ID: 1176234851

View in Genome Browser
Species Human (GRCh38)
Location 20:64049444-64049466
Sequence CCGCGACTGTGCATGGGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176234851_1176234861 11 Left 1176234851 20:64049444-64049466 CCGGGGCCCATGCACAGTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1176234861 20:64049478-64049500 GTCGTCCTGTGCGCCGTAGCCGG 0: 1
1: 0
2: 0
3: 0
4: 12
1176234851_1176234863 15 Left 1176234851 20:64049444-64049466 CCGGGGCCCATGCACAGTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1176234863 20:64049482-64049504 TCCTGTGCGCCGTAGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 34
1176234851_1176234862 12 Left 1176234851 20:64049444-64049466 CCGGGGCCCATGCACAGTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1176234862 20:64049479-64049501 TCGTCCTGTGCGCCGTAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176234851 Original CRISPR CCGCGACTGTGCATGGGCCC CGG (reversed) Exonic
903043939 1:20552409-20552431 CCGCGCCTGTGCAGGGTCCCGGG + Intergenic
907238948 1:53070062-53070084 CCGAGACTGTGCCTGTTCCCAGG + Exonic
912460388 1:109827025-109827047 CCACGGCTGTGCCTGGGGCCCGG - Intergenic
916187397 1:162146374-162146396 CCCCAACTGTGCATGTGCTCAGG - Intronic
1062774848 10:135945-135967 CCCGGACTGCGCACGGGCCCAGG - Intronic
1064081135 10:12308910-12308932 CCGGGACTGAGCCTGAGCCCGGG - Intergenic
1067087395 10:43250176-43250198 CCGAGACTGCGCATTGGCCAAGG - Intronic
1068276846 10:54811306-54811328 CCGCATCAGTGCTTGGGCCCTGG - Intronic
1073446668 10:103585054-103585076 TCGCCGCTGTGCAGGGGCCCGGG - Exonic
1076269064 10:129134528-129134550 CATCGACTGTGCATTGGCCGTGG - Intergenic
1077491335 11:2862342-2862364 CCGCGACTGGGCAGGGGGCCGGG - Intergenic
1080190410 11:29538542-29538564 CTGGCACTGTTCATGGGCCCTGG + Intergenic
1081794711 11:45811365-45811387 CCCCGCCTGTGTACGGGCCCCGG - Exonic
1083272876 11:61580887-61580909 CCGCCGCTGGGCATGGGGCCGGG + Intronic
1084456323 11:69270058-69270080 CAGCCACTGTGGAGGGGCCCAGG - Intergenic
1085519530 11:77129978-77130000 CCGCACCTGGGCCTGGGCCCGGG - Intronic
1085822857 11:79811628-79811650 CCACGGCTGTGCATGGGCTATGG + Intergenic
1097463835 12:59898001-59898023 CCACGACTGTGGCTGGGCCCAGG - Intergenic
1098890553 12:76006202-76006224 CAGCCACTGTGCTTGGGTCCCGG + Intergenic
1101440151 12:104697846-104697868 ATGCCACTGTGCATGGTCCCAGG - Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1113473296 13:110561786-110561808 CCGCGGCGGTGAAAGGGCCCGGG - Intergenic
1113768465 13:112894690-112894712 CCGCGAGTGTCCAGGCGCCCAGG + Intronic
1114673934 14:24429005-24429027 CCGGGACTGTGTAGGGGACCTGG + Exonic
1119197943 14:72731519-72731541 CAGGGACTGTGCAGGGTCCCAGG - Intronic
1119736586 14:76986480-76986502 CCATCACTGGGCATGGGCCCTGG + Intergenic
1121741019 14:96252439-96252461 CTGGGTCTGTGCATGTGCCCTGG + Intronic
1122840961 14:104462295-104462317 CCCCGACTGTGCGTGGGTGCCGG + Intergenic
1124340343 15:28886151-28886173 CCGCGACTGCTAATGAGCCCGGG - Exonic
1130061319 15:80572203-80572225 CCGCCCCTGTGCATTTGCCCTGG - Intronic
1133076159 16:3282866-3282888 TCGCGACTGCGCGTGCGCCCTGG - Intronic
1133185772 16:4097236-4097258 CTGGGAATGTGAATGGGCCCAGG - Intronic
1135074620 16:19382761-19382783 CTGAGACTGTACATGAGCCCGGG + Intergenic
1137841998 16:51649446-51649468 CAGCCACTGTGCCTGGCCCCAGG + Intergenic
1140122929 16:72099024-72099046 CCGCGTCTGTCCAGGGGCCGAGG + Exonic
1141519934 16:84571859-84571881 CAGCAACTCTGCAGGGGCCCAGG + Intronic
1143615338 17:8046153-8046175 CAGCGACTGTGGGTGGACCCTGG - Intronic
1143632778 17:8148316-8148338 CCTCCACTCTGCCTGGGCCCAGG + Intronic
1144520839 17:15951373-15951395 CCTGGCCTGTGCATGGGACCAGG - Intronic
1145904088 17:28506953-28506975 CCAGGCCTCTGCATGGGCCCAGG - Intronic
1148718926 17:49736695-49736717 CTGAGATTTTGCATGGGCCCAGG + Intronic
1151831796 17:76557195-76557217 CCGCGGCTGCCCAGGGGCCCGGG - Intergenic
1152608660 17:81305203-81305225 CAGGGGCTGTGCCTGGGCCCTGG - Intergenic
1152659838 17:81537126-81537148 CCGCAGCTGTGGGTGGGCCCCGG + Intronic
1154012040 18:10582554-10582576 GCGGGACTGTGCATGGGGCCTGG + Intergenic
1157282356 18:46354369-46354391 CTGAGTGTGTGCATGGGCCCTGG - Intronic
1159107562 18:64020606-64020628 CTGCCAATGTGCCTGGGCCCTGG + Intergenic
1160521649 18:79511520-79511542 CCGCCACTGTGCCATGGCCCTGG - Intronic
1161041976 19:2115140-2115162 AGGCCACTGTGCATGGCCCCAGG + Intronic
1161479858 19:4505029-4505051 CCAGGACTGTGAATGTGCCCAGG - Intronic
1167762210 19:51457062-51457084 CTGCCACTGTGCGTGAGCCCAGG - Intronic
1167765659 19:51480530-51480552 CTGCCAGTGTACATGGGCCCAGG - Exonic
1168242701 19:55095395-55095417 CCTCGACTGGGCAGGGGCCTGGG + Intronic
934517141 2:94995720-94995742 CCTTGGCTGTGCATGGGTCCAGG - Intergenic
936574423 2:113641548-113641570 CTGGGACAGTGCATGGGCCTGGG + Intronic
937290870 2:120781031-120781053 CTTCCACTCTGCATGGGCCCTGG + Intronic
943445652 2:187984097-187984119 CCACCACTGTGCATGGGGCTTGG + Intergenic
943651035 2:190457795-190457817 CCTCAACTATGCATGTGCCCTGG + Intronic
947593525 2:231397605-231397627 CCGGGACTGAGCCTGTGCCCAGG + Intronic
1175989752 20:62782448-62782470 GCGGGAGTGTGCAAGGGCCCTGG - Intergenic
1176234851 20:64049444-64049466 CCGCGACTGTGCATGGGCCCCGG - Exonic
1180160353 21:45996392-45996414 CCCCGACTGTGCAAGCACCCAGG - Intronic
1180800800 22:18631042-18631064 CCGGGGCTGTCCCTGGGCCCAGG - Intergenic
1180852033 22:19026599-19026621 CCGGGGCTGTCCCTGGGCCCAGG - Intergenic
1181046532 22:20217281-20217303 CCGGGAATGAGCATGTGCCCGGG - Intergenic
1181220917 22:21364220-21364242 CCGGGGCTGTCCCTGGGCCCAGG + Intergenic
1183702507 22:39458011-39458033 CCCCGACTGCGCTTGGGCCTCGG - Intronic
1184955895 22:47885700-47885722 TCGCCACTGTGCCCGGGCCCTGG + Intergenic
1185218960 22:49619419-49619441 CCTCGACTCAGCCTGGGCCCTGG + Intronic
1185302520 22:50089976-50089998 CCGCGCCTGGGCATGCGCCTTGG - Intronic
1185425746 22:50769335-50769357 CCGGGACAGTGCATGGGCATGGG - Intronic
953027305 3:39152698-39152720 GCGTGCCTGTGAATGGGCCCCGG + Intronic
959185406 3:103040429-103040451 AGGCAACTGTTCATGGGCCCTGG - Intergenic
959621019 3:108398543-108398565 GGGCGACTGTGCATGGTCCAAGG + Intronic
961577724 3:127851810-127851832 CCAGGACTGTGGATGGGCCTTGG + Intergenic
968704895 4:2073239-2073261 CCTGGACTGTGGATGGGGCCGGG - Intronic
984928321 4:184825858-184825880 CCGCGGCGGTGCCCGGGCCCCGG - Intronic
1002873429 6:1188545-1188567 CCACGAATGTGGATGCGCCCTGG - Intergenic
1011628401 6:89301988-89302010 CCGACACTGTCCATGGTCCCGGG - Intronic
1017728091 6:157289854-157289876 TCGCGTCAGGGCATGGGCCCAGG - Exonic
1018735911 6:166687077-166687099 CTGCGACTCTGCCTGGGCCGTGG + Intronic
1032654305 7:133910932-133910954 GTGCGAGTGTGCATGGTCCCTGG - Intronic
1035224432 7:157425595-157425617 CAGCGTCTGTGGATAGGCCCTGG - Intergenic
1035376723 7:158411433-158411455 CCGGGCATGTGCAAGGGCCCAGG - Intronic
1048348364 8:133595505-133595527 CCCCAACTCTGCATGGGCTCAGG - Intergenic
1049915189 9:310886-310908 CCCCGACTGTGGGTGGGACCTGG + Intronic
1058907328 9:109492341-109492363 CCAGGACTGTGCAGGGGCCATGG - Intronic
1062472992 9:136714388-136714410 CCCCGACTGGGCTTGGGCCAGGG - Intronic
1195022072 X:100838961-100838983 CAGCCACTGTGCTTGGCCCCTGG - Intronic
1202147341 Y:21813081-21813103 CCAGGACTGTGCTTGGTCCCTGG - Intergenic