ID: 1176235108

View in Genome Browser
Species Human (GRCh38)
Location 20:64050302-64050324
Sequence GAGCAGGGACGCAGAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1132
Summary {0: 1, 1: 0, 2: 4, 3: 88, 4: 1039}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176235097_1176235108 6 Left 1176235097 20:64050273-64050295 CCCTGGACGGAGCCCACAAAGAG 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1176235108 20:64050302-64050324 GAGCAGGGACGCAGAGGCTGTGG 0: 1
1: 0
2: 4
3: 88
4: 1039
1176235104_1176235108 -7 Left 1176235104 20:64050286-64050308 CCACAAAGAGAAGGGGGAGCAGG 0: 1
1: 0
2: 1
3: 43
4: 392
Right 1176235108 20:64050302-64050324 GAGCAGGGACGCAGAGGCTGTGG 0: 1
1: 0
2: 4
3: 88
4: 1039
1176235103_1176235108 -6 Left 1176235103 20:64050285-64050307 CCCACAAAGAGAAGGGGGAGCAG 0: 1
1: 0
2: 2
3: 35
4: 306
Right 1176235108 20:64050302-64050324 GAGCAGGGACGCAGAGGCTGTGG 0: 1
1: 0
2: 4
3: 88
4: 1039
1176235098_1176235108 5 Left 1176235098 20:64050274-64050296 CCTGGACGGAGCCCACAAAGAGA 0: 1
1: 0
2: 0
3: 4
4: 133
Right 1176235108 20:64050302-64050324 GAGCAGGGACGCAGAGGCTGTGG 0: 1
1: 0
2: 4
3: 88
4: 1039

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176235108 Original CRISPR GAGCAGGGACGCAGAGGCTG TGG Intronic
900092226 1:925456-925478 GAGCCGGGACACAGGGGGTGCGG + Intronic
900294659 1:1942844-1942866 GAGGGGGGACCCAGAGGGTGTGG + Intronic
900325831 1:2108249-2108271 GGGCAGGGGCGAAGAGGCCGGGG - Intronic
900430388 1:2598604-2598626 GAGCAGGGGCAAAGATGCTGAGG + Intronic
900537348 1:3185456-3185478 GTGCAGGGATGCCCAGGCTGCGG + Intronic
900544557 1:3221201-3221223 GCGGAGTGAGGCAGAGGCTGTGG - Intronic
900568978 1:3349041-3349063 CAGCATGGCCGGAGAGGCTGGGG + Intronic
900672820 1:3866314-3866336 GTGCAGGGAGGCAGAGGTTGCGG - Intronic
900738893 1:4318607-4318629 AACCGGGGAGGCAGAGGCTGCGG - Intergenic
900951317 1:5859634-5859656 CAGCAGAGACGCAGGAGCTGAGG + Intergenic
901181919 1:7347758-7347780 GAGGATGGAGGCAGAGGCTGGGG - Intronic
901363937 1:8729299-8729321 AACCAGGGAGGCAGAGGTTGTGG - Intronic
901435850 1:9247112-9247134 CAGCGGGCAGGCAGAGGCTGGGG - Intronic
901739650 1:11333917-11333939 GGGGAGGGAGGCAGAGGCAGCGG + Intergenic
901792222 1:11660238-11660260 GAACCGGGAGGCAGAGGTTGTGG - Intronic
901798783 1:11695135-11695157 GAGCAGGGATGATGAGTCTGAGG + Intronic
901829262 1:11882114-11882136 GACCACGGAGGCAGAGACTGGGG + Intergenic
901957548 1:12797467-12797489 GGGCAGTGAGGTAGAGGCTGTGG - Intergenic
901965555 1:12863221-12863243 GAGCAGTGAAGTAGAGGCTGTGG - Intronic
901980955 1:13033599-13033621 GAGCAGTGAAGTAGAGGCTGTGG - Intronic
902001132 1:13195331-13195353 GAGCAGTGAAGTAGAGGCTGTGG + Intergenic
902020364 1:13341035-13341057 GAGCAGTGAAGTAGAGGCTGTGG + Intergenic
902419271 1:16265169-16265191 AAACTGGGAGGCAGAGGCTGCGG - Intronic
902593343 1:17490705-17490727 AACCTGGGAGGCAGAGGCTGTGG + Intergenic
902790718 1:18766037-18766059 GAGAATGGATGCTGAGGCTGTGG - Intergenic
902857005 1:19214905-19214927 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
902909086 1:19581865-19581887 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
903060428 1:20664905-20664927 GAGCAGCCTCGCAGAGCCTGGGG - Intronic
903097409 1:20990589-20990611 AACCCGGGAGGCAGAGGCTGCGG + Intronic
903224609 1:21887542-21887564 GAACCGGGAAGCAGGGGCTGAGG + Exonic
903500001 1:23795424-23795446 GAGCAGGGAGGCAGTGGGGGAGG + Exonic
903665509 1:25005014-25005036 GAGGAGGGACGGGGAGGCTGTGG - Intergenic
903772201 1:25771029-25771051 GAGCAGGGCCTCACAGGCTGTGG - Intronic
903834245 1:26192510-26192532 AAGCAGGGAGGCGGAGGTTGCGG + Intronic
903946574 1:26967792-26967814 GGGCAGGGAGCCAGAGGGTGGGG - Intergenic
904524818 1:31125049-31125071 GAACTGGGAGGCAGAGGTTGCGG + Intergenic
904530738 1:31167224-31167246 TGGCAAGGACACAGAGGCTGTGG - Intergenic
904649188 1:31991727-31991749 GAGCTGGGAAGTAGAGGTTGCGG - Intergenic
904658084 1:32064413-32064435 AACCCGGGAGGCAGAGGCTGTGG - Intergenic
904665520 1:32117999-32118021 GAACTGGGAGGCAGAGGTTGCGG - Intronic
904703627 1:32374434-32374456 GAGCATGGATGCTAAGGCTGTGG - Intronic
904711169 1:32431502-32431524 GTGTAGTGACGCAGAGGCAGAGG - Intergenic
904730382 1:32586239-32586261 AACCCGGGAGGCAGAGGCTGTGG + Intronic
905031268 1:34885805-34885827 GCGCAGAGACGCAGTGGGTGAGG + Intronic
905189902 1:36225180-36225202 GAGCATGGCAGCAGAAGCTGGGG + Intronic
905222477 1:36458304-36458326 AACCTGGGAGGCAGAGGCTGCGG - Intronic
905229013 1:36501150-36501172 AACCAGGGAGGCAGAGGTTGCGG - Intergenic
905283083 1:36861446-36861468 GTGCTGGGAAGGAGAGGCTGGGG + Intronic
905314634 1:37074103-37074125 GCGCACGGAGGCAGGGGCTGGGG + Intergenic
905552404 1:38853667-38853689 AACCAGGGAGGCAGAGGTTGCGG + Intronic
905698707 1:39995565-39995587 AACCCGGGAGGCAGAGGCTGTGG + Intergenic
905748514 1:40440507-40440529 AACCAGGGAGGCAGAGGTTGCGG - Intergenic
905832958 1:41089027-41089049 AAGCAGAAACTCAGAGGCTGGGG - Intronic
905945899 1:41901215-41901237 GAGGAGAGACTCACAGGCTGAGG + Intronic
906076179 1:43053824-43053846 GATCTGGGAGGCAGAGGTTGTGG + Intergenic
906135597 1:43498505-43498527 AACCCGGGAGGCAGAGGCTGTGG - Intergenic
906505734 1:46378273-46378295 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
906734944 1:48116355-48116377 GAGCATGGAGGCAAAGGGTGAGG - Intergenic
907088830 1:51705489-51705511 AACCAGGGAGGCAGAGGTTGTGG - Intronic
908324824 1:63013476-63013498 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
908327013 1:63032792-63032814 GAGCATGGACACAAAGGGTGAGG + Intergenic
908458906 1:64330330-64330352 AACCTGGGAGGCAGAGGCTGCGG - Intergenic
908540476 1:65117437-65117459 AACCAGGGAGGCAGAGGTTGGGG - Intergenic
909465063 1:75964181-75964203 GAACCGGGAGGCAGAGGTTGTGG + Intergenic
909655918 1:78032378-78032400 AAGCAGGGAGGCGGAGGTTGTGG + Intronic
910420995 1:87063412-87063434 AACCTGGGAAGCAGAGGCTGCGG - Intronic
910953685 1:92678413-92678435 TTGCAGGTACTCAGAGGCTGAGG + Intronic
911187359 1:94917112-94917134 AACCTGGGAGGCAGAGGCTGCGG - Intronic
911387327 1:97193708-97193730 GAGGAGGGAGACAGAGGCAGGGG - Intronic
911610511 1:99954956-99954978 GAGAGGGGATGCAGGGGCTGGGG - Intergenic
911652465 1:100405175-100405197 GAGCTGGGAGGCAGAGAGTGAGG - Intronic
911903677 1:103537919-103537941 AACCTGGGAGGCAGAGGCTGTGG - Intronic
911966797 1:104381532-104381554 GGGTAGGGGAGCAGAGGCTGAGG - Intergenic
912474678 1:109928003-109928025 GGGCAGGGAGCCAGAGGCTGTGG + Intronic
912832207 1:112963508-112963530 AACCTGGGAGGCAGAGGCTGCGG - Intergenic
913330920 1:117666856-117666878 GTGCAGGGACGAAGTGGGTGAGG - Intergenic
914246176 1:145887262-145887284 GACCGGGAAGGCAGAGGCTGCGG - Intergenic
914413753 1:147457790-147457812 AAACTGGGAGGCAGAGGCTGTGG + Intergenic
914452347 1:147803530-147803552 AACCTGGGACGCAGAGGTTGCGG + Intergenic
914864437 1:151414702-151414724 AAGCTGGGAGGCAGAGGCTGCGG + Intronic
915059351 1:153167394-153167416 AACCTGGGAGGCAGAGGCTGTGG + Intergenic
915314438 1:155020058-155020080 GAGCAGGCTGGCAGAGGCAGAGG - Intronic
915397701 1:155598192-155598214 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
915413882 1:155724874-155724896 GAACTGGGAGGCAGAGGTTGTGG + Intronic
915445296 1:155971071-155971093 GAGGAGGGGAGGAGAGGCTGTGG - Intronic
915564691 1:156706881-156706903 GAGCTGGGAGGGAGAGTCTGGGG - Intergenic
915603317 1:156935965-156935987 GAGTGGGGACGCAGAGGATTTGG + Exonic
916050862 1:161035987-161036009 AACCCGGGAGGCAGAGGCTGCGG + Intronic
916052878 1:161048482-161048504 GAGTGGGGATGGAGAGGCTGAGG - Exonic
916337874 1:163693473-163693495 GAGCAGGCATGCAGAGGATTGGG + Intergenic
916422599 1:164650860-164650882 GAGAAGGGAAGCAGAGGTGGTGG - Intronic
916725454 1:167518487-167518509 AGGCTGGGAGGCAGAGGCTGAGG + Exonic
916820225 1:168391120-168391142 AACCAGGGAGGCGGAGGCTGTGG - Intergenic
917407115 1:174718915-174718937 AAGCTGGGAAGCAGAGGTTGTGG - Intronic
917991308 1:180381997-180382019 TACCAGGGAGGCTGAGGCTGAGG + Intronic
918155830 1:181845758-181845780 AAGCTAGGATGCAGAGGCTGTGG - Intergenic
918471951 1:184884299-184884321 AACCCGGGAGGCAGAGGCTGTGG - Intronic
919768834 1:201144324-201144346 GAGCAAGGAAGAACAGGCTGTGG + Intronic
920117270 1:203629615-203629637 GGGCGGGGTCGCAGAGGCCGCGG - Intronic
920203550 1:204275520-204275542 GAGCAGGAACCCAGGGGTTGGGG + Intronic
920218622 1:204378927-204378949 GAGCCGGGAGGTCGAGGCTGCGG + Intergenic
920235256 1:204498815-204498837 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
920267297 1:204733694-204733716 GGGCAGGGAGCCAGGGGCTGGGG - Intergenic
920580784 1:207105477-207105499 AACCAGGGAGGCAGAGGTTGGGG + Intronic
920833114 1:209482854-209482876 AAGCAGAGACTCTGAGGCTGTGG + Intergenic
921029539 1:211325642-211325664 CAGGAGGGAGGCAGAGGTTGTGG - Intergenic
921119977 1:212127743-212127765 GAACCGGGAGGCAGAGGTTGTGG - Intergenic
921864777 1:220076605-220076627 AACCTGGGAGGCAGAGGCTGCGG + Intronic
922156716 1:223046029-223046051 GAGGAAGGACACTGAGGCTGTGG + Intergenic
922306024 1:224345433-224345455 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
922564052 1:226589744-226589766 CAGCAGGGACAGGGAGGCTGAGG - Intronic
922782500 1:228264150-228264172 GAGCAGGGAGGTGCAGGCTGAGG + Exonic
922879790 1:228972067-228972089 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
923055991 1:230426189-230426211 CGGGCGGGACGCAGAGGCTGCGG + Intergenic
923157965 1:231295051-231295073 AAGCCGGGAGGCAGAGGTTGCGG - Intergenic
923502253 1:234575562-234575584 AACCTGGGAGGCAGAGGCTGCGG - Intergenic
923544606 1:234914989-234915011 GAGCTGGGAGGCAGAGGTGGAGG + Intergenic
923665173 1:235992975-235992997 GACTGGGGACGCTGAGGCTGGGG + Intronic
923681402 1:236121628-236121650 AACCCGGGAGGCAGAGGCTGTGG - Intergenic
923768579 1:236916140-236916162 GAACCGGGAGGCAGAGGTTGTGG + Intergenic
923896716 1:238277930-238277952 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
1063369522 10:5512116-5512138 GAGCAGGGGCTCCGAGGCTGCGG - Intergenic
1063676022 10:8141227-8141249 GAGAAGGGACAGAGAGACTGAGG + Intergenic
1063990629 10:11558188-11558210 GAGCAGGGAAGAAGAGGCCAGGG - Intronic
1064089894 10:12374446-12374468 GAGCAAGGACACAGAGACTGGGG - Intronic
1064540322 10:16398362-16398384 GAGGCAGGAGGCAGAGGCTGCGG + Intergenic
1065264472 10:23960334-23960356 GAACTGGGAGGCAGAGGTTGCGG - Intronic
1065660470 10:27999998-28000020 GAGATGGGAGGCAGAGGTTGCGG - Intergenic
1065734821 10:28742137-28742159 AAGCCGGGAGGCAGAGGTTGCGG - Intergenic
1066018654 10:31274227-31274249 TAACAGGGACTCACAGGCTGGGG + Intergenic
1066075032 10:31866691-31866713 AAACAGGGAGGCAGAGGTTGTGG - Intronic
1066272202 10:33834975-33834997 GACCTGGGAAGCAGAGGTTGTGG + Intergenic
1066427587 10:35322274-35322296 AACCTGGGAGGCAGAGGCTGCGG + Intronic
1066437441 10:35407259-35407281 GGGTGGGGAAGCAGAGGCTGAGG + Intronic
1066702917 10:38148913-38148935 AACCTGGGAGGCAGAGGCTGTGG - Intergenic
1067691475 10:48504749-48504771 GGGGAGGGAAGCAGAGGCTGGGG + Intronic
1067942423 10:50668024-50668046 GGGCAAGGAAGGAGAGGCTGGGG + Intergenic
1067961855 10:50862835-50862857 GAGCAGGGAGGCTGTGGATGGGG + Intronic
1068793028 10:61048185-61048207 CAGCAGAGAAGCAGAGGCTCAGG + Intergenic
1068882713 10:62067161-62067183 GAACCGGGAGGCAGAGGTTGCGG - Intronic
1069546406 10:69332454-69332476 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1069577140 10:69538796-69538818 GAGCTTGGACACACAGGCTGGGG - Intergenic
1069990593 10:72313346-72313368 GAACGGGGAGGCAGAGGTTGCGG - Intergenic
1070109415 10:73469259-73469281 GGGCAGGGGCGCAGTGGCTCAGG + Intronic
1070120300 10:73569672-73569694 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1070151986 10:73811079-73811101 GAGCAGCGGCGCGGAGGCTGCGG + Intronic
1070198020 10:74176778-74176800 GAGCCGGGAAGCAGTTGCTGTGG + Intronic
1070572880 10:77654175-77654197 GACCTGGGAGGCAGAGGTTGCGG + Intergenic
1070616002 10:77969658-77969680 GACCTGGGAGGCAGAGGCTGCGG - Intronic
1070624405 10:78039863-78039885 GAGCAGAGGGGCAGAGGCTCAGG + Intronic
1070735897 10:78863429-78863451 GGACAGGGATCCAGAGGCTGTGG - Intergenic
1070863667 10:79692982-79693004 GGGCAAGGAAGGAGAGGCTGGGG + Intergenic
1071153834 10:82667076-82667098 GAGAATGGACGTAGAGGCAGGGG - Intronic
1071514035 10:86285192-86285214 AAGCAGGGCCTCATAGGCTGTGG - Intronic
1071599395 10:86950260-86950282 GACCCGGGAGGCAGAGGTTGTGG + Intronic
1072119868 10:92396780-92396802 GAGGAGGGAGGTGGAGGCTGAGG + Intergenic
1072207907 10:93221052-93221074 CATCAGGGGCGCAGAGGCCGCGG + Intergenic
1072865840 10:99060578-99060600 AACCAGGGAAGCAGAGGTTGAGG + Intronic
1073339857 10:102736333-102736355 GAACTGGGAGGCGGAGGCTGTGG - Intronic
1073483471 10:103801779-103801801 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1073580396 10:104660438-104660460 GAGAAGGGACTCAGACTCTGGGG - Intronic
1074128683 10:110553319-110553341 GACCCGGGAGGCAGAGGTTGCGG - Intergenic
1074561030 10:114535386-114535408 AACCTGGGAGGCAGAGGCTGCGG - Intronic
1074857167 10:117481915-117481937 AAGCTGGGAGGCAGAGGTTGCGG + Intergenic
1075610617 10:123851943-123851965 TACCAGGGAGGCAGAGACTGGGG + Intronic
1076009012 10:126971992-126972014 AACCTGGGAGGCAGAGGCTGTGG - Intronic
1076589808 10:131575201-131575223 GAGCAGAGCGGGAGAGGCTGAGG + Intergenic
1076612988 10:131737966-131737988 GAGACGGGATGCAGAGCCTGGGG + Intergenic
1076714322 10:132355619-132355641 GTGCCGGGAGGAAGAGGCTGTGG + Intronic
1077174439 11:1182263-1182285 CGGCAGTGAGGCAGAGGCTGTGG - Intronic
1077299803 11:1841700-1841722 GAGCATGGCCCAAGAGGCTGGGG - Intergenic
1077361200 11:2140810-2140832 GGTCAGGGGCGCAGAGGCGGAGG + Intronic
1077528198 11:3081405-3081427 AACCCGGGAGGCAGAGGCTGCGG + Intergenic
1078389123 11:10920494-10920516 GAGGAGAGAGGCAGAGGCAGAGG - Intergenic
1078708025 11:13764181-13764203 GGGCATGGAGTCAGAGGCTGAGG - Intergenic
1078935167 11:15943201-15943223 GTGCAGGGGAGCAGAGGCTGAGG + Intergenic
1078987079 11:16607143-16607165 GAGCTGGGACCGAGGGGCTGGGG - Intronic
1079234861 11:18680959-18680981 GAGGAGGGAAGCTGAGGCCGTGG + Intergenic
1079319693 11:19441770-19441792 CAGCAGGGAGCCAGGGGCTGGGG + Intronic
1080198808 11:29644214-29644236 AACCCGGGACGCAGAGGTTGTGG + Intergenic
1080651432 11:34225675-34225697 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1080961336 11:37164009-37164031 GAGAAGGGATGCAGAGAATGAGG - Intergenic
1081678142 11:44982950-44982972 GAGAAGGGATGGAGAGGCAGTGG - Intergenic
1081947873 11:47014625-47014647 GACCCGGGAGGCAGAGGTTGTGG + Intronic
1082791803 11:57350709-57350731 GAGCAGGGAGTCAGAGGGCGAGG + Intronic
1083153934 11:60810991-60811013 GGGCAGGCAGGCAGAGGCTGTGG - Intergenic
1083356748 11:62072203-62072225 GATCCGGGAGGCAGAGGTTGTGG - Intergenic
1083361402 11:62111286-62111308 CAGCTGGGAGGCTGAGGCTGAGG + Intergenic
1083421026 11:62553370-62553392 GAGCAGGGAGGGAGGGGCTGAGG + Intronic
1083443650 11:62692804-62692826 GGGGTGGGAAGCAGAGGCTGGGG + Intronic
1083534331 11:63454596-63454618 GGGTAGGGGAGCAGAGGCTGAGG - Intergenic
1083592529 11:63904030-63904052 GGGCCGGGCCGCAGAGACTGCGG - Exonic
1083671095 11:64300250-64300272 GTGCAGGGAGGGAGAGGCAGGGG + Intergenic
1083671665 11:64303555-64303577 GAGCAGGGTTGGAGGGGCTGGGG + Exonic
1084204568 11:67584190-67584212 GGGAAGGGAGGCAGGGGCTGGGG + Intronic
1084296607 11:68216330-68216352 GAGCTGAGCCACAGAGGCTGGGG + Intergenic
1085538935 11:77247971-77247993 GAACCGGGAGGCAGAGGTTGCGG + Intronic
1085840159 11:80002317-80002339 GAGCAGGGATGTTGTGGCTGTGG + Intergenic
1086774183 11:90809474-90809496 AACCAGGGAGGCAGAGGCTGCGG - Intergenic
1087226839 11:95610674-95610696 GAGCCTGGAGGCAGAGGTTGTGG + Intergenic
1088250636 11:107858540-107858562 CAGCAGGGAGGCAGAGGTGGCGG - Intronic
1088977172 11:114826126-114826148 GAGCAGAGAAGTAGAGGCTGGGG + Intergenic
1088996151 11:114999057-114999079 GAGGAAGGCCACAGAGGCTGAGG + Intergenic
1089109243 11:116041955-116041977 GAGTAGGGAGGCAGGAGCTGGGG + Intergenic
1089156842 11:116409252-116409274 GCACAGAGACGCAGGGGCTGTGG + Intergenic
1089237047 11:117038432-117038454 AACCTGGGAGGCAGAGGCTGTGG - Intronic
1089255700 11:117192789-117192811 AAGCAGGGACACAGGGACTGAGG - Intronic
1089332412 11:117699239-117699261 TGGCAGGGAAGCAGAGCCTGTGG + Intronic
1089604438 11:119633749-119633771 GACCTGGGAGGCAGAGGCTGTGG + Intronic
1089650256 11:119908310-119908332 GAGCAGGAGCACAGGGGCTGGGG + Intergenic
1090194559 11:124803239-124803261 AATCTGGGAGGCAGAGGCTGCGG + Intergenic
1090261584 11:125324866-125324888 GAGCAAGGACTCAGAGGCTGAGG + Intronic
1090558212 11:127899055-127899077 CAGAAGGGGCGCCGAGGCTGCGG + Intergenic
1090751016 11:129746616-129746638 ACGCAGGGAAGCTGAGGCTGGGG - Intergenic
1090754654 11:129779245-129779267 GAGCATGGACACAAAGGGTGAGG + Intergenic
1091389601 12:117966-117988 GAGCAGCGACACAGCGGGTGTGG + Intronic
1091581589 12:1793703-1793725 GAGTAGGGGCGGCGAGGCTGAGG + Exonic
1091887756 12:4029118-4029140 AACCTGGGAGGCAGAGGCTGTGG - Intergenic
1091951223 12:4594567-4594589 GAGCAGGGAGGGAGGGGTTGAGG - Intronic
1092133773 12:6131787-6131809 GAACAGGGAGGCAGAGATTGGGG + Intergenic
1092850453 12:12621438-12621460 AACCTGGGAGGCAGAGGCTGTGG + Intronic
1092937323 12:13376226-13376248 TTGGAGGGACTCAGAGGCTGTGG - Exonic
1093037551 12:14347040-14347062 AACCAGGGAGGCAGAGGCTGCGG + Intergenic
1093439685 12:19179580-19179602 AACCCGGGAGGCAGAGGCTGCGG + Intronic
1093562781 12:20562296-20562318 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1094298646 12:28936280-28936302 GTGCAGAGGCCCAGAGGCTGTGG + Intergenic
1094569658 12:31630473-31630495 CATCAGGCACACAGAGGCTGAGG - Intergenic
1094631663 12:32181340-32181362 GACCTGGGAGGCAGAGGTTGCGG + Intronic
1094747382 12:33361221-33361243 AATCCGGGAGGCAGAGGCTGCGG - Intergenic
1095186063 12:39201373-39201395 GAGGAAGGACTCAGATGCTGGGG + Intergenic
1096008961 12:48196918-48196940 AACCAGGGACGCGGAGGTTGTGG + Intergenic
1096061119 12:48701683-48701705 GAACCGGGAGGCAGAGGTTGTGG - Intronic
1096381449 12:51161600-51161622 GACCCGGGAGGCAGAGGTTGCGG + Intronic
1096617893 12:52844576-52844598 GAGCAGCAAGGCTGAGGCTGAGG - Exonic
1097074910 12:56385661-56385683 GACCCGGGAGGCAGAGGTTGCGG + Intergenic
1097092728 12:56520043-56520065 AACCCGGGACGCAGAGGTTGCGG + Intergenic
1097159486 12:57036249-57036271 GAGCAGGGAGGCACAGGTTTGGG - Intronic
1097328328 12:58304382-58304404 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
1097484207 12:60173787-60173809 GAGCTGGGAGGCAGAGGTTGCGG - Intergenic
1097508516 12:60506932-60506954 GAGGAAGAACGCAGCGGCTGGGG + Intergenic
1097699876 12:62809127-62809149 GGCCTGGGAGGCAGAGGCTGCGG - Intronic
1099065310 12:77969764-77969786 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1099259552 12:80360557-80360579 AAGCCGGGAGGCAGAGGTTGCGG - Intronic
1099349516 12:81547451-81547473 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1099354065 12:81611530-81611552 CAGCAGGGCCGTGGAGGCTGTGG + Intronic
1100288733 12:93193063-93193085 CAGCTGGGATGCAGATGCTGCGG - Intergenic
1100294385 12:93247247-93247269 GACCCGGGAGGCAGAGGTTGCGG + Intergenic
1100329913 12:93572568-93572590 GTGCAGGAACGTAGAGGCGGAGG + Intronic
1100457904 12:94770236-94770258 GGGGAGGGAGGCAGTGGCTGGGG - Intergenic
1100659500 12:96681679-96681701 GAACCAGGAGGCAGAGGCTGAGG - Intronic
1100972940 12:100091265-100091287 GAACTGGGAAGCAGAGGTTGCGG - Intronic
1100991613 12:100257451-100257473 AACCTGGGAGGCAGAGGCTGTGG - Intronic
1101386240 12:104260387-104260409 GACCCGGGAGGCAGAGGTTGCGG + Intronic
1101827843 12:108234356-108234378 CAGGAGGGAGGCAGAGACTGGGG + Intronic
1101874943 12:108591759-108591781 GGGCAGGGGCGCAGAGGAAGAGG - Exonic
1101937498 12:109070027-109070049 GTGCAGGGACTAGGAGGCTGCGG + Intronic
1102005909 12:109589113-109589135 GAGGAGAGAAGAAGAGGCTGGGG + Intronic
1102270536 12:111531038-111531060 AACCTGGGAGGCAGAGGCTGCGG + Intronic
1102304207 12:111792333-111792355 GAGCAGCCAGGGAGAGGCTGGGG - Intronic
1102777417 12:115532748-115532770 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
1103326268 12:120123101-120123123 AACCTGGGAGGCAGAGGCTGCGG + Intergenic
1103331519 12:120157787-120157809 GATCAGGGAGGCAGGGCCTGTGG - Intronic
1103391205 12:120574846-120574868 AAGCTGGGAGGCAGAGGTTGCGG + Intronic
1103471123 12:121181984-121182006 AACCTGGGAGGCAGAGGCTGCGG + Intronic
1103624220 12:122206218-122206240 CAGCAGGGACTTAGCGGCTGGGG + Intronic
1103884997 12:124193778-124193800 GAACAGAGAGGCAGAAGCTGTGG + Intronic
1103897122 12:124280061-124280083 GAGCAGGCAGGCTCAGGCTGGGG - Intronic
1103920287 12:124395747-124395769 GAGAAGGGATGGAGAGGCGGTGG + Intronic
1104072913 12:125362083-125362105 GTGCAGGCAGGCAGAGGCAGAGG - Intronic
1104347817 12:128018518-128018540 AACCCGGGAGGCAGAGGCTGCGG + Intergenic
1104446106 12:128834953-128834975 GACCCGGGAGGCAGAGGTTGCGG + Intergenic
1104607111 12:130198245-130198267 GTGCAGGGAGGAAGATGCTGGGG + Intergenic
1104861957 12:131928774-131928796 GAGCCCGGAGGCGGAGGCTGCGG + Intergenic
1105426417 13:20298516-20298538 GGGCAGGAGCACAGAGGCTGCGG - Intergenic
1105723852 13:23142021-23142043 GAGAGTGGACGCCGAGGCTGAGG - Intergenic
1106020224 13:25907150-25907172 AACCTGGGAGGCAGAGGCTGCGG + Intronic
1106280125 13:28259714-28259736 AACCAGGGAGGCAGAGGTTGTGG - Intronic
1106580955 13:31017891-31017913 GAGGAGGAACACACAGGCTGAGG - Intergenic
1107065964 13:36214578-36214600 GGCCCGGGACGCAGCGGCTGTGG - Exonic
1107283737 13:38765818-38765840 GAAGATGGAAGCAGAGGCTGGGG - Intronic
1107476853 13:40745328-40745350 AAGCTGGGAGGCAGAGGTTGTGG - Intronic
1107889765 13:44903946-44903968 AGGCAGGGAAGCAGAAGCTGAGG + Intergenic
1107974837 13:45679266-45679288 GAACCGGGAGGCAGAGGTTGCGG - Intergenic
1108115273 13:47120592-47120614 GAGGTGGGAAGCAAAGGCTGAGG + Intergenic
1108205691 13:48087284-48087306 GAACCCGGAGGCAGAGGCTGCGG + Intronic
1108905174 13:55461082-55461104 GAACTGGGAGGCAGAGGTTGCGG + Intergenic
1109884316 13:68523815-68523837 CAGAATGGACGCTGAGGCTGAGG - Intergenic
1109903324 13:68803504-68803526 GACCCGGGAGGCAGAGGCTGTGG + Intergenic
1109930297 13:69207319-69207341 AACCTGGGAGGCAGAGGCTGCGG + Intergenic
1110844074 13:80174177-80174199 GACCCGGGAGGCAGAGGTTGTGG + Intergenic
1111128402 13:83942138-83942160 GAGCATGGACACAAAGGGTGAGG - Intergenic
1111183581 13:84699646-84699668 AACCCGGGAGGCAGAGGCTGTGG + Intergenic
1111730571 13:92071156-92071178 AACCTGGGAGGCAGAGGCTGCGG + Intronic
1112292277 13:98155265-98155287 GAACCGGGAGGCAGAGGTTGTGG + Intronic
1112295825 13:98186182-98186204 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1112509786 13:99998714-99998736 AACCAGGGAGGCAGAGGTTGCGG - Intergenic
1113289467 13:108888975-108888997 AAGCCGGGAGGCAGAGGTTGCGG + Intronic
1113457265 13:110457635-110457657 GAGCAGGGACGGTGAGCCTGGGG - Intronic
1113759913 13:112840171-112840193 GAGTGGGGAGGCTGAGGCTGGGG - Intronic
1113760000 13:112840459-112840481 GAGTAGGGAGGCTGAGGCTGGGG - Intronic
1113760021 13:112840524-112840546 GAGTAGGGAGGCTGAGGCTGGGG - Intronic
1114939349 14:27588561-27588583 GAATAGGGAGGCAGAGGTTGTGG - Intergenic
1115093126 14:29602505-29602527 GACCTGGGAGGCAGAGGTTGTGG - Intronic
1116810346 14:49533951-49533973 AACCTGGGAGGCAGAGGCTGCGG + Intergenic
1116845252 14:49859528-49859550 AACCTGGGAGGCAGAGGCTGAGG - Intergenic
1117288097 14:54306944-54306966 GGCGAGGGACCCAGAGGCTGGGG + Intergenic
1117665683 14:58053502-58053524 GAGAAGGGAAGCAGGGGCTGAGG - Intronic
1117707532 14:58487034-58487056 GAGCAAGGAGGCGTAGGCTGTGG - Exonic
1117912676 14:60649609-60649631 GAGCGGGGAGGGCGAGGCTGCGG + Intronic
1118206727 14:63729501-63729523 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
1118677428 14:68202658-68202680 AACCCGGGAAGCAGAGGCTGCGG - Intronic
1118978978 14:70701013-70701035 GGGCAGGGAAGCAGAGACAGAGG + Intergenic
1119090281 14:71774444-71774466 GAGCATGGACGCCAAGGGTGAGG - Intergenic
1119394523 14:74316433-74316455 AACCTGGGAGGCAGAGGCTGTGG + Intronic
1119554215 14:75541008-75541030 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1120376855 14:83719449-83719471 AACCAGGGAGGCAGAGGTTGCGG - Intergenic
1121013613 14:90535438-90535460 CAGCAGGGAGGCAGAGGCCTGGG - Exonic
1122023510 14:98858583-98858605 GAGCAGGGGCGCAAAAGCAGAGG + Intergenic
1122061946 14:99141837-99141859 GGGCTGGGACGCAGTGACTGTGG - Intergenic
1122223247 14:100255539-100255561 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1122246213 14:100405237-100405259 AACCCGGGAGGCAGAGGCTGCGG - Intronic
1122296679 14:100709834-100709856 GGGGCGGGACGCAGAGGCTGCGG - Intergenic
1122447669 14:101781491-101781513 GGGCAGGGGCGGGGAGGCTGGGG - Intronic
1122488832 14:102099478-102099500 GATCTGGGAGGCAGAGGTTGTGG + Intronic
1122547106 14:102529471-102529493 AAGCTGGGAGGCAGAGGCTGTGG + Intergenic
1122669326 14:103358142-103358164 GAGCAAGGATGGGGAGGCTGTGG + Intergenic
1122768239 14:104085712-104085734 CAGCGGGGACGCAGGGCCTGCGG - Exonic
1122993213 14:105248639-105248661 GGGCAGGGTCGCAGGGGCGGGGG + Exonic
1123062177 14:105599348-105599370 GGGCAGGGTGGCGGAGGCTGCGG + Intergenic
1202917952 14_KI270723v1_random:2769-2791 GTGCAGGGAAGCAGCAGCTGTGG + Intergenic
1202926671 14_KI270724v1_random:31814-31836 GTGCAGGGAAGCAGCAGCTGTGG - Intergenic
1123402484 15:20002263-20002285 AACCTGGGAGGCAGAGGCTGTGG + Intergenic
1123511822 15:21008925-21008947 AACCTGGGAGGCAGAGGCTGTGG + Intergenic
1123692220 15:22847873-22847895 AACCAGGGAGGCAGAGGTTGTGG - Intronic
1124037447 15:26068836-26068858 GGGTAGGGATCCAGAGGCTGGGG - Intergenic
1124449244 15:29770353-29770375 GACCAGGGAGGCGGAGGTTGCGG + Intronic
1124954962 15:34354307-34354329 GAGCTGGGAGGCAGAAGCTGTGG + Intronic
1125417491 15:39468592-39468614 GAGAAGGGGCCCAGAGGCTGGGG - Intergenic
1125501470 15:40242415-40242437 GAGCAGGAAGGCCCAGGCTGCGG + Intronic
1125558677 15:40608665-40608687 AATCCGGGAGGCAGAGGCTGTGG + Intronic
1125568882 15:40699219-40699241 AACCTGGGACGCAGAGGTTGCGG - Intronic
1125593134 15:40867651-40867673 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
1125790227 15:42359889-42359911 GAGCAAGGCCACTGAGGCTGGGG + Exonic
1126709061 15:51437095-51437117 GACCCGGGAGGCAGAGGTTGTGG - Intergenic
1127328954 15:57920384-57920406 GGGCAGGGAAGTAGAGGGTGAGG + Intergenic
1128091157 15:64919844-64919866 GAGGAGGGAAGCAGAGGCTGGGG - Intronic
1128131415 15:65229546-65229568 AACCCGGGAGGCAGAGGCTGCGG + Intergenic
1128249034 15:66152039-66152061 GAGGAGAGGCGCCGAGGCTGGGG - Intronic
1128647492 15:69388120-69388142 GAGGAGGGAGGCAGGGGCAGAGG - Intronic
1128747772 15:70126573-70126595 GAGCAGGGAGGCAGGGGCAGTGG - Intergenic
1128806466 15:70534557-70534579 GAGCAGGGAGGGAGAGGAAGTGG + Intergenic
1128964473 15:72044326-72044348 AACCTGGGAGGCAGAGGCTGCGG + Intronic
1129060977 15:72860075-72860097 GCTCAGGGACGCAGGGACTGAGG - Intergenic
1129120286 15:73392249-73392271 GAGCAGGGAGGCAGACGAAGAGG + Intergenic
1129285713 15:74522857-74522879 AAGCTGGGAGGCAGAGGTTGTGG + Intergenic
1129630042 15:77248900-77248922 GAACCAGGAGGCAGAGGCTGCGG - Intronic
1130222650 15:82033636-82033658 TTGCAGGGAGGCAGAGGTTGCGG - Intergenic
1130333741 15:82941363-82941385 GAACCGGGAGGCAGAGGCTGCGG + Intronic
1130910463 15:88267048-88267070 GAGCAGGGAGGGAGGGGATGAGG + Intergenic
1131135317 15:89930005-89930027 AACCCGGGAGGCAGAGGCTGCGG + Intergenic
1131253374 15:90845477-90845499 AAGCAGGGCCTCTGAGGCTGTGG + Intergenic
1131258640 15:90877227-90877249 GAGAAGGGAGGCAGAGACCGGGG - Intronic
1131279285 15:91007654-91007676 GAGCAGGGTGGCAGGGCCTGGGG + Intronic
1131655174 15:94448960-94448982 GAACTGGGAGGCAGAGGTTGCGG + Intronic
1131672645 15:94635992-94636014 TACCCGGGAGGCAGAGGCTGCGG + Intergenic
1131912966 15:97228694-97228716 AACCAGGGAGTCAGAGGCTGCGG - Intergenic
1132331087 15:101012960-101012982 GAACAGGGGCCCAGGGGCTGTGG - Intronic
1132513422 16:354758-354780 GAGCAGGTGGGCAGGGGCTGGGG + Intergenic
1132594336 16:741311-741333 CCGCAGGTACGCAGAGGATGAGG - Intronic
1132603243 16:783139-783161 GAGCAGGGCCCCAGTGGGTGGGG - Intronic
1132640486 16:976137-976159 GAGAAGGGACACAGGGCCTGGGG - Intronic
1132678667 16:1130909-1130931 GAGCAGGGATGCAGTGGGGGGGG + Intergenic
1132875574 16:2135563-2135585 GCGCTGGGCCGCAGAGGCAGGGG + Exonic
1132934028 16:2472084-2472106 GAGCAGGGCCACGGAGGCTGGGG - Exonic
1132974413 16:2704306-2704328 GCGCAGGGCCGCATGGGCTGTGG + Intronic
1133180507 16:4050633-4050655 GAACCGGGAGGCAGAGGTTGCGG + Intronic
1134186705 16:12090368-12090390 GCGCAGGAATGCAGAGGCAGTGG + Intronic
1134243671 16:12523962-12523984 AACCCGGGAGGCAGAGGCTGTGG - Intronic
1134475281 16:14568288-14568310 AACCCGGGAGGCAGAGGCTGCGG - Intronic
1134766571 16:16764068-16764090 AACCAGGGAGGCAGAGGTTGCGG - Intergenic
1134869038 16:17634889-17634911 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
1135014103 16:18909262-18909284 AACCCGGGAGGCAGAGGCTGTGG + Intronic
1135081701 16:19441879-19441901 AACCCGGGAGGCAGAGGCTGTGG - Intronic
1135094999 16:19557461-19557483 GAGCCGGGAGGCGGAGGTTGCGG - Intronic
1135243178 16:20828847-20828869 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1135382698 16:22008007-22008029 GAGCTGGGGCGCGGCGGCTGGGG + Intronic
1135629673 16:24026215-24026237 AACCTGGGAGGCAGAGGCTGCGG + Intronic
1136100775 16:27994076-27994098 GAGCATGGACACAAAGGATGAGG - Intronic
1136130925 16:28220733-28220755 AACCAGGGACGCAGAGGTTGCGG - Intergenic
1136237579 16:28924460-28924482 GAGCACGAAGGCCGAGGCTGTGG - Exonic
1136297121 16:29309919-29309941 TGGCTGGGAAGCAGAGGCTGCGG - Intergenic
1136380644 16:29893244-29893266 AACCCGGGAGGCAGAGGCTGCGG + Intronic
1136389591 16:29954515-29954537 AACCTGGGAGGCAGAGGCTGTGG + Intronic
1137013093 16:35344124-35344146 GTGCAGGGAAGCAGTAGCTGTGG + Intergenic
1137019804 16:35414305-35414327 GTGCAGGGAAGCAGTAGCTGTGG + Intergenic
1137026853 16:35485799-35485821 GTGCAGGGAAGCAGTAGCTGTGG + Intergenic
1137242320 16:46666344-46666366 AACCCGGGACGCAGAGGTTGTGG - Intronic
1137279753 16:46965751-46965773 AACCAGGGAGGCAGAGGCTTCGG + Intronic
1137365770 16:47858226-47858248 CAACAGGGAAGCAGAGGCAGGGG + Intergenic
1137980208 16:53062940-53062962 GACCCGGGAGGCAGAGGTTGTGG + Intronic
1138026669 16:53527581-53527603 CAGCATGCACGCAGCGGCTGTGG - Intergenic
1138482483 16:57312741-57312763 AACCTGGGAAGCAGAGGCTGTGG + Intergenic
1138571980 16:57880572-57880594 AACCTGGGAGGCAGAGGCTGCGG - Intergenic
1138673917 16:58637115-58637137 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
1139573979 16:67829864-67829886 CAGCAGGGTAGAAGAGGCTGAGG - Exonic
1139678766 16:68543636-68543658 AATCAGGGAGGCAGAGGTTGCGG - Intronic
1139727625 16:68914237-68914259 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1139922766 16:70470350-70470372 GAGCAGGAACTCACTGGCTGAGG - Exonic
1140033039 16:71353740-71353762 AAGCAGGGACACAGGGGCTGAGG - Intergenic
1140396126 16:74628264-74628286 GAGCAGGGAGGCAGGCTCTGTGG + Intronic
1140452120 16:75079400-75079422 AACCAGGGAAGCAGAGGTTGCGG + Intronic
1140610603 16:76593991-76594013 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1140860198 16:79011567-79011589 GCCCAGGGAGGCTGAGGCTGTGG - Intronic
1141104723 16:81224083-81224105 AACCAGGGAAGCAGAGGTTGGGG + Intergenic
1141444001 16:84046636-84046658 AAGCCGGGAGGCAGAGGCTGCGG - Intergenic
1141470464 16:84234877-84234899 GAGCAGGGAGGCTGAGGACGGGG - Intronic
1141498875 16:84430004-84430026 GAGAAGAGACGCAGAGACAGAGG - Intronic
1141505755 16:84477267-84477289 AACCAGGGAGGCAGAGGTTGTGG - Exonic
1141613848 16:85199020-85199042 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
1141672579 16:85500494-85500516 GATCGGGGACCCAGGGGCTGGGG - Intergenic
1141695189 16:85615813-85615835 GGTCAGGAACCCAGAGGCTGTGG - Intronic
1141701984 16:85646835-85646857 GAGCAGCTCCCCAGAGGCTGGGG - Intronic
1142134493 16:88445399-88445421 GAGGAGAGACGCACACGCTGCGG + Intergenic
1142209127 16:88799595-88799617 GAGCTGGGAGGCTGAGGGTGGGG - Intergenic
1142296457 16:89226281-89226303 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1142563607 17:825675-825697 TTGGAGGGCCGCAGAGGCTGTGG - Intronic
1143169053 17:4915800-4915822 GACCAGGGAGGCAGAGGTTGTGG + Intergenic
1143183030 17:4995851-4995873 AACCAGGGAGGCAGAGGTTGCGG + Exonic
1143506205 17:7367006-7367028 GAGCAGGGAAGGAGAAGCTAAGG + Intergenic
1143654191 17:8283890-8283912 GAGCCGGGAGGTTGAGGCTGCGG - Intergenic
1143725113 17:8839268-8839290 AACCAGGGAGGCAGAGGTTGTGG + Intronic
1143833669 17:9672622-9672644 GAGGAGAGACGCAGTGGCAGAGG + Intronic
1144517445 17:15928450-15928472 GAGCAGGGAGGCTGAGCATGGGG + Intergenic
1144953001 17:19004138-19004160 GGGCAGAGAAGCAGAGGCCGCGG - Exonic
1144994793 17:19260130-19260152 TAGCAGGAAAGCAGAAGCTGAGG + Intronic
1145000454 17:19301160-19301182 GACCATGGAGGCAGAGACTGGGG - Intronic
1146052032 17:29562008-29562030 GAGAAGGGCGGCAGAGGCAGTGG - Exonic
1146478473 17:33182166-33182188 GAGCAGGGAGGCAGGGGTGGAGG + Intronic
1146697708 17:34922819-34922841 GACCTGGGAGGCAGAGGTTGTGG + Intergenic
1146833702 17:36092385-36092407 GAGCTGGGAGGCAGAGGGTGGGG - Intergenic
1146848291 17:36199224-36199246 GAGCTGAGAGGCAGAGGGTGGGG - Intronic
1146918884 17:36696606-36696628 GAGCAGGGACAGAGGGGCTCTGG - Intergenic
1147330973 17:39699381-39699403 AACCAGGGAGGCAGAGGTTGTGG + Intronic
1147623130 17:41881343-41881365 AACCAGGGAGGCAGAGGCTGCGG + Intronic
1147970767 17:44218477-44218499 GAGCCGGGCTGCAGGGGCTGGGG - Intronic
1148112945 17:45157100-45157122 AAGCCGGGAGGCAGAGGTTGCGG + Intergenic
1148146380 17:45367576-45367598 GATGAGGGAGGCTGAGGCTGAGG - Intergenic
1148467410 17:47873217-47873239 AAGGAGGCAAGCAGAGGCTGGGG - Intergenic
1148655638 17:49281340-49281362 GAACCGGGAGGCAGAGGTTGCGG - Intergenic
1148710173 17:49674067-49674089 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1148770254 17:50062358-50062380 GAGAAGGGACCCACAGCCTGCGG - Intronic
1148918994 17:51012490-51012512 AACCAGGGAGGCAGAGGTTGTGG + Intronic
1149001033 17:51757820-51757842 GAGCATGGTGGCAGAGGGTGTGG + Intronic
1149560079 17:57602428-57602450 GACCTGGGAGGCAGAGGTTGTGG - Intronic
1149743662 17:59073369-59073391 AACCCGGGAGGCAGAGGCTGCGG - Intronic
1149801295 17:59569964-59569986 AACCTGGGACGCAGAGGTTGCGG + Intronic
1150261550 17:63796385-63796407 GACCCGGGAGGCAGAGGTTGTGG - Intronic
1150341190 17:64369012-64369034 AACCCGGGAGGCAGAGGCTGCGG - Intronic
1151109100 17:71654116-71654138 GAACCGGGAGGCAGAGGTTGAGG + Intergenic
1151127361 17:71859577-71859599 AATCCGGGAGGCAGAGGCTGTGG - Intergenic
1151448340 17:74181839-74181861 GAGGAGGGAGGCAGAGGCTGGGG - Intergenic
1151537858 17:74748849-74748871 GAGCGCGGACGCAGCGGCCGGGG + Exonic
1151613697 17:75194022-75194044 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
1152308637 17:79535895-79535917 GGGCAGGGGTGCAGTGGCTGGGG - Intergenic
1152321829 17:79612008-79612030 GAGCAGGAGAGCAGAGGCTGAGG + Intergenic
1152352500 17:79791454-79791476 GACCTGGGCCGGAGAGGCTGCGG + Intergenic
1152437569 17:80285746-80285768 AACCCGGGAGGCAGAGGCTGCGG - Intronic
1152623526 17:81378152-81378174 AACCAGGGAGGCAGAGGCTGCGG - Intergenic
1152716374 17:81902592-81902614 GGGCAGGCAAGCAAAGGCTGAGG - Intronic
1152835599 17:82528684-82528706 AAGCAGGGCCGCAGGGGCTGTGG - Intronic
1152919466 17:83058767-83058789 GAGAGGGGCCGGAGAGGCTGGGG + Intergenic
1153112277 18:1606127-1606149 GAGCCCAGAGGCAGAGGCTGCGG - Intergenic
1153677615 18:7469397-7469419 GAGCAGGGAGGCATTGGCTGGGG - Intergenic
1153903114 18:9636564-9636586 GAACCGGGAAGCAGAGGTTGTGG + Intergenic
1155031487 18:21988761-21988783 AAGCCGGGAGGCAGAGGTTGCGG + Intergenic
1155132002 18:22945463-22945485 AACCCGGGAGGCAGAGGCTGCGG - Intronic
1156454871 18:37287277-37287299 GGCCAGGGACGCAGTGCCTGAGG - Intronic
1157542454 18:48521403-48521425 GAGCAGGAACCAAGGGGCTGAGG - Intergenic
1157835980 18:50903564-50903586 TACCAGGTACTCAGAGGCTGAGG - Intronic
1157863157 18:51159752-51159774 GAGCAGGGATGCAGAGGGCAGGG + Intergenic
1158528565 18:58236943-58236965 AACCTGGGAGGCAGAGGCTGCGG + Intronic
1158573157 18:58613619-58613641 GACCTGGGAGGCAGAGGTTGCGG + Intronic
1158933934 18:62347479-62347501 CAGAAGGGAACCAGAGGCTGAGG + Intronic
1159090168 18:63839487-63839509 AACCTGGGAGGCAGAGGCTGCGG - Intergenic
1159596331 18:70385980-70386002 AACCAGGGAGGCAGAGGTTGCGG - Intergenic
1159850885 18:73526134-73526156 GAACAGGAAGGCAGGGGCTGTGG + Intergenic
1159959106 18:74541686-74541708 GGGCTGGGACGAAGGGGCTGGGG - Intronic
1160171916 18:76562361-76562383 GAGCTGGGTCCCAGAGGCTGGGG - Intergenic
1160451232 18:78967297-78967319 GAACAGGAACCAAGAGGCTGCGG + Intergenic
1160534675 18:79585684-79585706 GTGCAGGGACACAGTGGGTGTGG - Intergenic
1160556064 18:79726114-79726136 CAGCAGGGACACGGATGCTGAGG + Intronic
1160632518 18:80256739-80256761 AACCAGGGAGGCAGAGGGTGCGG - Intergenic
1160669685 19:354937-354959 AACCTGGGAGGCAGAGGCTGTGG - Intergenic
1160686360 19:438726-438748 TGGCAGGCACGGAGAGGCTGAGG + Exonic
1160940572 19:1618740-1618762 GAGAAGGAACGAAGTGGCTGCGG - Intronic
1160950789 19:1666282-1666304 AACCCGGGAGGCAGAGGCTGCGG - Intergenic
1161044004 19:2124859-2124881 GACCTGGGAGGCAGAGGTTGCGG + Intronic
1161077671 19:2294258-2294280 GAACACGGAGGCAGAGGCTAGGG + Intronic
1161083954 19:2325386-2325408 GAGCAGGGAGGGGGTGGCTGCGG - Intronic
1161084956 19:2330660-2330682 GAGCAGGGGCACAGAGGAGGGGG + Intronic
1161162951 19:2770737-2770759 GAAGACGGAGGCAGAGGCTGAGG + Intronic
1161319584 19:3634739-3634761 GAGCATGGAGGCAGAGCCCGAGG - Intronic
1161583672 19:5093877-5093899 GTGCAGGGACGCTGCAGCTGCGG + Intronic
1161595205 19:5147784-5147806 GGGCGGGGGGGCAGAGGCTGTGG + Intronic
1161642937 19:5435683-5435705 GAGGAGGGGAGCAGAGGGTGGGG - Intergenic
1161656786 19:5521161-5521183 GTGGAGGGTAGCAGAGGCTGGGG + Intergenic
1161832412 19:6616496-6616518 GAACCGGGAGGCAGAGGTTGCGG + Intergenic
1161878295 19:6928859-6928881 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1162036998 19:7946027-7946049 AACCTGGGAAGCAGAGGCTGCGG - Intergenic
1162494081 19:11013547-11013569 GATCCGGGACCCAGAGGCAGAGG - Intronic
1162541988 19:11302449-11302471 AATCCGGGAGGCAGAGGCTGCGG + Intronic
1162592722 19:11603358-11603380 GAGCCCGGAGGCAGAGGTTGCGG - Intronic
1162874352 19:13609804-13609826 AAGCAGAGACTCAGAGGCTTAGG - Intronic
1162914216 19:13865570-13865592 GGGCCGGGCCGCAGAGGCCGGGG - Intronic
1163127513 19:15252178-15252200 GAAGAGGGACGCAGAGGCCAAGG + Intronic
1163147863 19:15393823-15393845 GACCCGGGAGGCAGAGGTTGTGG + Intronic
1163884584 19:19954446-19954468 AACCTGGGAGGCAGAGGCTGTGG + Intergenic
1163922556 19:20305731-20305753 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
1163988434 19:20974219-20974241 AAGCCGGGAGGCAGAGACTGCGG + Intergenic
1164216211 19:23151527-23151549 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
1164271857 19:23679910-23679932 AATCAGGGAGGCAGAGGTTGTGG + Intronic
1164590629 19:29505038-29505060 GGGGAGGGACACTGAGGCTGAGG - Intergenic
1165454919 19:35904805-35904827 ACGCAGGGACCCTGAGGCTGGGG - Intronic
1165506124 19:36231285-36231307 AACCCGGGAGGCAGAGGCTGCGG - Intronic
1165552187 19:36596593-36596615 GAACTGGGAGGCAGAGGCTGCGG - Intronic
1165558554 19:36657698-36657720 AAGCTGGGAGGCAGAGGTTGTGG + Intronic
1165570434 19:36771153-36771175 GAACAGGGACACAAAGGATGAGG + Intronic
1165718197 19:38060767-38060789 AACCCGGGAGGCAGAGGCTGTGG - Intronic
1165805488 19:38578207-38578229 GAGCAGGGGCCCACAGACTGGGG + Intronic
1165886839 19:39084532-39084554 GGGCAGGGACGCTGGGGATGGGG + Intronic
1166576277 19:43841508-43841530 AACCTGGGAGGCAGAGGCTGCGG - Intronic
1166714440 19:44957685-44957707 GAGAAGGGTGGCAGTGGCTGTGG - Intronic
1166723907 19:45013752-45013774 AATCCGGGAGGCAGAGGCTGCGG + Intronic
1166798641 19:45443084-45443106 GACCAGGGACTCAGGAGCTGAGG + Intronic
1166927225 19:46277346-46277368 GGGTAGGGGAGCAGAGGCTGAGG + Intergenic
1167011332 19:46810318-46810340 AAGCCGGGAGGCAGAGGTTGTGG - Intergenic
1167327163 19:48833746-48833768 AAGCTGGGAGGCAGAGGTTGCGG + Intronic
1167492934 19:49802292-49802314 GAGCAGGGAGGCTGGGGCAGGGG - Intronic
1167549562 19:50150758-50150780 GACCCGGGAGGCAGAGGTTGTGG + Intergenic
1167989328 19:53344706-53344728 AAGCAGGGAGGCGGAGGTTGTGG - Intronic
1168083053 19:54024416-54024438 TAGCAGGGAGGCTGAGGCAGGGG - Intergenic
1168140802 19:54385499-54385521 GAGCAGAGACCTGGAGGCTGTGG - Intergenic
1168157539 19:54484566-54484588 GAGCAGAGACCTGGAGGCTGTGG + Intergenic
1168158434 19:54492033-54492055 GAACCGGGAGGCAGAGGTTGTGG - Intergenic
1168247439 19:55119842-55119864 GAGCAGGGTCGCAGTGGGAGTGG - Intergenic
1168410465 19:56136857-56136879 GAACCGGGAGGCAGAGGTTGCGG - Intronic
1168614287 19:57825368-57825390 GAACTGGGAGGCAGAGGTTGTGG - Intronic
925169688 2:1743513-1743535 GAGCGGGGGCGCCGCGGCTGCGG + Intronic
925204684 2:1996058-1996080 GGGAAGGGCCGGAGAGGCTGAGG + Intronic
925222522 2:2153530-2153552 GAGGAGGAAGGCAGAGGCTGGGG + Intronic
925266403 2:2569475-2569497 GTGCAGGGACACAGGGGATGAGG + Intergenic
925328722 2:3042274-3042296 GAGCAGAGCAGCAGAGGCCGCGG - Intergenic
925359412 2:3267090-3267112 AAGCAGGGACCCGGAAGCTGTGG + Intronic
925368412 2:3326431-3326453 GAGCAGGGCAGTGGAGGCTGGGG - Intronic
925746944 2:7051474-7051496 GAGCTTGGATGCAGAGGATGAGG + Intronic
925859819 2:8163511-8163533 AATCCGGGAGGCAGAGGCTGTGG - Intergenic
926625358 2:15085790-15085812 GAGCAGGGGTGCACACGCTGGGG + Intergenic
926748497 2:16179888-16179910 CTGCAGGGAGGCTGAGGCTGTGG + Intergenic
927351264 2:22119064-22119086 AACCCGGGAGGCAGAGGCTGTGG + Intergenic
927435815 2:23065171-23065193 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
927521539 2:23701876-23701898 AACCTGGGAGGCAGAGGCTGCGG - Intronic
927548845 2:23978883-23978905 AACCCAGGACGCAGAGGCTGTGG + Intronic
927554327 2:24021753-24021775 GAGGAGGGAAGCAGAAGCTGGGG + Intronic
927723298 2:25401440-25401462 AGGCAGGGACGCACATGCTGTGG + Intronic
927774277 2:25889869-25889891 GAACTGGGAGGCAGAGGTTGCGG + Intergenic
928341811 2:30449576-30449598 AACCCGGGAGGCAGAGGCTGTGG - Intronic
928968021 2:36996667-36996689 ATCCAGGGATGCAGAGGCTGCGG - Intronic
928968261 2:36999139-36999161 GACCTGGGAGGCGGAGGCTGTGG + Intronic
929440738 2:41964274-41964296 GAGCAGGGAGGCAGAGAGGGAGG - Intergenic
929557820 2:42936601-42936623 GACCAGGGAGGGAGAGGCAGAGG - Intergenic
929651687 2:43686272-43686294 AACCCGGGAGGCAGAGGCTGCGG - Intronic
929729213 2:44468838-44468860 GAGCTGGGAGGTTGAGGCTGTGG + Intronic
930062271 2:47300012-47300034 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
930067728 2:47340625-47340647 GAGAAGGTACACAGAGGCTTTGG + Intergenic
930655936 2:54007329-54007351 GACCCGGGAGGCAGAGGTTGCGG - Intronic
930789281 2:55307431-55307453 AACCTGGGAGGCAGAGGCTGAGG - Intronic
931240459 2:60447548-60447570 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
932258769 2:70309453-70309475 AACCAGGGAGGCAGAGGTTGCGG - Intergenic
932584702 2:73020449-73020471 GAGCAGAGAAGAGGAGGCTGGGG - Intronic
932887108 2:75558522-75558544 GAGAGGGGAGGCTGAGGCTGAGG + Intronic
933144899 2:78840341-78840363 GAACAGGGAGGCAGAGGATGCGG - Intergenic
933816988 2:86076305-86076327 GCTGAGGAACGCAGAGGCTGGGG - Intronic
934474578 2:94585956-94585978 GAACTGGGAGGCAGAGACTGTGG + Intergenic
934669822 2:96204180-96204202 AACCAGGGAGGCGGAGGCTGCGG + Intronic
934763571 2:96868931-96868953 GGGCGGAGACGCAGAAGCTGGGG + Intronic
934845480 2:97659282-97659304 GAGGAGGGACGCAGAGGAGAGGG + Intronic
935435738 2:103030126-103030148 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
935555275 2:104503067-104503089 GAGCAGGAACTCAGGAGCTGGGG - Intergenic
935716988 2:105947958-105947980 GAGAAGGGACCGAGAGGCAGGGG + Intergenic
936050704 2:109221502-109221524 AACCTGGGAGGCAGAGGCTGCGG + Intronic
936090746 2:109499945-109499967 GAGCAGGGAGGCAGCGAGTGGGG + Intronic
936288918 2:111203409-111203431 AACCTGGGAGGCAGAGGCTGAGG - Intergenic
936327982 2:111522089-111522111 GAGCAGGGAGGAGCAGGCTGGGG + Intergenic
937002198 2:118477978-118478000 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
937114342 2:119393805-119393827 AAGCTGGGAAGCAGAGGTTGCGG - Intergenic
937203435 2:120220649-120220671 GAACCGGGAGGCGGAGGCTGCGG + Intergenic
937319801 2:120954334-120954356 GACAGGGGAGGCAGAGGCTGTGG + Intronic
937321801 2:120965471-120965493 CAGCCGGGATGCAGATGCTGCGG + Intronic
937321809 2:120965509-120965531 CAGCCGGGATGCAGATGCTGCGG + Intronic
937321817 2:120965547-120965569 CAGCCGGGATGCAGATGCTGCGG + Intronic
937321825 2:120965585-120965607 CAGCCGGGATGCAGATGCTGCGG + Intronic
937321832 2:120965623-120965645 CAGCCGGGATGCAGATGCTGCGG + Intronic
937329027 2:121012060-121012082 AAGCTGGGAAGCAGAGGTTGCGG + Intergenic
937570637 2:123355064-123355086 AACCTGGGAGGCAGAGGCTGCGG - Intergenic
937871442 2:126789158-126789180 GAGGAGGGAGGGAGAGACTGGGG - Intergenic
938039737 2:128065792-128065814 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
938306663 2:130261088-130261110 AACCAGGGATGCAGAGGTTGCGG + Intergenic
938343664 2:130551233-130551255 GACCTGGGAGGCGGAGGCTGCGG + Intergenic
938346169 2:130569489-130569511 GACCTGGGAGGCGGAGGCTGCGG - Intergenic
938378357 2:130823153-130823175 GGGCAGGCACGCAGAGTTTGGGG + Intergenic
938450732 2:131417191-131417213 GACCTGGGAGGCAGAGGTTGCGG + Intergenic
938731121 2:134148834-134148856 AACCAGGGAGGCAGAGGTTGCGG - Intronic
938781801 2:134591240-134591262 GAGCATGGACACAAAGGGTGAGG - Intronic
938817738 2:134921429-134921451 AACCAGGGAGGCAGAGGTTGTGG - Intronic
939458296 2:142466396-142466418 AACCTGGGAGGCAGAGGCTGCGG - Intergenic
939610807 2:144308242-144308264 AACCTGGGAGGCAGAGGCTGTGG - Intronic
941813851 2:169780964-169780986 GACCCGGGAGGCAGAGGTTGTGG - Intergenic
942700834 2:178708053-178708075 TAGTAAGGACACAGAGGCTGGGG - Intronic
942763677 2:179429203-179429225 GAGCAGGGAGGCAGAAGTGGGGG - Intergenic
944163679 2:196694132-196694154 AACCAGGGAGGCAGAGGTTGCGG - Intronic
944576261 2:201094038-201094060 TAGTAGAGACGAAGAGGCTGAGG + Intergenic
945883840 2:215354103-215354125 AACCATGGAGGCAGAGGCTGTGG - Intergenic
946025842 2:216671238-216671260 GAGCAGGGAGACAGAAGCGGTGG - Intergenic
946106992 2:217379559-217379581 GAGCAGGGAGGGATAGCCTGAGG + Intronic
946190967 2:218007784-218007806 CACCCGGGACTCAGAGGCTGAGG - Intergenic
946197985 2:218049582-218049604 AACCTGGGAGGCAGAGGCTGCGG - Intronic
946311884 2:218886635-218886657 GAGCAGGGAGGCAGCGGTGGGGG - Intronic
946400725 2:219467118-219467140 GAGCAGAGACACACAGGGTGAGG - Intronic
947035912 2:225854512-225854534 AACCCGGGACGCAGAGGTTGCGG + Intergenic
947673306 2:231955846-231955868 GAGCCTGGAGGCAGAGGTTGTGG - Intergenic
948436797 2:237959262-237959284 GAGGATGGAAGCAGAGGTTGGGG - Intergenic
948460418 2:238127555-238127577 GAGCAGAGACCCAGAGCCTCGGG - Intronic
948577836 2:238965614-238965636 GAGCAGGGAGGGGGAGGCAGAGG - Intergenic
948873690 2:240816713-240816735 GATGTGGGACTCAGAGGCTGGGG - Intronic
949016803 2:241718088-241718110 AACCCGGGAGGCAGAGGCTGCGG - Intronic
949053034 2:241907788-241907810 AACCTGGGAGGCAGAGGCTGTGG - Intergenic
1169191926 20:3663299-3663321 GAGCAGGGACAGAGAGGCCAGGG + Intronic
1169290246 20:4343716-4343738 GACCCGGGAGGCAGAGGTTGCGG - Intergenic
1170610082 20:17905902-17905924 GAGCAGAGATGCACAGGCAGAGG + Intergenic
1170894580 20:20402054-20402076 CAGCAGGCACGGAGAGGCAGCGG + Intronic
1171045968 20:21809576-21809598 GAAAAGGGCCACAGAGGCTGAGG + Intergenic
1171191323 20:23161658-23161680 GTGGAGGGGCGCAGCGGCTGTGG + Intergenic
1171781910 20:29427429-29427451 GTGCAGGGAAGCAGCAGCTGTGG + Intergenic
1171963396 20:31511965-31511987 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
1172036780 20:32016576-32016598 AACCTGGGAGGCAGAGGCTGCGG + Intronic
1172272318 20:33661726-33661748 AAGCTGGGAGGCAGAGGTTGCGG - Intronic
1172354718 20:34271641-34271663 AACCTGGGAGGCAGAGGCTGTGG - Intergenic
1172412376 20:34734728-34734750 AACCTGGGACGCAGAGGTTGCGG - Intronic
1172519451 20:35557556-35557578 GTGGAGGGTGGCAGAGGCTGGGG - Exonic
1172600405 20:36178995-36179017 GACCTGGGAGGCAGAGGTTGTGG + Intronic
1172653615 20:36523160-36523182 TACCTGGGAGGCAGAGGCTGTGG - Intronic
1172697010 20:36829919-36829941 AACCAGGGAGGCAGAGGCTGCGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1172734752 20:37117958-37117980 AAGCCGGGAGGCAGAGGTTGCGG + Intronic
1173128857 20:40367836-40367858 AACCAGGGAAGCAGAGGTTGCGG - Intergenic
1173146802 20:40531847-40531869 GAGCTGGGGCGAATAGGCTGGGG - Intergenic
1173167750 20:40697877-40697899 GAGCAGGGAGGGAGAGACTGGGG + Intergenic
1173206102 20:40995003-40995025 AACCTGGGAGGCAGAGGCTGTGG - Intergenic
1173554051 20:43953027-43953049 GAGGATGGAAGCAGAGACTGGGG + Intronic
1173559759 20:43994673-43994695 GGGCAGGGACGGGGAGGCTCTGG - Intronic
1173645450 20:44630265-44630287 AACCAGGGAGTCAGAGGCTGTGG + Intronic
1174084091 20:47992937-47992959 GAGCATGGACACAAAGGGTGAGG + Intergenic
1174471007 20:50760824-50760846 AAGCTGGGAGGCAGAGGTTGCGG - Intergenic
1174549622 20:51352573-51352595 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
1175193434 20:57226267-57226289 CAGCCTGGACACAGAGGCTGTGG + Intronic
1175330194 20:58158315-58158337 TTGGAGGGAAGCAGAGGCTGGGG - Intronic
1175496684 20:59419351-59419373 GAGGAGGGAGGCAGGGCCTGGGG + Intergenic
1176102264 20:63369940-63369962 GTGCTGGGAGGCAGAGCCTGAGG - Intronic
1176103140 20:63373609-63373631 GGGCAGGGAGTCAGAGGCAGAGG - Intronic
1176141165 20:63545700-63545722 GACCAGGGACAGAGAGGCAGCGG + Intronic
1176233469 20:64043037-64043059 GAGCAGGGTCGGGGAGGATGGGG + Intronic
1176235108 20:64050302-64050324 GAGCAGGGACGCAGAGGCTGTGG + Intronic
1176258271 20:64165165-64165187 AAGCAGGGTCTCAGAGTCTGGGG + Intronic
1176385502 21:6137064-6137086 GGGCAGGGAAGGGGAGGCTGTGG - Intergenic
1177423843 21:20897171-20897193 GACCTGGGAGGCAGAGGTTGTGG - Intergenic
1178273574 21:31216090-31216112 GAACTGGGAGGCAGAGGGTGCGG + Intronic
1178369860 21:32018313-32018335 AACCTGGGAGGCAGAGGCTGTGG + Intronic
1178410861 21:32362744-32362766 GAGAAGGGATGCAGTGGCTCAGG - Intronic
1178527564 21:33344863-33344885 AAGCTGGGAGGCAGAGGTTGCGG - Intronic
1178680393 21:34669176-34669198 CAGAAGGGGCGCAGAGGCTTGGG + Intergenic
1179140650 21:38722229-38722251 AACCTGGGAGGCAGAGGCTGTGG - Intergenic
1179590660 21:42405896-42405918 GATCAGGGTCGCTGATGCTGGGG + Intronic
1179737971 21:43401188-43401210 GGGCAGGGAAGGGGAGGCTGTGG + Intergenic
1179928368 21:44550757-44550779 GAGGAGGGACACAGAGGAGGAGG + Exonic
1179939284 21:44627851-44627873 GAGGAGGGACACAGAGGAGGAGG - Exonic
1179942123 21:44647156-44647178 GAGGAGGGACACAGAGGAGGAGG - Exonic
1179949643 21:44702602-44702624 GAGGAGGGACACAGAGGAGGAGG - Intronic
1180005931 21:45020555-45020577 GAGAAGGCAGGCAGTGGCTGGGG - Intergenic
1180180355 21:46116134-46116156 GGGGAGGGTCGTAGAGGCTGAGG - Intronic
1180558236 22:16594584-16594606 AACCCGGGAGGCAGAGGCTGTGG - Intergenic
1180576518 22:16780373-16780395 AAGCTGGGAGGCAGAGGTTGCGG + Intergenic
1180750902 22:18123650-18123672 AACCTGGGAGGCAGAGGCTGAGG - Intronic
1181024681 22:20121325-20121347 AAGCCGGGAGGCAGAGGTTGCGG - Intronic
1181042360 22:20198154-20198176 CAGCAGAAACACAGAGGCTGAGG - Intergenic
1181386886 22:22552871-22552893 GAGGAGGGACCCAGAGGCCATGG - Intronic
1181630364 22:24147975-24147997 GAGCAGGCAGGAAGAGGCTGAGG + Intronic
1181696465 22:24595160-24595182 GGCCAGGGACACAGAGGGTGGGG - Intronic
1181812247 22:25410574-25410596 AACCCGGGAGGCAGAGGCTGCGG - Intergenic
1182106795 22:27695463-27695485 GCCCAGGGAGGCCGAGGCTGTGG + Intergenic
1182178232 22:28315855-28315877 GAGCAGGGACACAAAGGATGAGG + Intronic
1182326844 22:29519708-29519730 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1182329819 22:29543268-29543290 AAGCTGGGAGGCAGAGGATGTGG + Intronic
1182339224 22:29606030-29606052 AACCCGGGAAGCAGAGGCTGCGG - Intronic
1182535614 22:31000410-31000432 AACCCGGGAGGCAGAGGCTGTGG - Intergenic
1182565830 22:31198474-31198496 AACCCGGGAGGCAGAGGCTGTGG - Intronic
1182669699 22:31985416-31985438 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
1182802507 22:33042919-33042941 GAGCAGGGAGGCAGAAGCTCCGG - Intronic
1182911402 22:33987588-33987610 GAACCGGGAGGCAGAGGTTGTGG - Intergenic
1183332456 22:37228806-37228828 GGGCAGGGACGAGGAGCCTGAGG + Intronic
1183408788 22:37643040-37643062 GAGGAGGGAGCCAGAAGCTGGGG - Intronic
1183430288 22:37761784-37761806 GGGGTGGGACGCAGAGGGTGAGG + Intronic
1183510028 22:38229299-38229321 GTTCAGGGAGGCAGAGTCTGAGG - Intronic
1183663832 22:39236055-39236077 GAGCTGGGTCTCAGAGGCTTCGG - Intronic
1184238567 22:43199709-43199731 GGGCAGGGGCACTGAGGCTGGGG + Exonic
1184266694 22:43350934-43350956 AACCTGGGAGGCAGAGGCTGTGG + Intergenic
1184384575 22:44166961-44166983 GGGGAGGGAGGCAGTGGCTGTGG + Intronic
1184524932 22:45016667-45016689 GAACCGGGAGGCAGAGGTTGCGG - Intergenic
1184629348 22:45763586-45763608 GAGCAGGGACAGAGAGGTGGGGG - Intronic
1185079208 22:48700421-48700443 GAGCAGGCCGGCAGGGGCTGGGG + Intronic
1185179052 22:49348897-49348919 GACCAGGGAAGGAGAGGGTGTGG - Intergenic
1185232178 22:49689613-49689635 GAACAGGGAAACTGAGGCTGAGG + Intergenic
950001762 3:9662008-9662030 AACCCGGGAGGCAGAGGCTGTGG + Intronic
950040851 3:9918225-9918247 GTGCTGGGAAGCAGGGGCTGGGG - Intronic
950391738 3:12702207-12702229 AACCAGGGAGGCAGAGGTTGCGG - Intergenic
950475098 3:13210071-13210093 GAACCGGGACTCAGAGGCTGAGG - Intergenic
951079034 3:18429297-18429319 GAGCAGGGAGGAAGAAGCTGGGG + Intronic
951910092 3:27741305-27741327 AACCAGGGAGGCAGAGGTTGCGG - Intergenic
952386755 3:32847272-32847294 GACCCGGGACGCGGAGGTTGCGG - Intronic
952424614 3:33162837-33162859 AACCTGGGAGGCAGAGGCTGCGG + Intronic
952883892 3:38001351-38001373 GAGGAAGGCCTCAGAGGCTGGGG + Intronic
953055336 3:39383460-39383482 GAGCAGAGCCGCGGAGTCTGCGG + Exonic
953606090 3:44414260-44414282 GAGCAGGAATTCAAAGGCTGAGG - Intergenic
953841249 3:46391767-46391789 GGGTAGGGGAGCAGAGGCTGGGG + Intergenic
953968946 3:47332275-47332297 GAGCTGGGAGGCAGAGGTTGAGG + Intronic
954036096 3:47852068-47852090 GAAGAGGGGTGCAGAGGCTGTGG - Exonic
954142404 3:48615374-48615396 AACCCGGGAGGCAGAGGCTGTGG + Intergenic
954145599 3:48632879-48632901 GAGCAGGGCAGGAGCGGCTGGGG - Intronic
954316239 3:49803278-49803300 GCGCAGGCAGGCGGAGGCTGAGG + Exonic
954442736 3:50530586-50530608 GCGCAGGGACGCAGGGACGGGGG + Intergenic
954680268 3:52342139-52342161 GAGCAGCAGTGCAGAGGCTGAGG + Intronic
954685436 3:52367650-52367672 GAACAAGGAGGCAGAGGTTGCGG - Intronic
954721473 3:52567707-52567729 AACCTGGGAGGCAGAGGCTGCGG - Intronic
954762757 3:52888924-52888946 GAGGAAGGAGGGAGAGGCTGGGG - Intronic
955266633 3:57450468-57450490 AAGCAGGGAGGCGGAGGTTGTGG + Intronic
955546215 3:60033414-60033436 AACCTGGGAGGCAGAGGCTGCGG + Intronic
955763295 3:62313049-62313071 AACCTGGGAGGCAGAGGCTGAGG + Intergenic
956527335 3:70179421-70179443 GAGCAGAGTTGCAGAGGCTGAGG + Intergenic
956822158 3:72963748-72963770 GACCTGGGAGGCAGAGGTTGCGG - Intronic
957083591 3:75658968-75658990 GTGCAGGGAAGCAGCAGCTGTGG - Intergenic
957149157 3:76463049-76463071 CAGCAGGGAAGTGGAGGCTGTGG + Intronic
957535217 3:81493608-81493630 AACCTGGGAGGCAGAGGCTGCGG - Intronic
957831642 3:85529679-85529701 AAGCAGTGACGGAGAGGATGGGG - Intronic
958270784 3:91496712-91496734 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
958999496 3:100946291-100946313 AACCTGGGAGGCAGAGGCTGAGG + Intronic
959120523 3:102226912-102226934 GACCATGGAAGCAGAGGTTGGGG - Intronic
959708336 3:109359758-109359780 GACCCGGGAGGCAGAGGTTGCGG - Intergenic
959776274 3:110167943-110167965 AACCTGGGACGCAGAGGTTGTGG - Intergenic
960675932 3:120194909-120194931 AACCAGGGAGGCAGAGGTTGTGG - Intronic
960813794 3:121652574-121652596 AAGCTGGGAGGCAGAGGCGGAGG + Intronic
961327078 3:126115174-126115196 CTGCAGGGGCCCAGAGGCTGGGG + Intronic
961453774 3:127014456-127014478 GCTGAGGGAGGCAGAGGCTGGGG - Exonic
961733908 3:128988460-128988482 GAACCGGGAGGCAGAGGTTGTGG + Intronic
961759291 3:129153706-129153728 AACCCGGGAGGCAGAGGCTGCGG + Intronic
962361975 3:134750282-134750304 TAGCAGGGACGGAGGGGCTCTGG - Intronic
962572901 3:136729056-136729078 AGCCAGGGAGGCAGAGGCTGCGG - Intronic
962886568 3:139633256-139633278 AACCTGGGAGGCAGAGGCTGCGG - Intronic
962981016 3:140490185-140490207 GAGCAGAGACCCAGAGGATCTGG - Intronic
963208250 3:142658396-142658418 AACCTGGGAGGCAGAGGCTGCGG + Intronic
963211378 3:142695870-142695892 AATCAGGGAGGCAGAGGTTGCGG - Intronic
963706778 3:148698042-148698064 CAGCCGGGACGCCGAGGCGGCGG + Exonic
964511815 3:157460750-157460772 GAGTAGGTATGCAGAGACTGAGG + Intronic
964665235 3:159164688-159164710 AACCTGGGAGGCAGAGGCTGTGG + Intronic
965115943 3:164487925-164487947 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
965781326 3:172289248-172289270 GAGAATGGAAGCAGAAGCTGGGG - Intronic
966279025 3:178208314-178208336 GGGCAGGGACACAGAGGGTTGGG - Intergenic
966800674 3:183761163-183761185 AACCAGGGAGGCAGAGGTTGTGG - Intronic
966817616 3:183902007-183902029 GAGCTGGGAGATAGAGGCTGTGG + Intergenic
966891091 3:184408195-184408217 GAACCGGGAAGCAGAGGTTGTGG - Intronic
966978090 3:185104183-185104205 GAGCATGGACACAAAGGATGAGG - Intronic
967296346 3:187968719-187968741 GAACCGGGAGGCAGAGGTTGCGG + Intergenic
967400602 3:189056171-189056193 GACCCGGGAGGCAGAGGTTGCGG - Intronic
967643919 3:191899402-191899424 GGGTAGGGGAGCAGAGGCTGAGG + Intergenic
967805321 3:193710686-193710708 CAGCAGGGACCCAGAGGCCGCGG + Intergenic
967811139 3:193762097-193762119 GAGCAGGAACCCAGAGGGAGGGG + Intergenic
968179348 3:196580281-196580303 GACCCGGGAGGCAGAGGTTGCGG - Intronic
968248467 3:197180402-197180424 TAGGAGGGACGCTGAGGGTGCGG + Intronic
968314854 3:197715209-197715231 AACCCGGGAGGCAGAGGCTGTGG + Intronic
968560494 4:1278817-1278839 GAGCGAGGACGCAGAGGCCAGGG - Intergenic
968699175 4:2046755-2046777 GAGCAGGAAGGGAGGGGCTGCGG - Intergenic
968766674 4:2474947-2474969 AACCAGGGAGGCAGAGGTTGCGG + Intronic
968805111 4:2767176-2767198 GGGCAGGAAGGCTGAGGCTGGGG + Intergenic
969422016 4:7103037-7103059 GTCCAGGGCCGCAGAGGCAGGGG + Intergenic
969561507 4:7950955-7950977 GAGCAGGGAGGAAGAGGAAGGGG + Intergenic
969671747 4:8593519-8593541 GAGCAGGAAGGTAGAGGCTGGGG + Intronic
969847598 4:9931457-9931479 GAGCAGGGGAGAAGAGGCTAAGG + Intronic
970566476 4:17336689-17336711 GCGGATGGACGGAGAGGCTGTGG - Intergenic
970596306 4:17603582-17603604 AACCTGGGAGGCAGAGGCTGTGG - Intronic
972203814 4:36747607-36747629 GAGCAGGCAGGCAGGAGCTGGGG + Intergenic
972504142 4:39705273-39705295 AACCCGGGAGGCAGAGGCTGTGG - Intronic
974037059 4:56826603-56826625 AAGCCGGGAGGCAGAGGTTGTGG + Intergenic
974660384 4:64880785-64880807 GGTCAGGGAGGCAGAGGTTGCGG + Intergenic
974746693 4:66087107-66087129 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
975988859 4:80236044-80236066 GAGCAGGGAGGGAGAGGGTATGG - Intergenic
976199977 4:82568374-82568396 GAACTGGGAGGCAGAGGTTGCGG - Intergenic
976717729 4:88140542-88140564 AACCAGGGAGGCAGAGGTTGCGG + Intronic
977221321 4:94340734-94340756 AACCCGGGAGGCAGAGGCTGCGG - Intronic
978154537 4:105473994-105474016 CCGCAGGCACGCAGCGGCTGGGG + Exonic
978429959 4:108623252-108623274 AAGCTGGGAGGCAGAGGTTGTGG + Intronic
979175148 4:117653182-117653204 GAGTGTGGAAGCAGAGGCTGGGG - Intergenic
981080605 4:140635851-140635873 TGGCAGGGAGGCAGAAGCTGAGG + Intronic
981584145 4:146282891-146282913 GAGCAGGGGTGGAGATGCTGTGG - Intronic
981711430 4:147712505-147712527 GAACCGGGAGGCAGAGGTTGTGG + Intergenic
981744293 4:148037328-148037350 GGGTAGGGAGGAAGAGGCTGTGG + Intronic
982480878 4:155908387-155908409 GAGCAGGGGCTCAGAGGTAGAGG - Intronic
982796201 4:159648133-159648155 GAGCTGGGAGGCAGAGGTTGCGG - Intergenic
983258268 4:165426836-165426858 GAGCATGGACACAAAGGGTGAGG + Intronic
983792239 4:171813050-171813072 GAGCCGGGGCGCGGCGGCTGCGG - Intronic
983858775 4:172678421-172678443 AACCAGGGAGGCAGAGGTTGCGG - Intronic
984549805 4:181146692-181146714 GAGCAGGGATGCCAAGACTGAGG - Intergenic
984899054 4:184568246-184568268 AAGCCGGGAGGCAGAGGTTGGGG + Intergenic
984952615 4:185018481-185018503 GCGCAGGGGCGCAGCGGCCGCGG - Intergenic
985002114 4:185495993-185496015 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
985495211 5:200326-200348 GATCAGGGTTGCAGAGCCTGTGG - Exonic
985577459 5:680143-680165 CAGCAGGGGCGCAGGGGCCGCGG - Intronic
985592391 5:772239-772261 CAGCAGGGGCGCAGGGGCCGCGG - Intergenic
985913255 5:2898896-2898918 GAGCAGGGCCCTAAAGGCTGAGG - Intergenic
985959303 5:3287726-3287748 GTGCTGGGGCGCAAAGGCTGTGG - Intergenic
986192763 5:5512076-5512098 GAGCAGGGACACAGGAGGTGAGG + Intergenic
986285319 5:6354574-6354596 GAAGAAGGAGGCAGAGGCTGGGG + Intergenic
986663200 5:10077287-10077309 GAGAGGGGGCGCAGAGGCAGCGG - Intergenic
987344820 5:16969704-16969726 GAACCGGGAGGCAGAGGTTGCGG + Intergenic
987879735 5:23727991-23728013 AACCCGGGAGGCAGAGGCTGTGG - Intergenic
988042252 5:25904745-25904767 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
988324823 5:29749942-29749964 AATCAGGGACTCGGAGGCTGAGG + Intergenic
988835159 5:35024890-35024912 AACCTGGGAGGCAGAGGCTGTGG + Intronic
989070052 5:37500801-37500823 AACCCGGGAGGCAGAGGCTGCGG - Intronic
990029776 5:51243487-51243509 AAGCTGGGAGGCAGAGGTTGCGG - Intergenic
990310156 5:54530103-54530125 GAGGAGGGAGGCACAGACTGAGG - Intronic
990718334 5:58664477-58664499 GAGCAGGGAGGCAGTGGAGGTGG + Intronic
990920805 5:60964526-60964548 AACCTGGGACGCAGAGGTTGCGG - Intronic
991372283 5:65931894-65931916 AACCCGGGAGGCAGAGGCTGCGG - Intronic
992369676 5:76130043-76130065 GAGAAGGGAGGCTGAGGATGGGG - Intronic
992437182 5:76765996-76766018 GAACCGGGAGGCAGAGGTTGTGG + Intergenic
992704620 5:79378139-79378161 GAACCGGGAGGCAGAGGTTGTGG + Intronic
994157368 5:96518944-96518966 AACCCGGGAGGCAGAGGCTGAGG + Intergenic
994324742 5:98435924-98435946 GAGTGGGGAAGCAGAGGCTGAGG - Intergenic
994370266 5:98959673-98959695 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
995145978 5:108787318-108787340 GAGGGGGGCCGCAGGGGCTGAGG + Intronic
996896696 5:128492723-128492745 AACCTGGGAGGCAGAGGCTGTGG + Intronic
997211716 5:132080818-132080840 GGGCAGGGAAGAGGAGGCTGGGG - Intergenic
997283197 5:132661324-132661346 CAGCAAGGACGGAGAGGCTTGGG + Intergenic
997513952 5:134472420-134472442 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
997950459 5:138238714-138238736 AATCAGGGAAGCAGAGGTTGTGG - Intergenic
997984476 5:138492002-138492024 GCGCAGGGGCGCAGGGGCTCCGG - Intergenic
998004151 5:138646277-138646299 GAGCAGGGAGGCAGGGGCTTTGG - Intronic
998130297 5:139648374-139648396 GAGCGGGGATGTAGAGGCGGCGG + Exonic
998174853 5:139895404-139895426 GAGCAGGGCAGCAGTTGCTGGGG + Intronic
998388053 5:141769536-141769558 GAGGAGGCATGCAGGGGCTGGGG - Intergenic
998498595 5:142612735-142612757 GAGCAGGAAGGCTGAGGCTGGGG - Intronic
998712563 5:144843415-144843437 CAGCAGTGACGCAGAAGTTGTGG + Intergenic
998829898 5:146146260-146146282 GAGCCAGGAGGCAGAGGCTGCGG + Intronic
998998490 5:147893618-147893640 AACCAGGGAGGCAGAGGTTGTGG - Intronic
999135054 5:149313046-149313068 GAACCGGGAGGCAGAGGTTGTGG + Intronic
999353923 5:150905445-150905467 GAGCAGGGAAGAGGAGACTGAGG + Intergenic
999420080 5:151433359-151433381 AACCAGGGAAGCAGAGGTTGCGG - Intergenic
1000529905 5:162406614-162406636 GACCAGGGAGGCAGAGGCAAAGG + Intergenic
1001041428 5:168338231-168338253 AAGCAGGGAGGCGGAGGTTGTGG + Intronic
1001090820 5:168739498-168739520 AAGCTGGGAGGCAGAGGTTGTGG - Intronic
1001832905 5:174804495-174804517 AACCCGGGAGGCAGAGGCTGTGG - Intergenic
1001878605 5:175222706-175222728 CAGCAGGGCTCCAGAGGCTGAGG - Intergenic
1002001786 5:176200144-176200166 GAGCAGGGAGGCAAAGGCGTTGG + Intergenic
1002062335 5:176632937-176632959 CAGCAGGGAAGCAGAGGGCGGGG + Intronic
1002252550 5:177938826-177938848 GAGCAGGGAGGCAAAGGCGTTGG - Intergenic
1002549255 5:179974825-179974847 GAGCAGGCACGCAGCGGCGCGGG + Intronic
1003105741 6:3214379-3214401 AACCCGGGAGGCAGAGGCTGCGG - Intergenic
1003198809 6:3939828-3939850 GAGCAGGGACGCTGAGCCCAGGG + Intergenic
1003591170 6:7437998-7438020 AACCTGGGAGGCAGAGGCTGCGG + Intergenic
1003985020 6:11426772-11426794 GTGCAGGGACACACAGCCTGGGG + Intergenic
1004891554 6:20105696-20105718 GAACCAGGAGGCAGAGGCTGGGG + Intronic
1005069158 6:21848594-21848616 GCTCAGGGACGTAGAGGCTGCGG + Intergenic
1005654310 6:27918060-27918082 AACCAGGGAGGCAGAGGTTGAGG - Intergenic
1005829913 6:29662403-29662425 GAACCGGGAGGCAGAGGTTGCGG + Intronic
1005870664 6:29972272-29972294 GACCTGGGACACAGAGACTGAGG - Intergenic
1006327363 6:33364830-33364852 GAGCAGGGAGGCAGTGGGGGAGG - Intergenic
1006392936 6:33769502-33769524 GTGCAGGGACACAGAGGCAAGGG - Intergenic
1006648956 6:35535345-35535367 GTGGAGGGACTGAGAGGCTGGGG - Intergenic
1006970671 6:38041912-38041934 AACCTGGGAGGCAGAGGCTGCGG - Intronic
1007006526 6:38368773-38368795 GAGCAGGGACCCTTAGCCTGAGG - Intronic
1007323658 6:41044155-41044177 GAGGAGGGACGCCCAGGGTGGGG + Exonic
1007914911 6:45552445-45552467 GAGTAGCCAGGCAGAGGCTGAGG + Intronic
1008007943 6:46432289-46432311 AACCAGGGAGGCAGAGGTTGTGG - Intronic
1008238068 6:49074215-49074237 AACCTGGGAGGCAGAGGCTGGGG - Intergenic
1008934334 6:56973830-56973852 GAGCTGGGAAGCTGAGGCTGTGG - Intronic
1009568902 6:65354737-65354759 AACCAGGGACGCAGAGATTGCGG + Intronic
1011289876 6:85765872-85765894 TAGCAGTGAGCCAGAGGCTGAGG + Intergenic
1011424755 6:87214290-87214312 AAGCAGGGACAGAGATGCTGGGG - Intronic
1011452600 6:87510791-87510813 GACCTGGGAGGCAGAGGTTGCGG + Intronic
1011465419 6:87650927-87650949 GACCTGGGAGGCAGAGGTTGCGG + Intronic
1012468330 6:99540467-99540489 AACCTGGGAGGCAGAGGCTGTGG - Intergenic
1012898734 6:104982234-104982256 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1013188774 6:107784297-107784319 GAGAAGGGACCCAGAGGATGGGG + Intronic
1013862471 6:114652338-114652360 GTTCTGGGAAGCAGAGGCTGAGG - Intergenic
1014468423 6:121784469-121784491 AACCTGGGAGGCAGAGGCTGTGG + Intergenic
1016999890 6:149989401-149989423 AACCCGGGAGGCAGAGGCTGCGG - Intergenic
1017406276 6:154122987-154123009 GAGCATGGACACAAAGGGTGAGG + Intronic
1017844197 6:158241670-158241692 AACCAGAGACGCAGAGGTTGCGG - Intronic
1018656656 6:166043235-166043257 GAGGAGGGGTGGAGAGGCTGGGG + Intergenic
1018889591 6:167973818-167973840 GAGCATGGAGGCATGGGCTGGGG + Intergenic
1018893042 6:167996169-167996191 GGGCAGGGAAGGAGATGCTGGGG - Intergenic
1018900439 6:168049264-168049286 AAGCAAGGACGCTGAGGCTGTGG + Intergenic
1019402578 7:864704-864726 AAGCCGGGAGGCAGAGGTTGCGG - Intronic
1019499697 7:1358758-1358780 GGGCAGAGAAGCAGAGGGTGGGG - Intergenic
1019552720 7:1611139-1611161 GAGGAGGGAGACACAGGCTGAGG - Intergenic
1019577178 7:1743204-1743226 GAGCCTGGACACAGAGGATGTGG - Intronic
1019595668 7:1857282-1857304 GAGCACTGAGTCAGAGGCTGTGG - Intronic
1019682346 7:2358159-2358181 AAGCGGGGAGGCAGAGGCTGCGG - Intronic
1019716278 7:2540928-2540950 GAGGAGGGAGGCAGAGGCAGTGG - Intronic
1019774960 7:2906847-2906869 GAGGAGACACGCAGGGGCTGTGG + Intronic
1020046805 7:5046362-5046384 GAGCCGTGGGGCAGAGGCTGCGG + Exonic
1020112716 7:5456489-5456511 GAGCAGGGAGGCAGAGCCTGAGG + Intronic
1020219319 7:6222667-6222689 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1020288714 7:6706444-6706466 GAGCGGTGGGGCAGAGGCTGCGG - Exonic
1020834650 7:13134356-13134378 GCACTGGGAGGCAGAGGCTGGGG - Intergenic
1021499876 7:21320559-21320581 GAGCCGGGAAGTTGAGGCTGCGG + Intergenic
1021660535 7:22914821-22914843 GAGTAGGGGAGCGGAGGCTGAGG - Intergenic
1023079353 7:36513201-36513223 GCACAGGGAGGCAGAGGCTTGGG - Exonic
1023373293 7:39532864-39532886 GAGCAGGAACCAAGAGGCAGAGG - Intergenic
1023409900 7:39879959-39879981 GACCAGGGAGGCAGAGGTTGCGG - Intergenic
1023775165 7:43598839-43598861 GAACTGGGAGGCAGAGGTTGCGG - Intronic
1023864327 7:44231762-44231784 GAGCAGGGTGGGAGAGTCTGGGG - Intronic
1023891794 7:44398107-44398129 GAGCAGGGATGCAGGGGTTCTGG - Intronic
1025766115 7:64452607-64452629 AATCAGGGAAGCAGAGGTTGCGG + Intergenic
1025986629 7:66458600-66458622 GACCTGGGAGGCAGAGGCAGAGG + Intergenic
1026285829 7:68962055-68962077 AACCAGGAAGGCAGAGGCTGCGG + Intergenic
1026661124 7:72303477-72303499 AACCTGGGAGGCAGAGGCTGCGG + Intronic
1026668884 7:72369437-72369459 AACCTGGGAGGCAGAGGCTGAGG - Intronic
1026858836 7:73771587-73771609 GTGCAGGGACTCTGAGGCAGGGG - Intergenic
1026887637 7:73962863-73962885 GAACCGGGAGGCAGAGGTTGCGG - Intergenic
1026890531 7:73979158-73979180 GGGAAGGGAAGCAGAAGCTGAGG - Intergenic
1026975563 7:74495640-74495662 GAGGAGGGAAGGAGGGGCTGAGG + Intronic
1027116501 7:75485876-75485898 GAGCCGTGGGGCAGAGGCTGCGG - Exonic
1027121791 7:75527577-75527599 GAGCCGGGGGGCAGAGGCTGCGG - Intergenic
1027186988 7:75978599-75978621 GACCTGGGAGGCAGAGGTTGTGG - Intronic
1027209898 7:76137445-76137467 GACCTGGGAGGCAGAGGCAGAGG + Intergenic
1027275325 7:76549827-76549849 GAGCCGTGGGGCAGAGGCTGCGG + Intergenic
1028147167 7:87330838-87330860 GAGCATGGACACAAAGGGTGAGG + Intergenic
1028537051 7:91901333-91901355 GAACCGGGAGGCAGAGGTTGTGG + Intergenic
1029126182 7:98296544-98296566 GAACAGGGAGGCAGAGGTTGTGG + Intronic
1029137371 7:98383359-98383381 AACCAGGGAAGCAGAGGTTGTGG - Intronic
1029176866 7:98670717-98670739 GAACAAGGAGGCAGAGGTTGCGG + Intergenic
1029509825 7:100987142-100987164 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1029551140 7:101237701-101237723 GAAGAGGCAGGCAGAGGCTGAGG - Exonic
1029620538 7:101687822-101687844 GGGGAGGGAGGAAGAGGCTGTGG + Intergenic
1029721036 7:102364377-102364399 GAGCCGTGGGGCAGAGGCTGCGG + Exonic
1030021395 7:105278606-105278628 GACCTGGGAGGCAGAGGTTGTGG + Intronic
1030027219 7:105335876-105335898 AAGCTGGGAGGCAGAGGTTGCGG + Intronic
1030075117 7:105730101-105730123 AAGCAGGGCAGGAGAGGCTGTGG + Intronic
1030077141 7:105746466-105746488 GGGGAGAGACGCAGAAGCTGGGG - Intronic
1030648921 7:112096009-112096031 AACCCGGGAAGCAGAGGCTGCGG + Intronic
1030929708 7:115507030-115507052 GAGCAGCCACACAGAGACTGAGG + Intergenic
1031361724 7:120856884-120856906 GAGGAGGGACGGGCAGGCTGTGG - Intronic
1031596000 7:123649730-123649752 AACCTGGGAGGCAGAGGCTGCGG + Intergenic
1032135508 7:129273404-129273426 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1032194972 7:129783215-129783237 CACCAGGGACACAGCGGCTGGGG - Intergenic
1032337080 7:131035208-131035230 GACCCGGGAGGCAGAGGTTGTGG + Intergenic
1032339514 7:131058173-131058195 AACCTGGGAGGCAGAGGCTGTGG - Intergenic
1032369593 7:131333612-131333634 GACCCGGGAGGCAGAGGTTGCGG - Intronic
1032419650 7:131767855-131767877 GAGCAGGGACGCAGCCTCTGCGG - Intergenic
1032424090 7:131806556-131806578 GAGCTGGAGAGCAGAGGCTGTGG + Intergenic
1032640634 7:133763209-133763231 GACCCTGGAAGCAGAGGCTGTGG - Intronic
1033606378 7:142931098-142931120 AACCTGGGAGGCAGAGGCTGCGG - Intronic
1033656997 7:143381335-143381357 GGACCGGGACGCAGAGTCTGCGG + Exonic
1033672497 7:143506236-143506258 TAGCAGGGCAGCAGAGGATGAGG + Intergenic
1034018417 7:147612476-147612498 GACCTGGGAGGCAGAGGTTGTGG - Intronic
1034180628 7:149134806-149134828 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1034448093 7:151123535-151123557 GAGCAAGGACAGAGAGGCCGAGG - Intronic
1034502040 7:151456894-151456916 GAGCAGGGTAGCAGAGGCCCTGG + Intergenic
1034582588 7:152058410-152058432 GAACCGGGAGGCAGAGGTTGCGG - Intronic
1034918029 7:155056948-155056970 GAGCAGGGAAGCAGAGAGAGTGG - Intergenic
1035475712 7:159143086-159143108 GAGGAGGGAGGCAGAGGTGGGGG + Intronic
1035557996 8:580536-580558 GAGCAGGGACCCAGCAGCTCCGG + Intergenic
1035663417 8:1363787-1363809 GAGCCAGGCCTCAGAGGCTGCGG + Intergenic
1035734254 8:1876364-1876386 GGGCAGGGCCGGGGAGGCTGGGG - Intronic
1035768238 8:2126169-2126191 AAGCAGAGATGCAGCGGCTGAGG + Intronic
1035868062 8:3106318-3106340 GACCAGGGAGGTTGAGGCTGTGG + Intronic
1036163514 8:6409897-6409919 GAGCAGGGACCCAGTGACAGAGG + Intronic
1036289914 8:7478143-7478165 GTGCAGGGACACACAGGCTCAGG + Intergenic
1036331563 8:7833384-7833406 GTGCAGGGACACACAGGCTCAGG - Intergenic
1036436777 8:8742345-8742367 AACCTGGGAGGCAGAGGCTGCGG - Intergenic
1037137568 8:15481167-15481189 GAACCTGGAAGCAGAGGCTGTGG + Intronic
1037860838 8:22404576-22404598 GAGCAGAGAAGCAGAGACTGAGG + Intronic
1037977971 8:23226411-23226433 AACCCGGGAGGCAGAGGCTGCGG + Intergenic
1038215484 8:25558260-25558282 GAGCAGGGACACATGAGCTGTGG - Intergenic
1038507775 8:28100466-28100488 GAGCAAGGACACAGGGGCTAAGG + Intronic
1039235974 8:35503143-35503165 GAGCAGGGACTCAAAGTGTGTGG + Intronic
1039415643 8:37391682-37391704 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
1039452604 8:37687656-37687678 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
1039457090 8:37714697-37714719 GAGAAGGGGAGCAGATGCTGAGG - Intergenic
1039704641 8:39994333-39994355 AACCTGGGACGCAGAGGTTGTGG - Intronic
1039912891 8:41838685-41838707 AACCCGGGAGGCAGAGGCTGCGG + Intronic
1039925054 8:41922136-41922158 GAACGGGGAGGCAGAGGTTGTGG + Intergenic
1040410748 8:47152040-47152062 TACCAGGTACACAGAGGCTGAGG + Intergenic
1040536485 8:48315456-48315478 GTGCCTGGAGGCAGAGGCTGTGG - Intergenic
1041042671 8:53863064-53863086 GAACTGGGAGGCAGAGGTTGCGG - Intronic
1041916059 8:63139935-63139957 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
1042258334 8:66829948-66829970 AACCTGGGAGGCAGAGGCTGCGG - Intronic
1042944809 8:74144481-74144503 GAGCAGGAAGGCAGAGGCCAGGG + Intergenic
1043851981 8:85225979-85226001 AACCCGGGAGGCAGAGGCTGCGG + Intronic
1044039274 8:87346117-87346139 AATCAGGGAGGCAGAGGCTGTGG - Intronic
1044690113 8:94869058-94869080 AACCAGGGAGGCAGAGGTTGTGG - Intronic
1045205828 8:100039453-100039475 GAGCCTGGAGGCAGAGGTTGCGG - Intronic
1045313758 8:101026189-101026211 AGCCAGGGACTCAGAGGCTGGGG - Intergenic
1045436686 8:102171330-102171352 GAGCAGGGGCCCAGAAGCAGAGG - Intergenic
1045520067 8:102895782-102895804 GAACAGGGAAGCAGAGGTTGCGG - Intronic
1046353044 8:113041126-113041148 AACCAGGGAAGCAGAGGTTGCGG + Intronic
1046472173 8:114690110-114690132 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
1046748027 8:117896943-117896965 AAACATGGAGGCAGAGGCTGGGG - Intronic
1047258231 8:123233096-123233118 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1047282379 8:123457142-123457164 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1047380859 8:124361355-124361377 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1047449865 8:124955512-124955534 AACCAGGGAGGCAGAGGTTGTGG + Intergenic
1047501187 8:125443074-125443096 AACCTGGGAGGCAGAGGCTGTGG - Intergenic
1048000643 8:130376823-130376845 AAGCCGGGAGGCAGAGGTTGCGG + Intronic
1048921168 8:139231376-139231398 TCGCAGGGCAGCAGAGGCTGAGG + Intergenic
1048965464 8:139611473-139611495 GAGCCAGGCCACAGAGGCTGGGG + Intronic
1049001944 8:139831856-139831878 GAGCACGGAGGCAGAGGCCTGGG - Intronic
1049145151 8:140995003-140995025 GAACTGGGAGGCAAAGGCTGTGG + Intronic
1049339660 8:142105375-142105397 GTCCAGGGAAGCAGGGGCTGAGG - Intergenic
1049356734 8:142192842-142192864 GAGCAGGGATGAAGAGGGAGTGG + Intergenic
1049362003 8:142216316-142216338 GTGCAGAGAGGCAGGGGCTGGGG + Intronic
1049380408 8:142311373-142311395 AACCCGGGAGGCAGAGGCTGTGG - Intronic
1049391208 8:142372619-142372641 GAGGAGGGGCACAGAGGCTCGGG - Intronic
1049478134 8:142806348-142806370 GAGTAGGGGCCCAGAGGCTCAGG - Intergenic
1049601448 8:143509619-143509641 GCTCTGGGACGCAGAGCCTGGGG + Intronic
1049724502 8:144139316-144139338 GTGCAGGGTTGGAGAGGCTGGGG + Intronic
1049750755 8:144282515-144282537 TAGCAGGGACGCAAAGGGTGGGG + Intronic
1049791881 8:144475903-144475925 GGGAAGGGAGGAAGAGGCTGTGG + Exonic
1049953830 9:673286-673308 GAACAGGGAGGCAGAGGTTGCGG - Intronic
1049970460 9:817637-817659 AACCTGGGAGGCAGAGGCTGCGG + Intergenic
1050348988 9:4721535-4721557 GAACTGGGAGGCAGAGGCTGCGG - Intronic
1050572760 9:6958507-6958529 AACCAGGGAGGCAGAGGTTGTGG + Intronic
1051347739 9:16167833-16167855 AACCCGGGAGGCAGAGGCTGTGG + Intergenic
1051400384 9:16675330-16675352 GAGCCCGGAGGCAGAGGTTGTGG - Intronic
1051774818 9:20622080-20622102 GAGGAGGGGAGCGGAGGCTGAGG + Intronic
1051817967 9:21132062-21132084 GACCACAGATGCAGAGGCTGTGG + Intergenic
1052747893 9:32458965-32458987 GAACCGGGAGGCAGAGGTTGCGG - Intronic
1053458372 9:38249529-38249551 GAGCAGGGACTCAGAGGCCATGG - Intergenic
1053683489 9:40500146-40500168 GAACTGGGAGGCAGAGACTGTGG - Intergenic
1054280226 9:63124775-63124797 GAACTGGGAGGCAGAGACTGTGG + Intergenic
1054296593 9:63335643-63335665 GAACTGGGAGGCAGAGACTGTGG - Intergenic
1054394610 9:64640149-64640171 GAACTGGGAGGCAGAGACTGTGG - Intergenic
1054429258 9:65145349-65145371 GAACTGGGAGGCAGAGACTGTGG - Intergenic
1054501125 9:65876182-65876204 GAACTGGGAGGCAGAGACTGTGG + Intergenic
1055092277 9:72375184-72375206 AAGCCGGGAGGCAGAGGTTGTGG - Intergenic
1055301124 9:74884069-74884091 AACCTGGGACGCAGAGGTTGTGG + Intronic
1055454509 9:76459827-76459849 GAGCAGGAAAGGAGAGGCTTCGG - Intronic
1055940616 9:81645660-81645682 AACCCGGGAGGCAGAGGCTGTGG + Intronic
1056336913 9:85580443-85580465 AACCCGGGACGCAGAGGTTGTGG - Intronic
1057038579 9:91831181-91831203 AACCAGGGAGGCGGAGGCTGTGG + Intronic
1057194677 9:93110466-93110488 CAACAGGGAAGCTGAGGCTGGGG + Intronic
1057260986 9:93583904-93583926 AACCAGGGAGGCAGAGGTTGTGG - Intronic
1057311749 9:93947538-93947560 GACGAGGGTCCCAGAGGCTGTGG - Intergenic
1057528917 9:95826958-95826980 GAGCAGGGTCGGACAGGATGGGG - Intergenic
1057588025 9:96347056-96347078 AACCAGGGAGGCAGAGGTTGTGG + Intronic
1057953166 9:99386004-99386026 CAGCAGGGAGCCAGAGCCTGGGG - Intergenic
1058022937 9:100109741-100109763 AACCAGGGAGGCAGAGGTTGTGG - Intronic
1058290102 9:103230281-103230303 GACCCGGGAGGCAGAGGTTGCGG - Intergenic
1058432773 9:104933443-104933465 GAACTGGGAGGCAGAGGTTGCGG + Intergenic
1059922893 9:119177945-119177967 GAGCAGGGAGCACGAGGCTGAGG + Intronic
1060020723 9:120128378-120128400 GATCATGGTCACAGAGGCTGGGG + Intergenic
1060366518 9:123021399-123021421 AAGCCGGGAGGCAGAGGTTGCGG - Intronic
1060427002 9:123514411-123514433 GAGAAGGGAGGCAGTGGCAGTGG + Intronic
1060444351 9:123674026-123674048 GAGAAGGGAGGCAGCAGCTGTGG - Intronic
1060484985 9:124041103-124041125 GAGCTGGGACGCCGGGTCTGGGG + Intergenic
1060495750 9:124117645-124117667 GAACAGGGAGGCTGAGGATGGGG + Intergenic
1060797413 9:126522153-126522175 GAGAAGGCACAGAGAGGCTGTGG - Intergenic
1060991953 9:127854469-127854491 GAGCAGGGACGCCGTCGCTCCGG - Exonic
1061047474 9:128174374-128174396 GTGCAGGGAGGCTGGGGCTGTGG + Intronic
1061068534 9:128294416-128294438 TGGCAGGGACCCAGAGACTGGGG - Intergenic
1061234212 9:129333147-129333169 AACCTGGGAGGCAGAGGCTGCGG - Intergenic
1061262984 9:129490160-129490182 GAGTAGGGAGGGAGAGGCAGGGG - Intergenic
1061364486 9:130164700-130164722 AACCAGGGAGGCAGAGGTTGCGG - Intergenic
1061371147 9:130198260-130198282 GAGGAAGGACGCAGAGACTGAGG + Intronic
1061396676 9:130347363-130347385 GAGCAGGGACCCAGAGCTGGGGG + Intronic
1061874073 9:133535269-133535291 CAGCCGGCAGGCAGAGGCTGGGG + Intronic
1061879596 9:133562201-133562223 CAGCAGGGCTGCAGAGGGTGCGG - Intronic
1061890976 9:133619196-133619218 GAGCAGAGTGGCAGAGGCTCTGG + Intergenic
1061946966 9:133913930-133913952 GAGGTGGGAGGCAGAGTCTGGGG - Intronic
1062107261 9:134762492-134762514 CAGCATGGACGCACAGGCCGGGG + Intronic
1062177811 9:135173936-135173958 GAAGTGGGAGGCAGAGGCTGGGG - Intergenic
1062253087 9:135608115-135608137 AATCAGGGACGATGAGGCTGTGG + Intergenic
1062464633 9:136675593-136675615 GAGCAGGGACGGAAAAGCTGTGG + Intronic
1062483239 9:136762134-136762156 GGGAAGGGAGGGAGAGGCTGGGG + Intronic
1062501955 9:136855478-136855500 GAGCTGGGCGGCAGGGGCTGGGG - Exonic
1062542634 9:137048417-137048439 GGGCAGAGACGCTGAGGGTGGGG + Exonic
1062657045 9:137609310-137609332 AACCAGGGAGGCAGAGGTTGCGG - Intronic
1185755912 X:2652694-2652716 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
1186696573 X:12039889-12039911 AACCAGGGAGGCAGAGGTTGAGG + Intergenic
1187319195 X:18225397-18225419 AACCCGGGAGGCAGAGGCTGCGG + Intergenic
1188421558 X:29995866-29995888 GAACCGGGAGGCAGAGGTTGCGG - Intergenic
1188485012 X:30672734-30672756 AACCAGGGAGGCAGAGGTTGCGG + Intronic
1188492153 X:30749231-30749253 AACCAGGGAGGCAGAGGTTGTGG - Intergenic
1189160582 X:38804903-38804925 GCGCAGGGACGCAGGGGCACGGG - Exonic
1189313291 X:40035128-40035150 AACCAGGGAGGCAGAGGTTGCGG - Intergenic
1189727570 X:43983574-43983596 GGGGAGGGAGGAAGAGGCTGTGG + Intergenic
1189926123 X:45957348-45957370 AACCTGGGATGCAGAGGCTGCGG + Intergenic
1189947243 X:46191714-46191736 GAGCAGGGACGTAGCCTCTGGGG + Intergenic
1190220561 X:48509755-48509777 AAGCAGGGACACAGAGGGAGCGG - Intronic
1191613715 X:63145422-63145444 GAGAAGAGAAGCAGATGCTGAGG + Intergenic
1191622581 X:63233505-63233527 GAGAAGAGAAGCAGATGCTGAGG - Intergenic
1192809555 X:74536662-74536684 GAGCAGGGAGGTAGAGGGCGGGG - Intergenic
1194216258 X:91133688-91133710 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
1194296307 X:92130570-92130592 AACCAGGGAGGCAGAGGTTGTGG + Intronic
1195923153 X:110002564-110002586 GAGGAGGGAGGCAGTGGCGGTGG + Intergenic
1196122987 X:112070140-112070162 GACCAGGGTCCCAGAGGCAGTGG + Intronic
1196301892 X:114057674-114057696 GAACCGGGAGGCAGAGGTTGCGG - Intergenic
1196401602 X:115322846-115322868 GAGCATGGACGCAAAGGGTGAGG - Intergenic
1197224378 X:123941921-123941943 AACCCGGGAGGCAGAGGCTGCGG - Intergenic
1197680664 X:129380684-129380706 AACCAGGGAGGCAGAGGTTGCGG + Intergenic
1197767171 X:130066838-130066860 CAGCAGGGACCCTGAGCCTGAGG + Exonic
1198311821 X:135432524-135432546 GAGGAGGGAAGCAGAGGCAGGGG - Intergenic
1199500296 X:148500387-148500409 GACCCGGGACGCAGGGGCCGTGG - Intergenic
1199546001 X:149007925-149007947 GGACAGAGAGGCAGAGGCTGGGG - Intergenic
1199699537 X:150365190-150365212 GAAAAGGGACGCAGAGGCAGAGG + Intronic
1199771141 X:150976081-150976103 GAGCAGGGACGCGGTGGCGCTGG + Intergenic
1199978850 X:152909762-152909784 CAGCTGGGCCCCAGAGGCTGAGG + Intergenic
1200609475 Y:5309000-5309022 AACCAGGGAAGCAGAGGTTGCGG + Intronic
1200613815 Y:5355181-5355203 AACCAGGGAGGCAGAGGTTGTGG + Intronic
1200786387 Y:7263993-7264015 GTGCAGGTTCGCAGAGGCTCGGG + Intergenic
1201337794 Y:12898970-12898992 GAGCATGGATGCAAAGGGTGAGG - Intergenic
1202302197 Y:23428731-23428753 GACCTGGGAAGCAGAGGTTGGGG - Intergenic
1202568614 Y:26241867-26241889 GACCTGGGAAGCAGAGGTTGGGG + Intergenic