ID: 1176234299

View in Genome Browser
Species Human (GRCh38)
Location 20:64047222-64047244
Sequence CTTTCCTGAGGGAGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 1, 2: 2, 3: 37, 4: 304}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176234299_1176234315 18 Left 1176234299 20:64047222-64047244 CCTGCCAGCCTCCCTCAGGAAAG 0: 1
1: 1
2: 2
3: 37
4: 304
Right 1176234315 20:64047263-64047285 CCTTGGGCATGGAAGTTTTAAGG 0: 1
1: 0
2: 1
3: 26
4: 129
1176234299_1176234310 1 Left 1176234299 20:64047222-64047244 CCTGCCAGCCTCCCTCAGGAAAG 0: 1
1: 1
2: 2
3: 37
4: 304
Right 1176234310 20:64047246-64047268 GGGCCGTACTGGGCAGTCCTTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1176234299_1176234317 24 Left 1176234299 20:64047222-64047244 CCTGCCAGCCTCCCTCAGGAAAG 0: 1
1: 1
2: 2
3: 37
4: 304
Right 1176234317 20:64047269-64047291 GCATGGAAGTTTTAAGGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 140
1176234299_1176234319 30 Left 1176234299 20:64047222-64047244 CCTGCCAGCCTCCCTCAGGAAAG 0: 1
1: 1
2: 2
3: 37
4: 304
Right 1176234319 20:64047275-64047297 AAGTTTTAAGGTGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 243
1176234299_1176234311 2 Left 1176234299 20:64047222-64047244 CCTGCCAGCCTCCCTCAGGAAAG 0: 1
1: 1
2: 2
3: 37
4: 304
Right 1176234311 20:64047247-64047269 GGCCGTACTGGGCAGTCCTTGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1176234299_1176234313 7 Left 1176234299 20:64047222-64047244 CCTGCCAGCCTCCCTCAGGAAAG 0: 1
1: 1
2: 2
3: 37
4: 304
Right 1176234313 20:64047252-64047274 TACTGGGCAGTCCTTGGGCATGG 0: 1
1: 0
2: 1
3: 16
4: 176
1176234299_1176234316 21 Left 1176234299 20:64047222-64047244 CCTGCCAGCCTCCCTCAGGAAAG 0: 1
1: 1
2: 2
3: 37
4: 304
Right 1176234316 20:64047266-64047288 TGGGCATGGAAGTTTTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 187
1176234299_1176234308 -10 Left 1176234299 20:64047222-64047244 CCTGCCAGCCTCCCTCAGGAAAG 0: 1
1: 1
2: 2
3: 37
4: 304
Right 1176234308 20:64047235-64047257 CTCAGGAAAGGGGGCCGTACTGG 0: 1
1: 0
2: 0
3: 6
4: 104
1176234299_1176234309 -9 Left 1176234299 20:64047222-64047244 CCTGCCAGCCTCCCTCAGGAAAG 0: 1
1: 1
2: 2
3: 37
4: 304
Right 1176234309 20:64047236-64047258 TCAGGAAAGGGGGCCGTACTGGG 0: 1
1: 0
2: 0
3: 3
4: 86
1176234299_1176234318 29 Left 1176234299 20:64047222-64047244 CCTGCCAGCCTCCCTCAGGAAAG 0: 1
1: 1
2: 2
3: 37
4: 304
Right 1176234318 20:64047274-64047296 GAAGTTTTAAGGTGGAGGCAAGG 0: 1
1: 0
2: 3
3: 16
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176234299 Original CRISPR CTTTCCTGAGGGAGGCTGGC AGG (reversed) Intronic
900296438 1:1953943-1953965 CATTCCTCAGGGAGGAGGGCTGG + Intronic
900706343 1:4082502-4082524 CTTTACTGGGGGAGGGAGGCTGG + Intergenic
901600444 1:10419522-10419544 CTTACCTGGATGAGGCTGGCTGG - Exonic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903839433 1:26227783-26227805 CTTTCCTGCAGGAGCCTGGATGG + Intergenic
904343497 1:29853191-29853213 CTGTCCCGGGGGAGGCTGGCTGG - Intergenic
905238267 1:36565349-36565371 CCTTCCTGGGGGTGGCAGGCAGG + Intergenic
905705110 1:40050227-40050249 CTGTCCTAAGGGAGTCTAGCAGG - Intronic
906524209 1:46485194-46485216 CTCTGCTGGGGGTGGCTGGCGGG + Intergenic
907861188 1:58355248-58355270 CTTTACAGATGGAGACTGGCTGG - Intronic
909170463 1:72286603-72286625 ATTTCCTGAAGGAGGCAGTCAGG + Intergenic
909350489 1:74647232-74647254 CTTTCCTGAAGGAAGGGGGCGGG + Intronic
909942757 1:81630256-81630278 CTTTCCTGGAGAAGGCTGGGAGG - Intronic
911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG + Intronic
912822751 1:112880990-112881012 CTTTACTGAGGGAGGCCAGTTGG + Intergenic
915103218 1:153515546-153515568 CTTTCCTGAGCCAGGCTGCGTGG - Intergenic
915272889 1:154767665-154767687 CCTCCCTGAGGGAGGTGGGCAGG + Intronic
915318606 1:155043562-155043584 CTGCCCTGAGGGAGGCTGTAAGG + Intronic
917106209 1:171494774-171494796 CTTTCTTGAGGGAGGGGGGCAGG - Intronic
917653980 1:177107490-177107512 CTGTGCTGAGGGAGGATGACTGG + Intronic
918261308 1:182798850-182798872 CTTTCAGCAGGGAGGCAGGCAGG - Intronic
919847515 1:201650888-201650910 CTTTGCAGAGTGAGGCTGCCTGG - Intronic
920618727 1:207522670-207522692 CTTTCTTGAGGGTGGATGGTTGG + Intronic
921559541 1:216640441-216640463 CTTGCCTTAGGGAAGCTGGTTGG + Intronic
921957296 1:220998020-220998042 CTCTCCAGAGGCAGGCTGGGAGG - Intergenic
922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG + Intergenic
923335774 1:232968911-232968933 CCTTCCTGGGGAAGGCTGACAGG - Intronic
924624897 1:245689359-245689381 CATCCCTGAGAGAGGCTGCCAGG - Intronic
924852654 1:247845878-247845900 CTTTCTTGAGTGGGGCAGGCTGG - Intergenic
1064008563 10:11716813-11716835 CTTTCCTGAGGAAGTCAGTCTGG + Intergenic
1065528150 10:26643182-26643204 CTTTCCTGAGGAGAGGTGGCAGG + Intergenic
1066043671 10:31578381-31578403 CTCACCTGCTGGAGGCTGGCAGG - Intergenic
1066058362 10:31701640-31701662 CGTGGCTCAGGGAGGCTGGCAGG - Intergenic
1067090133 10:43262232-43262254 CTTCCGTGGAGGAGGCTGGCGGG - Intronic
1067849825 10:49747379-49747401 CTGGCCTGAGGGAGGAAGGCAGG + Intronic
1068197395 10:53734807-53734829 CTTTACTGAGAGAGCCTGGTGGG - Intergenic
1070612199 10:77940977-77940999 TTTTATTCAGGGAGGCTGGCTGG + Intergenic
1070922457 10:80196681-80196703 CTGCCCTGAGGCTGGCTGGCTGG - Intronic
1071430244 10:85601425-85601447 GTTTCCTCAGGGAGACTGGGCGG - Exonic
1071457181 10:85859967-85859989 CTTTCCTCAGGGAAGATGGCTGG + Intronic
1072221884 10:93333819-93333841 CATTCCTGTGGGACGCTGTCAGG + Exonic
1074363201 10:112838987-112839009 CTTCCCTGAGGGCTGCTGGCTGG + Intergenic
1075479200 10:122764944-122764966 CTTTCCTCAGGGAGGTCAGCTGG - Intergenic
1075623171 10:123942697-123942719 CCCTCCTGAGGGCTGCTGGCTGG - Intergenic
1076749083 10:132533145-132533167 CATGCATGAGGGATGCTGGCTGG + Intergenic
1077195400 11:1277341-1277363 CCTTCCTCAGGGAGGCCGGTGGG - Intronic
1077562636 11:3273555-3273577 CTCGCCTCAGGGAGGCTGGCAGG - Intergenic
1077568529 11:3319374-3319396 CTCGCCTCAGGGAGGCTGGCAGG - Intergenic
1078180537 11:9006349-9006371 CTTTCCTCAGGGAGGAAGCCAGG + Intergenic
1078572723 11:12473507-12473529 CTTTCCTCAGGGAAGCAGGGAGG - Intronic
1079247093 11:18760685-18760707 CCTTCCTGCGGGCAGCTGGCTGG - Intronic
1082883462 11:58060463-58060485 CTTTCCTTAGGCAGGAGGGCTGG - Intronic
1083233805 11:61339380-61339402 CTGTCCTGAAGAAGGCAGGCCGG + Exonic
1083268085 11:61556249-61556271 CTGGGCTGAGGGAGGGTGGCAGG - Intronic
1083306179 11:61762973-61762995 CTATCCCGAGGGAGGTGGGCAGG + Intronic
1083654108 11:64220736-64220758 CTTTCCTGAGGAAGGCTCTGTGG - Intronic
1085424419 11:76391275-76391297 CTTGCCTGGGGCAGGATGGCAGG + Intronic
1085514927 11:77106363-77106385 CTGTCCTGAGGGTGGGAGGCTGG - Intronic
1086657884 11:89382133-89382155 CTTTCCTGAGGGGGGAGGGCAGG + Intronic
1088657956 11:112019078-112019100 CTTTCCTGAGTGAAGCAGCCAGG - Intronic
1089164912 11:116468365-116468387 ATTTCCTGGGGGAAGCTGGATGG + Intergenic
1089298254 11:117482249-117482271 CTCTCCTGGGGGAGGAGGGCTGG - Intronic
1089759551 11:120712980-120713002 GTTTCCTGCGTGAGCCTGGCTGG + Intronic
1090326162 11:125887930-125887952 CGTTCCTGAGGGAGGCGGCCGGG + Intronic
1090375654 11:126286984-126287006 CTTTCAAGAGGGAGGCAGGAAGG - Intronic
1090989986 11:131808400-131808422 CTTTGCTGAAGGTGGCTGGAAGG - Intronic
1091061026 11:132462353-132462375 CTTTCCTGAGGCTGCCTGGTGGG + Intronic
1091384648 12:85367-85389 CTCTTGTGAGGGAAGCTGGCAGG + Intronic
1091847211 12:3666577-3666599 AGTTCCTGTGGGAGGCTGGCAGG - Intronic
1091852885 12:3714472-3714494 CTTTGCTGAGGGCTGCTGCCTGG - Intronic
1092158904 12:6304353-6304375 CTTTACTGAGGGCTGTTGGCTGG - Intergenic
1092239284 12:6827549-6827571 CTTCCCTGTGCGAGGCTGCCTGG - Intronic
1092526402 12:9312627-9312649 CTTCCCTGGGGGTGCCTGGCCGG - Intergenic
1094126203 12:27024496-27024518 GTTCCCTGAGGAAGGCTGGCTGG - Intronic
1094165044 12:27435203-27435225 CTTTGCTGTGGGAGCCTGTCCGG + Intergenic
1094496833 12:30994040-30994062 CTTTCAAGAGGCAGTCTGGCTGG - Exonic
1094512173 12:31103327-31103349 CTTCCCTGGGGGTGCCTGGCCGG - Exonic
1095421499 12:42028838-42028860 AGTTGCTGGGGGAGGCTGGCAGG + Intergenic
1095435809 12:42186427-42186449 CTTTCCTGAGGGGGGCAGAGGGG + Intronic
1096094102 12:48923392-48923414 CTTCCCTGATGGAGGCTGAAAGG + Intronic
1100678894 12:96897809-96897831 CTTCCCTGATGGATGCTGCCAGG - Intergenic
1101652151 12:106687074-106687096 TTCTCCTCAGGCAGGCTGGCTGG - Exonic
1101945239 12:109131377-109131399 CATTCTTGAGTGAGGCTGACAGG - Intronic
1102617456 12:114166992-114167014 CTGTCCTCAGGGAGGCTAGCAGG + Intergenic
1102768169 12:115451254-115451276 CATTCCCGAGGGAGGCCAGCAGG + Intergenic
1103058637 12:117841334-117841356 CGGTCCTGAGGGAGGATGGGAGG - Intronic
1103254842 12:119532150-119532172 CTTTCCTGAAGGAGCCTCACGGG - Intronic
1103381408 12:120496617-120496639 CTTTCCTAAGGGCGCCTGACAGG + Intronic
1103601828 12:122059377-122059399 CTGTCCTTGGGGAGGCAGGCGGG + Exonic
1104029770 12:125056407-125056429 CTTTGCTGCGGGAGTTTGGCTGG - Intergenic
1104801213 12:131556264-131556286 ATATCCTCAGGGATGCTGGCGGG - Intergenic
1105793732 13:23830420-23830442 CTTTCCTCTGGGAGGCAAGCGGG + Intronic
1106457126 13:29937303-29937325 CTTTCCTGATGGAGCCTGGCAGG - Intergenic
1106891069 13:34246104-34246126 CTTTCTTGAGGGAGGCTTCCTGG - Intergenic
1107734332 13:43381628-43381650 CTTTCCTGCCTAAGGCTGGCTGG - Intronic
1107803155 13:44129577-44129599 CTTTCTGGAGAGAGGCTGCCAGG - Intergenic
1108442229 13:50466637-50466659 CTTTCCTTAGGGCTCCTGGCTGG + Intronic
1113596164 13:111535014-111535036 CTCTCCTGAAGGCGGCTGGCTGG - Intergenic
1118596919 14:67442848-67442870 CTTCCCTTTGGGAGGCTGGAAGG - Intergenic
1119172693 14:72546911-72546933 CTTTCCTGAGAGTGGGTGGGAGG - Intronic
1119646292 14:76350888-76350910 CAGTGCTGAGTGAGGCTGGCAGG + Intronic
1121429023 14:93873855-93873877 CTTTCCTTAAGGAGGCTCCCTGG - Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1124115487 15:26838989-26839011 GTTTTCTGAAGGAGGCTGGAGGG - Intronic
1124159292 15:27254261-27254283 GTTTCCAGAGGGAGGGAGGCAGG + Intronic
1124954438 15:34350853-34350875 TTCTCCTGAGGGAGGCTGTGTGG + Intronic
1128128487 15:65210301-65210323 CTCTCATAAGGCAGGCTGGCTGG + Intronic
1128450592 15:67803946-67803968 CTTTACTGATGGAGGCTGCAGGG - Intronic
1128450632 15:67804145-67804167 CTGTCCAGAGGCAGGCAGGCGGG - Intronic
1129727020 15:77906518-77906540 CTGACCTGAGGGAGGCTCCCCGG - Intergenic
1130153854 15:81332902-81332924 CTGTGGGGAGGGAGGCTGGCGGG + Exonic
1130245885 15:82248299-82248321 CTTTCCAGAATGAGGCTGGGAGG - Intronic
1130454811 15:84095077-84095099 CTTTCCAGAATGAGGCTGGGAGG + Intergenic
1131047829 15:89327169-89327191 CTCTCCTGAGAGCAGCTGGCAGG + Exonic
1131077147 15:89502519-89502541 CTTGCCTGAGGTGGGCGGGCAGG - Intergenic
1132283084 15:100636995-100637017 TTTTCCTGAGAGTGTCTGGCGGG - Intronic
1132469835 16:96279-96301 CTTTCCTGAGGCTGTCTGGCAGG - Intronic
1135358824 16:21793597-21793619 CTGTCATGAGGGAGACTGGAAGG + Intergenic
1135457380 16:22610033-22610055 CTGTCATGAGGGAGACTGGAAGG + Intergenic
1136296733 16:29308292-29308314 ATTTCCTGAGAGAGGCTGCAGGG + Intergenic
1138385142 16:56631481-56631503 CTTTCCTTTAAGAGGCTGGCTGG + Intergenic
1139372964 16:66479933-66479955 TCTGCCTGAGGGGGGCTGGCAGG - Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1141605627 16:85151881-85151903 GATTGCTGAGGGAGGCTGGGAGG - Intergenic
1141846655 16:86613820-86613842 CTTCCCTGAGGGAGGCACGGTGG - Intergenic
1141965199 16:87437439-87437461 CTTTCCTCACGGAGGCTTTCTGG - Intronic
1142480339 17:215009-215031 CGTTCCTGTGGGTGGCTGCCGGG + Intronic
1142531183 17:580629-580651 CTGTCCTGAGGGAGGTTCTCTGG - Intronic
1142664773 17:1456277-1456299 CCTGCCCGAGGGAGGCTGCCGGG + Intronic
1142798774 17:2330617-2330639 CTTTCTTGTGGCAGGTTGGCTGG - Exonic
1142881068 17:2883033-2883055 CTCTTCTGAGGGAGGCTGCGGGG + Intronic
1143010846 17:3865484-3865506 GCTTCCTGTAGGAGGCTGGCGGG - Exonic
1143490151 17:7281504-7281526 CTTCCCAGTCGGAGGCTGGCGGG + Intergenic
1143681198 17:8477211-8477233 CTTTGCTGAGAGCGGCAGGCCGG - Intronic
1143867427 17:9934287-9934309 CCTTCCTGAGGCAGGATGGTGGG + Intronic
1144465843 17:15496494-15496516 CTTTCCTGAAGGACACTGGGAGG + Intronic
1146222124 17:31033315-31033337 CTTGTCCGGGGGAGGCTGGCTGG + Intergenic
1146351743 17:32101271-32101293 TTTTCCTCAGGGAGTCTTGCTGG - Intergenic
1147160194 17:38565029-38565051 GGCTCCTGGGGGAGGCTGGCTGG - Intronic
1148236207 17:45970868-45970890 CTCTCCTGAGGGAGGAAGGATGG - Intronic
1148847701 17:50538889-50538911 CGTCCCTGTGGGAGGCTGGGGGG - Exonic
1148913900 17:50958291-50958313 CCTTCCTGAAGGAGCCTAGCTGG - Intergenic
1149657865 17:58319700-58319722 GTTCCCTGAGAGAGGCGGGCAGG + Intronic
1150714262 17:67557953-67557975 CTTTCCTCAGAGAGGCAGCCCGG + Intronic
1150816571 17:68396688-68396710 GTTTGCTGGGGGAGGCTGGGTGG - Intronic
1151504324 17:74516613-74516635 CTCTCCTGAGGCAGGTTGGAGGG - Intergenic
1151574827 17:74947525-74947547 CCTTCCTGAGTGAGGCTTTCTGG - Intronic
1151972431 17:77465750-77465772 CTTTTCTGTGGTAGACTGGCAGG + Intronic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1153284922 18:3448732-3448754 TTTTTTTGAGGGAGGGTGGCAGG + Intronic
1153599425 18:6764587-6764609 GCTGCCTCAGGGAGGCTGGCAGG - Intronic
1153665958 18:7367828-7367850 CTTTCCTGAGGGGACCTGGGAGG + Intergenic
1153777806 18:8469042-8469064 CTTCCCTGACAGAGGCAGGCAGG + Intergenic
1153826000 18:8875499-8875521 CTTTCCTAAGGGGAGCTGGATGG + Intergenic
1155275379 18:24182429-24182451 CTTTCATGAGGCCTGCTGGCTGG + Intronic
1155306707 18:24485475-24485497 TTAGCCTGAGTGAGGCTGGCTGG - Intergenic
1159060721 18:63511324-63511346 CTTTCCTTAGGGAGGATGCCTGG + Intergenic
1159987305 18:74858201-74858223 CTGTCATGAGGAAGGCAGGCAGG - Intronic
1160791387 19:925319-925341 CTCCCCAGAGGGAGGCCGGCGGG + Intergenic
1160915997 19:1497041-1497063 CTCTGCTGAGGGTGGCTGCCCGG + Intronic
1161018728 19:1997563-1997585 CATGCCTGCTGGAGGCTGGCAGG - Intronic
1161338891 19:3730010-3730032 CTGTCCTGAGAGAGGAGGGCGGG - Exonic
1161766373 19:6211158-6211180 CTGGCCTGAGGGGGGCTGACCGG - Intergenic
1162553853 19:11374464-11374486 CTTCCCTGAGGGAGGCTGCTGGG - Intergenic
1162871193 19:13588025-13588047 TTTTCTTAAGGGAGGCAGGCTGG - Intronic
1163230477 19:15998499-15998521 CTCTCCTGGGGCAGGCTGGAAGG - Intergenic
1163660566 19:18574687-18574709 ATTTCCTGGGGCAGGCTGGCTGG + Intronic
1165040442 19:33064627-33064649 CTGGCCGGACGGAGGCTGGCGGG - Intronic
1165137822 19:33681482-33681504 ATGTCCTCAGGGAGGCTGCCAGG - Intronic
1167145402 19:47678567-47678589 CTTTCCTGAGGGTGCCCCGCTGG + Intronic
1167440927 19:49508386-49508408 CTTTGGAGAGGGAGGCAGGCGGG + Intronic
1168535766 19:57168274-57168296 CAGTCTTGAGGGAAGCTGGCTGG + Intergenic
925744540 2:7033114-7033136 CTTTCCACAGGGACTCTGGCTGG + Intronic
926349717 2:11983825-11983847 CTGTCCTGAGGGAGGCAAGGAGG - Intergenic
926597293 2:14805215-14805237 CTTTCCTCTGGGAAGCTGACTGG - Intergenic
927194555 2:20538684-20538706 CTTTCCTGATGGTGGCTGCAGGG + Intergenic
927220111 2:20699066-20699088 CTTTCCTGTGGCATTCTGGCTGG + Intronic
930928251 2:56847995-56848017 CCTTCCTGTTGGAGGGTGGCTGG + Intergenic
932174124 2:69584121-69584143 CTTTCTTGAAGGAGGCGGGTGGG - Intronic
934052329 2:88221165-88221187 CTTTCCTGGGGGTGGCTAGGAGG + Intergenic
934504607 2:94880514-94880536 CTGTACTGTGGGATGCTGGCAGG - Intergenic
935106091 2:100045064-100045086 GTTTCATCAGGGAGGCTGGTTGG - Intronic
935251975 2:101271049-101271071 CGTTCCTGACGGAGGCTGGACGG - Intergenic
936291358 2:111226388-111226410 ATATCAGGAGGGAGGCTGGCAGG + Intergenic
936648826 2:114403040-114403062 CTTCCTTGAGGGTGGGTGGCTGG + Intergenic
937917072 2:127104533-127104555 GTTTCCTGAGCAAGGATGGCAGG - Intronic
938029269 2:127978329-127978351 CTTCCTGGAGGGAGCCTGGCAGG - Intronic
940250073 2:151665299-151665321 GTTCCCTGGGCGAGGCTGGCAGG + Intronic
940839174 2:158559388-158559410 CATGCCTGAGGGAGGCAGGCAGG + Intronic
941096470 2:161244025-161244047 CTTTCCTAAGGTTGGCTGACTGG - Intergenic
943487650 2:188507067-188507089 CTTTCCTGAAGGCTCCTGGCAGG + Intronic
944692435 2:202170110-202170132 GTCACCTGAGGGAGGCTGGGTGG - Intronic
944770934 2:202912976-202912998 TTTTTCTGAGGGAGGATGGATGG + Intronic
945041456 2:205746553-205746575 CTCTGCTGAGGGAGGAGGGCTGG - Intronic
947369207 2:229427595-229427617 CTTGCCCCAGGGAGGCTGCCAGG + Intronic
948112215 2:235465065-235465087 CTTTCCTGAGAGAGGAGGGGAGG + Intergenic
948437824 2:237966161-237966183 TCTTCCTAAAGGAGGCTGGCGGG - Intergenic
948679931 2:239626956-239626978 ACTTCCAGAGGGAGGCTGACAGG + Intergenic
948901916 2:240960480-240960502 CATTTCTGAGGGGGGTTGGCAGG + Intronic
948954366 2:241275179-241275201 CTTTCCTGAGGCGGGGTGGGGGG - Intronic
1170201580 20:13749904-13749926 CTTTACTGAGGGTGGGTGGTGGG - Intronic
1170556449 20:17518821-17518843 CTCTCCTGAGGGAGGGATGCAGG - Intronic
1171194559 20:23187100-23187122 TCTTCCTGAGGGTGGCTGGCAGG + Intergenic
1171201430 20:23245135-23245157 CTTTCCTGAGGGAGGTGGCCAGG - Intergenic
1171345785 20:24465267-24465289 CCTTCCTGAGTGGAGCTGGCTGG - Intergenic
1171361215 20:24587633-24587655 CTTTCCTAAGCGAGGCCAGCTGG + Intronic
1172681562 20:36719713-36719735 CTTTCCTGAGGGAGTGTTGACGG - Intronic
1173322901 20:42005298-42005320 CTTCCTTGAGGGAGGCAGGCTGG + Intergenic
1173577191 20:44120108-44120130 ATTTACTGAGGGAGGCTTTCAGG - Intronic
1174343009 20:49909672-49909694 CTTTCCTGAGGCAGGAAGCCTGG + Intronic
1175105416 20:56611340-56611362 CTTTCCTGTGGGAGGCAGGAGGG + Intergenic
1175822408 20:61917473-61917495 CCTTCCTGTGGGAGGCTCGCAGG + Intronic
1175915748 20:62424926-62424948 CATTCCTGAAGGGTGCTGGCTGG + Intronic
1176234299 20:64047222-64047244 CTTTCCTGAGGGAGGCTGGCAGG - Intronic
1179044885 21:37835085-37835107 CATGCCTGAGAGAGACTGGCAGG + Intronic
1181015022 22:20063782-20063804 CTTTCCTGCCTGGGGCTGGCTGG + Intronic
1181054458 22:20253584-20253606 CTTTTATGAGGGAAGCTGGTTGG - Intronic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1182015081 22:27032572-27032594 CGTGCCTGTGGGAGGCGGGCCGG + Intergenic
1183708670 22:39489911-39489933 CTTCCTTGGGGCAGGCTGGCTGG + Exonic
1184172585 22:42768721-42768743 CATGCCTGAGGGTGGCTGGAGGG - Intergenic
1184368538 22:44068140-44068162 CTTTCCTGAGGCTGGCTTCCTGG - Intronic
1184690271 22:46114309-46114331 CTGTCCTGAGGGAGGACGGAAGG - Intergenic
1185068116 22:48642077-48642099 CTTTTCTGAGGGGGGCAGCCTGG + Intronic
1185257838 22:49846048-49846070 CTTTGCTGTGGGAGTTTGGCTGG + Intergenic
1185327360 22:50233481-50233503 CTTACCTGACGGAGGCGGGAAGG - Exonic
950548240 3:13651755-13651777 CTCCCCTGAGGGAGACAGGCGGG + Intergenic
950563329 3:13748790-13748812 CTTTCCTGGGGGTGGCTGGCAGG + Intergenic
950665984 3:14495163-14495185 ATCTGCTGAGGGAGGTTGGCAGG - Intronic
951751804 3:26044242-26044264 CTTTGGTGATGGAGGCTGGCTGG + Intergenic
952867750 3:37865930-37865952 CTTTGCTGTGGGAGGCAGGAGGG + Intronic
953094825 3:39765224-39765246 CATACCTGAGGGAGTCTGGGAGG - Intergenic
953812335 3:46123989-46124011 CTTCCCTGAGGGTGGCCCGCTGG - Intergenic
956561394 3:70580167-70580189 CTGTACTGAGGGAGGTTGGGGGG - Intergenic
957246070 3:77718505-77718527 TTTGCCTGAGGGAGGCAGTCTGG - Intergenic
959590894 3:108079513-108079535 CTCTCCAGAGGGAGCATGGCTGG + Intronic
961406585 3:126684024-126684046 CTCTCCTGAGCGGAGCTGGCTGG - Intergenic
961436967 3:126925925-126925947 CTTTCCTGAGGCTGGCTTGGTGG + Intronic
961456273 3:127026083-127026105 CATTCCTGAGTGGGGCTGGGAGG + Intronic
964144449 3:153441985-153442007 CTTTCCTGGGGGAGGGAGGAAGG - Intergenic
964480483 3:157134048-157134070 CTTTGCTGAGAGAGGTGGGCTGG - Intergenic
964623707 3:158739301-158739323 CTTTCCTGAGGGAGGCAAGATGG - Intronic
965596141 3:170413305-170413327 CTTTCCTGTGGGCGGCAGGTGGG + Intergenic
966374116 3:179278038-179278060 CATCCCTGTGGGAGGGTGGCCGG - Intergenic
966480369 3:180401417-180401439 CTTTCCTGAAGGAGGGTGACAGG - Intergenic
966876445 3:184324759-184324781 CAGTCCTGAGGCCGGCTGGCTGG - Intronic
967189884 3:186975961-186975983 GTTTCCTATGGGAGGCTGGGAGG - Intronic
968596289 4:1487573-1487595 CTGTCCTGAGGGGGTCAGGCAGG + Intergenic
968707449 4:2086757-2086779 CCTTCCTGGGGGAGCATGGCCGG + Intronic
969202661 4:5618179-5618201 ATCTCCTGAGGGAAGCTGCCTGG - Intronic
969308262 4:6337700-6337722 TTTTCCTGCTGGAGGCTGGTAGG - Intronic
969339844 4:6533326-6533348 CTTGTTTGAGGGAGGCTGGGAGG - Intronic
969613792 4:8240939-8240961 CTGTCCTCAGCGAGGGTGGCTGG - Exonic
975544960 4:75550807-75550829 CTTTCCTAAGTGGTGCTGGCAGG + Intergenic
976112548 4:81691440-81691462 CTTCCCTGATGGAGTCTGGGAGG + Intronic
976152351 4:82104901-82104923 CCTTCAAGAGGGAGCCTGGCTGG + Intergenic
976369722 4:84273534-84273556 CTTGCTTGAGGGTGGCAGGCGGG + Intergenic
978729956 4:112013982-112014004 CGTTCCTGAGTGAAACTGGCTGG - Intergenic
978892130 4:113842610-113842632 ATTTGATGAGGGAGGCTGGCAGG + Intergenic
981062770 4:140444369-140444391 CTTACTTGAGGGAGGATGGTAGG - Intronic
985679713 5:1249531-1249553 CTTGCCGGAGGGGGCCTGGCTGG - Intergenic
985794546 5:1952502-1952524 CTCTCCTGATGGGGCCTGGCAGG + Intergenic
986082533 5:4409589-4409611 CTTCACAGAGGGAGGCAGGCAGG - Intergenic
986376967 5:7142173-7142195 ATTTCCTGAGGGAGTGAGGCTGG - Intergenic
986948242 5:13049768-13049790 CTTTCCTGAGGGTGGGCTGCCGG - Intergenic
987023365 5:13898053-13898075 CTTTCCTGAGGAAAGCTGGAAGG - Intronic
988166960 5:27605183-27605205 ATTTCCTGAGGGACGGTGGGAGG - Intergenic
990835175 5:60011086-60011108 TTTTCCTCAGTGAAGCTGGCAGG - Intronic
991037675 5:62144377-62144399 CTTCCCAGATGGAGACTGGCAGG - Intergenic
991975392 5:72179544-72179566 CTTTCCTGCGGCAGGCGGGCGGG - Intronic
995862502 5:116656572-116656594 CTATCCTGTGGTAGGCTGGTAGG - Intergenic
996100231 5:119437721-119437743 CTTCCCTGGGGGGGACTGGCAGG - Intergenic
996324535 5:122258213-122258235 CTGTCCTGATGGGGGATGGCAGG + Intergenic
996853664 5:127980515-127980537 CTTTTATGAGGGAGGCTTGCAGG - Intergenic
997889255 5:137660407-137660429 CTGTCCTGTGGGAAGCTGGCTGG - Intronic
998562681 5:143186068-143186090 CTTTCTTGAGGGTGGCAGGTGGG - Intronic
999954508 5:156685909-156685931 CTTTCCTGAGGGTGGAGGGTGGG + Intronic
1001096257 5:168777838-168777860 CTTTCCTTTGGGAGGAAGGCTGG + Intronic
1002382256 5:178839288-178839310 CCTGCCTGAGGCAGGCTGGAGGG - Intergenic
1002467288 5:179413941-179413963 ATTGTCCGAGGGAGGCTGGCAGG - Intergenic
1003749704 6:9041639-9041661 GTTTCCTTAGGGAGGTTGGAAGG + Intergenic
1006837215 6:37006171-37006193 CTTTTCTGAGAGGTGCTGGCAGG - Intronic
1007253880 6:40515218-40515240 GGATGCTGAGGGAGGCTGGCAGG + Intronic
1007433367 6:41789256-41789278 CTTTGCTGCGGGAGTTTGGCTGG + Exonic
1007618095 6:43194139-43194161 GGTTCCTGAGGGAGACAGGCAGG + Intronic
1007733780 6:43967873-43967895 CTTCCCCGGGGGAGGCAGGCTGG - Intergenic
1008434341 6:51457452-51457474 CTTTCCAGAGGGAGGCTGGCTGG + Intergenic
1009905827 6:69868374-69868396 CCTTCCTGAGGAGGGCTGACAGG + Intronic
1010206063 6:73323474-73323496 CTTTCCTGCAGGAGGGTGGGAGG - Intergenic
1010451817 6:76012554-76012576 CTTTCCTGTTGGAGACTGGGAGG + Intronic
1015212679 6:130715768-130715790 CTTCCCTGAGGTAGGAAGGCAGG + Intergenic
1016874005 6:148846958-148846980 CTCTCCTGAGTGAGGCAGGCTGG + Intronic
1019530467 7:1500483-1500505 CTTTGCTGAGGGTGGATCGCTGG - Intronic
1019573568 7:1725258-1725280 ATTCCCAGAGGGAGGCTGCCCGG + Intronic
1022972817 7:35532782-35532804 ATTTTCTAAGGGAAGCTGGCAGG - Intergenic
1023466557 7:40462235-40462257 AATGTCTGAGGGAGGCTGGCAGG + Intronic
1024262566 7:47582968-47582990 CTCTTCTGTGAGAGGCTGGCGGG - Intergenic
1024928447 7:54643212-54643234 CTCTCCTGTGTGTGGCTGGCAGG - Intergenic
1026033541 7:66815603-66815625 CTTCCCGGAGGGGGGCAGGCAGG + Intergenic
1026133471 7:67639295-67639317 CTACCCTGAGGGATGCTGCCTGG - Intergenic
1026458039 7:70589857-70589879 CTTTCCTGAGGGGCTCTGTCAGG - Intronic
1027151009 7:75733640-75733662 GCTTCCTGGAGGAGGCTGGCAGG + Intronic
1028650660 7:93147123-93147145 ATTTCCAGAGAGAGACTGGCTGG - Exonic
1028672707 7:93421772-93421794 CTTACCCGTGAGAGGCTGGCTGG + Intergenic
1029577605 7:101413740-101413762 CCATCCTGATGGAGGCTGCCGGG + Intronic
1030820134 7:114084778-114084800 CTTTCCCCAGGGAGGAGGGCCGG + Intergenic
1031585872 7:123532480-123532502 TTTTTCTGAGGGAGGATGGATGG - Exonic
1032127631 7:129206275-129206297 CTTGCCCGAGAGAGGCTGGTAGG - Exonic
1032391655 7:131558784-131558806 CTTTCTGGAATGAGGCTGGCTGG + Intergenic
1034201177 7:149283883-149283905 CCTTCCTGAGGGATTCTGACAGG - Exonic
1035812713 8:2505934-2505956 CTTTCCTGAAGGAGACTGCATGG + Intergenic
1038408386 8:27339785-27339807 CTTTACTGATGGTGGTTGGCAGG + Intronic
1038492675 8:27981906-27981928 ATTTCCTGGGAGGGGCTGGCTGG - Intronic
1039467466 8:37795045-37795067 CTTTCCTGAGGAATGCAGCCTGG + Intronic
1041956843 8:63565761-63565783 TATTCCTGACGGAGGCTGGCAGG - Intergenic
1042069666 8:64917336-64917358 CTTTCCCTATGCAGGCTGGCAGG + Intergenic
1044528179 8:93276037-93276059 CTTTTCTGAGGGAGCATTGCAGG + Intergenic
1044528866 8:93285036-93285058 CTTTGCTGAAGGAAGCTGGCTGG - Intergenic
1047039518 8:120977342-120977364 CTTTCCTAACTGAGGCTGGGAGG - Intergenic
1047694912 8:127393851-127393873 CTCTTCTGAGTGAGGCTTGCAGG - Intergenic
1049274479 8:141712957-141712979 CTTTTCAGAGGGAGGATGGAAGG + Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049507681 8:143012371-143012393 CTTCTCTGAGTGAGGCTTGCTGG + Intergenic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1049800534 8:144515615-144515637 CTCCCCTGAAGGAGGGTGGCAGG - Intronic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1049830901 8:144700252-144700274 TTCTCCTGAGGGAGCCAGGCGGG + Intergenic
1049852961 8:144843968-144843990 CCTTCCTCAGAGAGGCAGGCTGG + Intronic
1053431884 9:38047482-38047504 CTTCCCTGTTGGAGGCAGGCAGG - Intronic
1056220707 9:84448286-84448308 CTTACCAGAGGGAGGCAGGAGGG + Intergenic
1056758040 9:89394623-89394645 CTCTGCTGCAGGAGGCTGGCTGG + Intronic
1057927896 9:99169311-99169333 CATTTCTGAGAGAGGCAGGCAGG + Intergenic
1058947200 9:109868861-109868883 CATTCCTGAGGGAGGATGGAGGG + Intronic
1060820213 9:126657568-126657590 GCCTCCTCAGGGAGGCTGGCTGG + Intronic
1061569947 9:131470966-131470988 CTTACCTGAGGGATGCAGGGCGG - Exonic
1061625982 9:131840939-131840961 CTCTCCTGAGGGAGGAAGCCAGG + Intergenic
1061919177 9:133772764-133772786 CTGTCCTGAGAGATGCAGGCAGG + Intronic
1062292801 9:135804838-135804860 CTGTTCTGAGGGTGGCGGGCAGG - Intergenic
1062590820 9:137273818-137273840 AATTTCTGAGGGAGGTTGGCAGG + Intergenic
1062631481 9:137464999-137465021 CCTTCCTCAGTGAGGCAGGCAGG + Intronic
1185571661 X:1139320-1139342 CTTTTCTGAGCTAGGCGGGCAGG - Intergenic
1185952473 X:4451950-4451972 CTTCAGTGAGGGAGGCTGGATGG + Intergenic
1189436608 X:40998366-40998388 CTGTCCAGAGAGAGGTTGGCAGG - Intergenic
1197904877 X:131413980-131414002 CTTACCTGAGGGTGGCAGGTGGG + Intergenic
1201722324 Y:17113193-17113215 CTATCCTGAGGAAGGATGGAGGG - Intergenic