGGAAGG + Intronic
1178920032 21:36732691-36732713 GGTCTCCAGAATGACAGAGATGG - Intronic
1179046844 21:37852304-37852326 TCTCCCCAGAGCCACAGGGGAGG + Intronic
1179519119 21:41930854-41930876 GGACCTCAGACCCCCAGGGAAGG + Intronic
1179564157 21:42235902-42235924 GGCCCCCTGAACCATGGGGATGG - Intronic
1180837915 22:18940482-18940504 TGCCCCCAGCACCACAGGGCAGG + Intergenic
1180953196 22:19730022-19730044 GGTGCCCAGATCTGCAGGGAGGG - Intergenic
1180955252 22:19738544-19738566 CGACCCCAGACCCCCAGGGAGGG - Intergenic
1181575463 22:23791703-23791725 GGGTCGCAGCACCACAGGGAAGG - Intronic
1181914369 22:26267807-26267829 GGTCACCAGGACTGCAGGGAAGG + Intronic
1182012577 22:27012705-27012727 GGTTCCCAGAACCACAGGATAGG + Intergenic
1182481189 22:30609883-30609905 GGGACCCAGACCCACAGAGATGG + Intronic
1183032205 22:35114739-35114761 GCTCAGCGGAACCACAGGGATGG + Intergenic
1183621222 22:38973920-38973942 GGTGCTGAGAAACACAGGGATGG + Intronic
1184522523 22:45003554-45003576 GGCCTGCAGAGCCACAGGGATGG - Intronic
1184676643 22:46046579-46046601 TGGACCCAGCACCACAGGGAGGG + Intergenic
1184716618 22:46286220-46286242 GCTCCCAAGGACCCCAGGGATGG + Intronic
1184765270 22:46569051-46569073 GCTCCCCGGGATCACAGGGAGGG + Intergenic
1184893408 22:47393167-47393189 GGTACCCAGAGCCAAGGGGAAGG - Intergenic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
950141705 3:10620407-10620429 AGTCCCCAGAGCCACAGGCCAGG - Intronic
950315767 3:12000766-12000788 GGAACCCAGATCCACAGGTAAGG + Intergenic
952956728 3:38562318-38562340 GGACATCAGAAGCACAGGGAGGG + Intronic
955292037 3:57701043-57701065 GGTCCCCAGTCCCCCAGGCAAGG - Intergenic
957777335 3:84770392-84770414 GGTACACATAAACACAGGGATGG + Intergenic
958450889 3:94271207-94271229 GGTCCCAAGAACAAAAGGAAAGG - Intergenic
960028164 3:113031613-113031635 TGCCCCCAGCACCACAGGGCAGG - Intergenic
961296899 3:125892102-125892124 TGCCCCCAGCACCACAGGGCAGG + Intergenic
963408382 3:144898487-144898509 GGGCCACAGAGTCACAGGGATGG + Intergenic
963696027 3:148566747-148566769 TGCCCCCAGCACCACAGGGCAGG - Intergenic
965405955 3:168268999-168269021 GAACCCCAGAAACTCAGGGAAGG + Intergenic
966694575 3:182777250-182777272 AATCCCCAGAATCACAGGGTAGG + Intergenic
967026596 3:185569901-185569923 TGCCCCCAGCACCACAGGGCAGG - Intergenic
968637240 4:1686894-1686916 GTTCCCCAAAGCCACTGGGATGG + Intergenic
969203242 4:5622456-5622478 CATCCCCACAACCACAGGGCAGG + Intronic
969496080 4:7527082-7527104 GGTCCCCAGGGCCACAGAGAGGG - Intronic
969656013 4:8499002-8499024 GAGCCACAGAACCACAGAGAGGG - Intergenic
970090721 4:12404571-12404593 TGTCCACAGAAACACAGAGATGG - Intergenic
970380218 4:15499895-15499917 GGTCCCCAGCCACGCAGGGAAGG - Intronic
971899603 4:32642369-32642391 GATCCCCACAAACACAGGCATGG + Intergenic
971918762 4:32909822-32909844 AGTCCCCTGAACCACAGAGATGG - Intergenic
973739993 4:53910416-53910438 GGTTTCCAGAGGCACAGGGATGG + Intronic
973804710 4:54514690-54514712 TGTCCCCAGAACCAAAGAGTTGG + Intergenic
975761367 4:77623713-77623735 GGACCTCAGAAGAACAGGGAAGG + Intergenic
978990693 4:115078516-115078538 GTTCCACAGATCCACAGGGCAGG - Intronic
980451827 4:132983694-132983716 GGTCCCCAGAAGAAAAGAGATGG + Intergenic
982355081 4:154457722-154457744 GGTCCACAGAATCACCTGGAGGG + Intronic
982876760 4:160660427-160660449 TGCCCCCAGCACCACAGGGCAGG + Intergenic
985049360 4:185973757-185973779 GGTCACCAGAACTACAGGGGTGG + Intergenic
985889075 5:2701708-2701730 GGTCCACAGAACTAGAGGGCTGG - Intergenic
989391033 5:40900973-40900995 GGTCACCAGGACCAAAAGGATGG - Intergenic
990450688 5:55929475-55929497 GGACCCCAGAACCTCACGGCAGG + Intergenic
990677645 5:58205677-58205699 CTTACCCAGAACCACAGAGAAGG + Intergenic
992217054 5:74536596-74536618 GGCCCCCAGAACTGCATGGATGG + Intergenic
994252614 5:97554843-97554865 GGTCCCAAGAAGCAAAGGAAAGG + Intergenic
995547513 5:113247803-113247825 TGTCACCATAACCAGAGGGAGGG + Intronic
997074113 5:130651783-130651805 GATCCCAGGAACAACAGGGAAGG + Intergenic
997597324 5:135115835-135115857 GGTGCCCAGCACGTCAGGGACGG - Intronic
998266918 5:140673438-140673460 GGACCCCAGTACCACAGGAGAGG - Exonic
998341296 5:141420074-141420096 GGTCCCCCCAACTACAGTGAGGG + Exonic
998489772 5:142536472-142536494 GCACCCCAGCTCCACAGGGAGGG + Intergenic
999952428 5:156665055-156665077 TGCCCCCAGCACCACAGGGCAGG - Intronic
1001287913 5:170437193-170437215 CTTCCCTAGACCCACAGGGAAGG - Intronic
1002170173 5:177370519-177370541 TGTTCTCAGACCCACAGGGATGG + Intronic
1002662301 5:180799778-180799800 TCTTCCCAGAACCAAAGGGAGGG - Intronic
1003098201 6:3157903-3157925 GGGCCCCGGAACCAGGGGGAGGG + Intergenic
1003606987 6:7571203-7571225 GTTCCCAAGAGCCACAGGAATGG - Intronic
1003631942 6:7795262-7795284 GGCAGCCAGAACCACAAGGAAGG + Intronic
1004229136 6:13814861-13814883 GCTCCCCAGAACCACATGTTTGG - Intergenic
1005445486 6:25918291-25918313 GCTTCCCAGAACCACCAGGAAGG + Intronic
1006171399 6:32095461-32095483 GGGCAGCAGAACCACAGGGGTGG - Intronic
1006184261 6:32171408-32171430 GGGCTGCAGAACCACAGGGTGGG + Exonic
1007581183 6:42961037-42961059 CGGCCGCAGAACCACAGGGCCGG + Intronic
1007716600 6:43859712-43859734 TGGGCCCAGAAACACAGGGATGG + Intergenic
1008411312 6:51183261-51183283 GGTCCTCAGATCCGCCGGGAGGG - Intergenic
1009032241 6:58073483-58073505 GCTCCCCAGAACCACGGACACGG - Intergenic
1009673740 6:66788911-66788933 AGTCCCCAGTACCACAGGCTAGG - Intergenic
1010592215 6:77724544-77724566 TGCCCCCAGCACCACAGGGCAGG - Intronic
1011297662 6:85841117-85841139 GGTCCCCAGTCCCACTGGGTGGG + Intergenic
1014127877 6:117797760-117797782 CGAGTCCAGAACCACAGGGATGG + Intergenic
1014829209 6:126081542-126081564 AGTCCCCAGAACCTCACTGAAGG - Intergenic
1016811297 6:148263595-148263617 GGTGCCCAGAAGCACAGCTAAGG + Intergenic
1018092677 6:160358642-160358664 TGTCCCCAGAGCCACCCGGATGG - Intronic
1018144908 6:160877035-160877057 GTGCCCCAGTCCCACAGGGAAGG - Intergenic
1019123758 6:169825532-169825554 GGTCCTGACACCCACAGGGAAGG + Intergenic
1019739194 7:2664356-2664378 GGACCCCAGAACCCCAGACAAGG + Exonic
1019773581 7:2898872-2898894 TGTCCCTGGAACCACAGGGATGG - Intergenic
1019976889 7:4590067-4590089 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1019977824 7:4598570-4598592 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1020073076 7:5240234-5240256 GGTCCAGAGAAACACAGGAAAGG - Intergenic
1024373268 7:48610375-48610397 GCCCCACAGAACCACAGGGGCGG - Intronic
1024598414 7:50959578-50959600 GGGCCCCAGAAGCACAGAGCAGG - Intergenic
1025205794 7:56992772-56992794 TGTCCCCAGAACCTCAGCAAGGG + Intergenic
1025666146 7:63584166-63584188 TGTCCCCAGAACCTCAGCAAGGG - Intergenic
1028007493 7:85593474-85593496 GGGCCCCAGCACCACAGACAAGG - Intergenic
1029524955 7:101088654-101088676 GGACCCCAGCCCCACAGGGGTGG + Exonic
1029598069 7:101548255-101548277 GGCTCCCTGCACCACAGGGAGGG + Intronic
1029967173 7:104751960-104751982 TGCCCCCAGCACCACAGGGCAGG - Intronic
1030029082 7:105352398-105352420 GGTCCACAGAGCAACAGGCAAGG + Intronic
1030574693 7:111271494-111271516 GTACATCAGAACCACAGGGAAGG + Intronic
1031936347 7:127739178-127739200 ATTCTTCAGAACCACAGGGAAGG - Intronic
1034458764 7:151186677-151186699 GGGCCTCAGATCCCCAGGGAAGG + Intronic
1035403169 7:158581368-158581390 GGTACCCAGAGGTACAGGGATGG + Intronic
1036292432 8:7505515-7505537 TGCCCCCAGCACCACAGGGCAGG - Intronic
1038202559 8:25427926-25427948 GCTACCCAGAACCACAGGGCTGG + Exonic
1040616881 8:49046292-49046314 GGTCACCAGAACCACACTGGAGG + Intergenic
1043270710 8:78329732-78329754 GGTCCCAGGGACCACAAGGAGGG - Intergenic
1048517799 8:135126226-135126248 GGTCCCCAGAAAGTCAGTGAGGG - Intergenic
1048871580 8:138803604-138803626 GGGCCCCAGGTACACAGGGATGG - Intronic
1048947397 8:139462131-139462153 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1048986698 8:139738636-139738658 GGACCCCAGAACCACACGGCGGG + Intronic
1049344137 8:142129423-142129445 GGTCCCCAGGGCCACACGGCTGG - Intergenic
1049578982 8:143402337-143402359 GTTACTCAGCACCACAGGGAAGG - Intergenic
1049689952 8:143953978-143954000 GTGCCCCAGAACCACAGGCTGGG - Intronic
1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG + Intronic
1051426732 9:16939851-16939873 GGTGCCAAGAACCATAGGAAGGG + Intergenic
1052179327 9:25505280-25505302 GCCCCACAGAACCACAGGGGTGG - Intergenic
1052995403 9:34549414-34549436 GGGCCCAAGACCCACAAGGAAGG + Intergenic
1053560805 9:39192024-39192046 GGTCCCAGAAAACACAGGGATGG + Intronic
1053824907 9:42012274-42012296 GGTCCCAGAAAACACAGGGATGG + Intronic
1054136314 9:61426931-61426953 GGTCCCAGAAAACACAGGGATGG - Intergenic
1054605665 9:67175089-67175111 GGTCCCAGAAAACACAGGGATGG - Intergenic
1055452662 9:76444765-76444787 GGTCTCCAGAACAACACAGAGGG - Intronic
1056121820 9:83495789-83495811 GGTCACCATAAACACAGAGATGG + Intronic
1056289616 9:85129406-85129428 GGATCCCAGAATCACAGGGCTGG - Intergenic
1057009603 9:91589765-91589787 AGTCCCCAGAACTACATGGGTGG - Intronic
1057750359 9:97787830-97787852 GGTCATCAGGACCACAGGAAGGG + Intergenic
1058727034 9:107814154-107814176 AATCCCCAGAACCACAAGTAGGG - Intergenic
1058847764 9:108978908-108978930 GGTCCCAAGAACCTCTAGGAGGG + Intronic
1060912347 9:127361102-127361124 TGAGCCCAGAATCACAGGGAAGG + Intronic
1060934075 9:127505859-127505881 TGACCCCAGACCCTCAGGGAGGG + Exonic
1061480476 9:130895594-130895616 GGCACACAGAAGCACAGGGAGGG - Intergenic
1061664675 9:132153613-132153635 GGTCATCAGAACTACAGAGAGGG + Intergenic
1061882064 9:133573564-133573586 TCTCCCCAGATCCACAGTGAGGG - Intronic
1062285446 9:135770681-135770703 GGTCCCCAACACCTCTGGGACGG + Intronic
1186638853 X:11433786-11433808 GATCCTCAGAACAACTGGGAAGG + Intronic
1187412593 X:19063863-19063885 GGTCCCCAGAAGCAGAGTGGGGG + Intronic
1187747036 X:22420723-22420745 GTTCCCCAGAACCTGAGGCAAGG + Intergenic
1190124006 X:47687387-47687409 TGTCCCCAGAGCCTCAGGGCAGG + Intergenic
1193625860 X:83819446-83819468 AGTCTCCAGAACCTCAGAGATGG + Intergenic
1194239077 X:91422096-91422118 GGTAGCCAGAATCAGAGGGAAGG + Intergenic
1195246462 X:102999730-102999752 GGTCCTCACAACCATATGGAAGG + Intergenic
1196172276 X:112602580-112602602 TGTCCTCAAAACCACAGGGTAGG + Intergenic
1197121682 X:122900376-122900398 GGTCCCCAGAACCTCTGGTCAGG + Intergenic
1197333434 X:125181697-125181719 GGTCCACAGAAGGAGAGGGAAGG + Intergenic
1197345695 X:125324341-125324363 TGGCCCCAGAACCACAGAAATGG - Intergenic
1198056398 X:132999946-132999968 GGTCCCCAGAACTGCAGGTGTGG - Intergenic
1198263768 X:134990850-134990872 AGGCCCCAGAACCCCAGGAAGGG - Intergenic
1198672710 X:139098682-139098704 GGTACGCAGAAACACAGAGATGG + Intronic
1200055224 X:153456707-153456729 GGCCCTCAGCCCCACAGGGAAGG + Intronic
1200956297 Y:8949768-8949790 TGTACCCAGAGGCACAGGGAAGG - Intergenic