ID: 1176237437

View in Genome Browser
Species Human (GRCh38)
Location 20:64060221-64060243
Sequence TCTGCAGTCCTGATACTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 154}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176237428_1176237437 28 Left 1176237428 20:64060170-64060192 CCTGCCCAGGAGGGGCCTCTCTG 0: 2
1: 0
2: 9
3: 34
4: 367
Right 1176237437 20:64060221-64060243 TCTGCAGTCCTGATACTTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 154
1176237435_1176237437 -9 Left 1176237435 20:64060207-64060229 CCAGCATCTCAGGATCTGCAGTC 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1176237437 20:64060221-64060243 TCTGCAGTCCTGATACTTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 154
1176237433_1176237437 -3 Left 1176237433 20:64060201-64060223 CCCTTACCAGCATCTCAGGATCT 0: 1
1: 0
2: 2
3: 18
4: 214
Right 1176237437 20:64060221-64060243 TCTGCAGTCCTGATACTTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 154
1176237431_1176237437 13 Left 1176237431 20:64060185-64060207 CCTCTCTGTGCTGCAGCCCTTAC 0: 1
1: 0
2: 2
3: 33
4: 295
Right 1176237437 20:64060221-64060243 TCTGCAGTCCTGATACTTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 154
1176237429_1176237437 24 Left 1176237429 20:64060174-64060196 CCCAGGAGGGGCCTCTCTGTGCT 0: 1
1: 1
2: 3
3: 18
4: 259
Right 1176237437 20:64060221-64060243 TCTGCAGTCCTGATACTTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 154
1176237434_1176237437 -4 Left 1176237434 20:64060202-64060224 CCTTACCAGCATCTCAGGATCTG 0: 1
1: 0
2: 0
3: 20
4: 178
Right 1176237437 20:64060221-64060243 TCTGCAGTCCTGATACTTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 154
1176237430_1176237437 23 Left 1176237430 20:64060175-64060197 CCAGGAGGGGCCTCTCTGTGCTG 0: 1
1: 1
2: 4
3: 43
4: 335
Right 1176237437 20:64060221-64060243 TCTGCAGTCCTGATACTTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176237437 Original CRISPR TCTGCAGTCCTGATACTTGG AGG Intronic
900679891 1:3910944-3910966 TCTGCAGTCCTGACGCCAGGGGG + Intergenic
905001178 1:34671292-34671314 TCTGCAGTCTTCACTCTTGGGGG + Intergenic
905709961 1:40093759-40093781 TCTGTAGTCCCGCTACTTGGGGG + Intronic
906287640 1:44598060-44598082 TCTGGAGGCCTGACTCTTGGAGG - Intronic
906901967 1:49845072-49845094 TCTGCATTCCTGACATTTGTAGG - Intronic
907008914 1:50944427-50944449 GCAGCAATCCTGACACTTGGTGG - Intronic
907465337 1:54631558-54631580 TCTGCAGTCCTATTAATTTGAGG - Intronic
907482867 1:54756718-54756740 CCTGCTGCCCCGATACTTGGGGG + Intergenic
911065295 1:93782438-93782460 TCAGCAGTGCTGATACTAAGTGG + Intronic
913188537 1:116392975-116392997 TCTTCAGACCTGGTACTTGTTGG - Exonic
914915599 1:151817333-151817355 TCTGCAGCCCAGGTACATGGTGG - Intronic
914942351 1:152034466-152034488 TCTGCAGTCCTTAGCCTTGCAGG + Intronic
917046490 1:170866313-170866335 TCTGCAGAAATGAAACTTGGAGG - Intergenic
917878470 1:179308938-179308960 TCTGCTGTACGGATGCTTGGCGG + Intronic
921712321 1:218385442-218385464 TCTGAAGTCGTGTTACTTTGGGG - Intronic
1064349533 10:14564449-14564471 TCTGCATCTCTGATTCTTGGGGG - Intronic
1064828893 10:19439413-19439435 CCTGCAGTCCTGATGGTGGGAGG + Intronic
1065102427 10:22344301-22344323 GATGAAGTCCTGATACTTTGTGG - Intergenic
1066978811 10:42392531-42392553 TCTGCTATCCTGGTCCTTGGAGG - Intergenic
1068092622 10:52451457-52451479 TCAGCAGTCTTCAAACTTGGGGG + Intergenic
1069616943 10:69812233-69812255 TCTGGAGTCCAGCTACATGGTGG + Intronic
1072095737 10:92177682-92177704 TCAGCAGTGGTGATTCTTGGAGG + Intronic
1073026155 10:100488661-100488683 TCTGAAGTCCAGCTCCTTGGTGG - Intronic
1075577013 10:123584890-123584912 TCTGGAGGACTCATACTTGGTGG - Intergenic
1077053707 11:579643-579665 TCTGCACCCCTGGTGCTTGGTGG - Intronic
1077703489 11:4462599-4462621 AGTCCAGCCCTGATACTTGGTGG - Intergenic
1084834315 11:71791838-71791860 TATGCTGTCCTGCTACTGGGCGG - Intronic
1085008378 11:73116035-73116057 TCTGCAGTCATCATATTTAGTGG - Intronic
1086700992 11:89900322-89900344 TCTGCCGTCCAGAAACTTAGTGG - Intergenic
1086705175 11:89944205-89944227 TCTGCCGTCCAGAAACTTAGTGG + Intergenic
1089011111 11:115132513-115132535 TGGGCAGTCTTGCTACTTGGTGG - Intergenic
1089178115 11:116562853-116562875 TCTGCAGCCCTCATCCTAGGAGG + Intergenic
1089608158 11:119653941-119653963 TCTGCAGAGCTGATAGGTGGTGG + Intronic
1090341122 11:126021466-126021488 TCTGCTGTCCAGAAACTTGGTGG - Exonic
1092021128 12:5203029-5203051 TCTTCAGTCCTGATGCGTGGGGG + Intergenic
1092546447 12:9456065-9456087 TCTGTTGTCCAGCTACTTGGGGG - Intergenic
1094175746 12:27539051-27539073 TCAGCACTACTGATACTTAGAGG - Intronic
1094506494 12:31066009-31066031 TCTGTTGTCCAGCTACTTGGGGG + Intergenic
1095493530 12:42760936-42760958 AGTGCAGTCCAGCTACTTGGTGG + Intergenic
1096830671 12:54311550-54311572 CCTGTAGTCCAGCTACTTGGAGG + Intronic
1102510626 12:113412996-113413018 CCTGTAGTCCTGCTACTTGGGGG + Intronic
1102960177 12:117087474-117087496 CCTTCAGTCCTGAGAATTGGAGG - Intronic
1107986809 13:45783308-45783330 TCTGGAGTCCTGGTATTGGGAGG + Exonic
1109460805 13:62655137-62655159 TCTTCAGTCGTGATCCTTGGAGG + Intergenic
1109821756 13:67666351-67666373 CTTGTAGTCCAGATACTTGGGGG - Intergenic
1111962863 13:94830474-94830496 GCTGCAGTCCTCACATTTGGAGG + Intergenic
1112485452 13:99815460-99815482 CCTGCAGTCCAGCTACTTGCAGG + Intronic
1113955558 13:114098519-114098541 GCTGCAGCCCTGAGACCTGGTGG + Intronic
1114407182 14:22467782-22467804 ACTGCAGTCCAGAGACATGGTGG - Intergenic
1114940680 14:27606695-27606717 TCTGAAGACCTGCTACCTGGAGG + Intergenic
1115427122 14:33273044-33273066 TCTGCAGTCCTGGTCCCTGACGG + Intronic
1118831813 14:69440460-69440482 TCTGTAGTCCAGATTCTTGGGGG + Intronic
1119208875 14:72814314-72814336 TCTGCCTTCATCATACTTGGGGG + Intronic
1122151613 14:99728937-99728959 GCTGCAGTACTGAGGCTTGGTGG - Intergenic
1122898494 14:104772226-104772248 GCTGCAGTCCTGGTACAAGGAGG - Intronic
1126429960 15:48572567-48572589 TCCCCAGTACTGATCCTTGGGGG - Intronic
1131167231 15:90151206-90151228 CCTGTAGTCCAGGTACTTGGAGG - Intergenic
1134088111 16:11372435-11372457 TCTGCAGAGCTGGTACTTGCTGG + Exonic
1134434770 16:14246466-14246488 TCTTCAGTTCTGATACCTGGAGG - Exonic
1138096657 16:54217205-54217227 TCAGCATTCCTCACACTTGGTGG - Intergenic
1144669071 17:17121624-17121646 ACTGCACTACTGAGACTTGGAGG + Intronic
1146704571 17:34991594-34991616 TCTTCAGTCCTGGGTCTTGGGGG + Intronic
1150581293 17:66476324-66476346 TCTGCAAGCCTGGTGCTTGGGGG + Intronic
1152405817 17:80097193-80097215 CCTGCAGCCCGGCTACTTGGCGG - Intronic
1153934440 18:9908617-9908639 TCTGGAGTCCTGATGCTTGTTGG + Intergenic
1155239471 18:23851708-23851730 GCTCCAGTCCTGATCCTTGAGGG + Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156127530 18:33924976-33924998 TCTGCATAAATGATACTTGGGGG - Intronic
1157670066 18:49520733-49520755 CCTGTAGTCCTGCTACTAGGAGG - Intergenic
1158810112 18:61022044-61022066 TCAGCAGTCCTGAAACTTTTTGG - Intergenic
1159566257 18:70054221-70054243 TCTGCAGTCATGTTTATTGGTGG - Exonic
1160411807 18:78680097-78680119 TCAGCAGTGCTGAGACATGGGGG + Intergenic
1160466586 18:79082859-79082881 TCTCCAGTCAGGATACATGGCGG + Intronic
1161709477 19:5839800-5839822 AGGGCAGTCGTGATACTTGGAGG - Intergenic
1161746471 19:6063314-6063336 TCTGCAGACCTTAGACTTGCAGG - Intronic
1163600663 19:18247415-18247437 CCTGTAGTCCAGCTACTTGGAGG - Intronic
1163734021 19:18967614-18967636 CCTGCAATCCTGATGCTTTGGGG + Intergenic
1164862137 19:31570217-31570239 CCTGTAGTCCAGCTACTTGGCGG + Intergenic
1165668532 19:37655242-37655264 TCTGCAGCCCTGAGGCCTGGAGG - Exonic
1166596107 19:44051757-44051779 TCTGCAGTCCAGACACCTTGCGG + Intronic
1166917579 19:46206100-46206122 TCAGCAATCCTGAGACTTTGTGG - Intergenic
1166919867 19:46221923-46221945 TCAGCAATCCTGAGACTTTGCGG - Intergenic
1168667184 19:58212950-58212972 TCCACAGTCCTGACACTTGTAGG - Exonic
925716018 2:6785207-6785229 TCTGAAGGCCTGAGAATTGGGGG + Intergenic
926000298 2:9325820-9325842 TCTGCAGAGCTGGCACTTGGAGG + Intronic
928556995 2:32437146-32437168 TCTGCAATCCTAACACTTTGGGG - Intronic
929947642 2:46382551-46382573 GCTGTAGTCCTGGTACTGGGTGG - Exonic
932886100 2:75550455-75550477 TCTGCTGTGTAGATACTTGGAGG - Intronic
934503621 2:94876261-94876283 TTTCCATTCCTGATACTTGATGG - Intronic
938684726 2:133727232-133727254 TGTGCAGTCCTGATGATTTGTGG - Intergenic
939214319 2:139216738-139216760 TCTGCAATCCTCTTAATTGGAGG + Intergenic
946221022 2:218227076-218227098 TCTGAAGTGCTGTTACCTGGAGG + Intronic
946645323 2:221827064-221827086 CCTGTAGTCCAGATACTTGGGGG + Intergenic
947712704 2:232325234-232325256 TCTGCAGTCTTGATGCTCGCCGG + Intronic
947732394 2:232438678-232438700 TCTGCAGTCTTGATGCTCGCCGG + Intergenic
947868901 2:233421537-233421559 TCTGTGGTCCTGATGCTTGCAGG + Intronic
1170940613 20:20845302-20845324 TCTGCAGTGCTGACCCTTGCTGG - Intergenic
1171266504 20:23775977-23775999 TCTGTAGTACTGATCTTTGGTGG + Intergenic
1172746361 20:37212328-37212350 CCTGTAGTCCAGCTACTTGGAGG + Intronic
1173107017 20:40146667-40146689 TCTCCATTCCTGATTCATGGTGG - Intergenic
1173497475 20:43529985-43530007 TCAGCAGTCCTGAGCCTTGGTGG + Intronic
1176237437 20:64060221-64060243 TCTGCAGTCCTGATACTTGGAGG + Intronic
1182438321 22:30345739-30345761 TCTGCACTCCTGAACCATGGTGG - Intronic
1183251135 22:36731320-36731342 CCTGTAGTCCTACTACTTGGAGG - Intergenic
1183498390 22:38163441-38163463 TCTGCGTTCCTGATGCCTGGTGG - Intronic
1184495864 22:44841012-44841034 TCTGCAGGCCTCATACATGCAGG + Intronic
950447584 3:13047247-13047269 ACTGCAGTCCTGGTCTTTGGGGG + Intronic
952476960 3:33719999-33720021 TCTGGAGGCCTGAGAATTGGAGG - Intergenic
953560637 3:43989006-43989028 TCTGCACTTCTGGTACCTGGAGG + Intergenic
954631333 3:52049339-52049361 CATGCAGTCCTGACACCTGGTGG + Exonic
955827645 3:62965231-62965253 TCTGCAGTTCTGAAATTAGGTGG + Intergenic
957003725 3:74918334-74918356 TCTGCACTGATGATACTTGTTGG - Intergenic
957236680 3:77602140-77602162 TCTTCAGTCCTGATAGTTTTGGG + Intronic
957639069 3:82826931-82826953 TCTGCAGGCCTGAGAACTGGGGG + Intergenic
959490985 3:106988311-106988333 CTTGCAGTCCTGGTAGTTGGTGG - Intergenic
959999483 3:112715606-112715628 TCTGAAGCCCTGATACTTAGAGG - Intergenic
961989781 3:131176091-131176113 TCTTCAGTCTTTATAGTTGGGGG + Intronic
962533654 3:136307139-136307161 TCTGCAGTCTTAATACATGAAGG - Intronic
963431902 3:145217390-145217412 TCTGCCTTCCTGAAGCTTGGAGG - Intergenic
964777640 3:160295483-160295505 CCTGTAGCCCAGATACTTGGAGG + Intronic
970930708 4:21508446-21508468 TGTGCAATCCTCATACTTGGTGG - Intronic
982305025 4:153921935-153921957 TCTTCAGTCAAGATGCTTGGAGG + Intergenic
984985931 4:185329519-185329541 TCTGCTGTCCTGATCCTCAGAGG - Intronic
985962743 5:3315127-3315149 TCTGCATTCCTGAGGCTTCGTGG - Intergenic
988258908 5:28857941-28857963 TCTGCAGTAATTACACTTGGTGG - Intergenic
991664439 5:68984261-68984283 TCTGCAGTCCAGCTATTAGGAGG + Intergenic
992141219 5:73798961-73798983 CCTGCAGTCCTGCTACTTGGGGG + Intronic
992545079 5:77806063-77806085 CCTGTAGTCCAGCTACTTGGGGG - Intronic
994434645 5:99711529-99711551 TATGCAGTCCAGACACTTGATGG - Intergenic
995493558 5:112718493-112718515 ACTGCAGTCCTCACCCTTGGTGG + Intronic
996479250 5:123955274-123955296 ACAGCAGTCCTGAGACTTGGTGG + Intergenic
996633805 5:125666821-125666843 TCTGCTGTACTGATCCTCGGAGG - Intergenic
999025717 5:148229962-148229984 TCAGTAGTCATTATACTTGGTGG - Intergenic
1002038700 5:176494424-176494446 TCAGCAGTCCTGAGAGATGGGGG + Intronic
1003364050 6:5456090-5456112 TCTGTAGTCCAGCTACTTGGAGG + Intronic
1003737667 6:8895236-8895258 TCTGCTTTTCTGATACGTGGAGG + Intergenic
1012297745 6:97546095-97546117 TGTGCAGTCATGATGCTTGCAGG + Intergenic
1014893140 6:126867517-126867539 TGTGAAGTCCTGATATTTAGAGG - Intergenic
1017038602 6:150289391-150289413 TCTCCAGTCCTGCTTCTCGGTGG - Intergenic
1017508806 6:155093729-155093751 TCTGCCTTCCTGGTGCTTGGAGG - Intronic
1019817889 7:3214547-3214569 CCTGCAGTCCTGGTACTTAGGGG + Intergenic
1020041729 7:5008691-5008713 CCTACAGTCCAGATACTTGTAGG - Intronic
1024217133 7:47257024-47257046 TCTGCTGCCCTCATACCTGGAGG - Intergenic
1024217145 7:47257074-47257096 TCTGCTGCCCTCATACCTGGAGG - Intergenic
1027231773 7:76276813-76276835 TCTGCCATCTTGGTACTTGGTGG + Intronic
1030105606 7:105984347-105984369 CCTGCTGTCCTGAGTCTTGGCGG + Intronic
1032834023 7:135656913-135656935 CCTGTAGTCCAGCTACTTGGGGG - Intergenic
1035303568 7:157915562-157915584 CCTGCAGTCATGGTTCTTGGGGG + Intronic
1035607230 8:937939-937961 TCTGCAGTGCTGATCCAAGGTGG + Intergenic
1037492580 8:19410148-19410170 TGAGCAGTCCTGATGCTTGCAGG - Intronic
1038165230 8:25079558-25079580 CCTATAGTCCAGATACTTGGAGG - Intergenic
1041342473 8:56860074-56860096 TTTGCAGTCCTGATAGGTTGAGG - Intergenic
1047334007 8:123919140-123919162 TCTCCACTGCTGAGACTTGGGGG - Intronic
1047803566 8:128335146-128335168 CCTGCAATTCTGATCCTTGGAGG + Intergenic
1048267323 8:132999034-132999056 GCTGCAGTCCTGGTTCTTGGAGG - Intronic
1050451777 9:5789420-5789442 TCTGTAATCCTGATAGTTGAAGG - Intronic
1050940498 9:11451776-11451798 TGTGCAGTCTTGAGACTTGGTGG + Intergenic
1052763539 9:32617383-32617405 TCTCCATTCCTCAAACTTGGAGG - Intergenic
1052951775 9:34219484-34219506 TTTCCAGTCCTATTACTTGGAGG + Intronic
1053612377 9:39728204-39728226 TCTGCAGTTATGTAACTTGGAGG + Intergenic
1053870413 9:42486205-42486227 TCTGCAGTTATGTAACTTGGAGG + Intergenic
1054085875 9:60742945-60742967 TCTGCAGTTATGTAACTTGGAGG - Intergenic
1054241139 9:62614188-62614210 TCTGCAGTTATGTAACTTGGAGG - Intergenic
1054555269 9:66648712-66648734 TCTGCAGTTATGTAACTTGGAGG - Intergenic
1055391982 9:75832870-75832892 TATGCAGTCTTAATAGTTGGAGG + Intergenic
1056821842 9:89847984-89848006 CCTGTAGTCCCAATACTTGGGGG + Intergenic
1057385868 9:94605590-94605612 TCTGCAATCCTAATTCTTGCTGG - Intronic
1059572796 9:115458581-115458603 TCTGGAGTTCTGAGAATTGGAGG - Intergenic
1061066582 9:128281814-128281836 TTTGCAGTCCTAACACTGGGAGG + Intronic
1186467673 X:9796765-9796787 CCTGTAGTCCTAATACTTGGGGG - Intronic
1188251695 X:27903786-27903808 TCTGCAGTAATGAGACATGGAGG + Intergenic
1189613601 X:42763229-42763251 TCTGCAGTCCTGGTCCTCGGAGG + Intergenic
1193764627 X:85511922-85511944 TCTGAAGTCCTGAAAGTTGTCGG - Intergenic
1198170377 X:134099445-134099467 TCTGAAGGCCTGAAAATTGGTGG - Intergenic
1201979527 Y:19892055-19892077 TCTGCAGTCCTGATCACTGTGGG + Intergenic