ID: 1176239190

View in Genome Browser
Species Human (GRCh38)
Location 20:64068053-64068075
Sequence CCGCTCCCTGGCTTTGGCAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176239190_1176239207 29 Left 1176239190 20:64068053-64068075 CCGATGCCAAAGCCAGGGAGCGG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1176239207 20:64068105-64068127 GAGGGATGCCTCAGAGGCCCCGG 0: 1
1: 1
2: 3
3: 27
4: 334
1176239190_1176239205 23 Left 1176239190 20:64068053-64068075 CCGATGCCAAAGCCAGGGAGCGG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1176239205 20:64068099-64068121 GTCCTCGAGGGATGCCTCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 78
1176239190_1176239201 11 Left 1176239190 20:64068053-64068075 CCGATGCCAAAGCCAGGGAGCGG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1176239201 20:64068087-64068109 GCCTCTGCCCACGTCCTCGAGGG 0: 1
1: 0
2: 1
3: 13
4: 176
1176239190_1176239200 10 Left 1176239190 20:64068053-64068075 CCGATGCCAAAGCCAGGGAGCGG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1176239200 20:64068086-64068108 TGCCTCTGCCCACGTCCTCGAGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176239190 Original CRISPR CCGCTCCCTGGCTTTGGCAT CGG (reversed) Exonic
900310108 1:2029425-2029447 CTGCTCCCTGGGGTGGGCATGGG + Intronic
903828427 1:26161080-26161102 CTGCTCCCTGGATGTGGCACCGG + Intronic
904773587 1:32894023-32894045 CCGCTTACTTGCTTTGGCCTGGG - Exonic
905975802 1:42172789-42172811 TCGCTCGCTGGCTTTGACCTTGG + Intergenic
910180879 1:84481376-84481398 CCTCTCCCTGACTTTGGGAATGG + Intronic
910441364 1:87255805-87255827 ACACTCCCTGACTTTGGAATTGG + Intergenic
913121784 1:115749134-115749156 CCTCTCTCTACCTTTGGCATAGG + Intronic
917668811 1:177251951-177251973 CAGCCCCCTTGCTTTGGGATAGG - Intronic
920385542 1:205568610-205568632 CCGCACCCGGGCTGTGGCAGTGG - Intergenic
1064015590 10:11769393-11769415 CAACTCCCTGGCTTTTGCCTTGG - Intergenic
1064492550 10:15874995-15875017 TCGCTGCCAGGCTTTGGTATCGG + Intergenic
1069058414 10:63868291-63868313 CTGCTCCCTGGCTGTGGCTGTGG + Intergenic
1071551709 10:86571081-86571103 ACGCTTCCTGGCTTTGGCTTTGG + Intergenic
1073587232 10:104722453-104722475 TCTCACCCTGGCTTTGGTATCGG + Intronic
1075482824 10:122797048-122797070 CCCCTGCCAGGCTTTGACATTGG - Intergenic
1076479493 10:130775560-130775582 CTGCTCCCTGGCATTGACCTTGG + Intergenic
1076689294 10:132213083-132213105 TCCCTTCCTGGCTCTGGCATGGG + Intronic
1076846577 10:133072208-133072230 CCGCTTCCAGGCTATGGCCTGGG - Intronic
1077238877 11:1500302-1500324 CCTCTCCCTGGCTGTGGCTGTGG + Intronic
1077636104 11:3841745-3841767 TCGCTCCCTGGCTTTGCGCTCGG + Intergenic
1078901531 11:15647137-15647159 CCACTCCCTAGCTATGCCATGGG + Intergenic
1081645540 11:44787729-44787751 CAGATCCCTGGCTTTTGCCTGGG - Intronic
1081807955 11:45900359-45900381 CCGGGCCCTGGCTCTGGCCTTGG - Exonic
1084041258 11:66543950-66543972 GCGGCACCTGGCTTTGGCATTGG + Exonic
1084276152 11:68051954-68051976 CCCCGCCCTGGCTTTGACATGGG + Intergenic
1084949207 11:72655327-72655349 CCTCACCCTGGCTGTGGCACTGG - Intronic
1087066862 11:94035671-94035693 CCTCTGCCTGCCTTTGTCATAGG - Intronic
1087599016 11:100289043-100289065 CCTCTCCCTGGCTTAGTCTTTGG - Intronic
1087839833 11:102909345-102909367 CCGCTTACTGGATTTGACATTGG + Intergenic
1088841282 11:113629648-113629670 CCGCCTCCTGCCTTGGGCATCGG - Intergenic
1090765345 11:129871542-129871564 CCCATCCATGGCTTTGGCTTGGG - Intronic
1096021593 12:48329830-48329852 CCTCGCCCTGGCATTGGCCTTGG - Exonic
1097100942 12:56588910-56588932 CCCCTCCTTGGCTATGGCACAGG + Exonic
1100326966 12:93549316-93549338 CTGCTGCCTGGCTCTGGCCTGGG + Intergenic
1104717909 12:131028819-131028841 CCGGTCTCAGGCCTTGGCATAGG - Intronic
1112366802 13:98762171-98762193 CCGCCCCCTGGACTTGGCCTTGG - Intergenic
1120941502 14:89954628-89954650 CCGCGACCTGGCTCTGGCCTCGG + Exonic
1121253365 14:92514952-92514974 CCGCTCCCTGGCTTGGCAGTGGG + Intronic
1123473675 15:20572142-20572164 CTGCCCCCTGGCTTTGTTATAGG - Intergenic
1123644334 15:22428211-22428233 CTGCCCCCTGGCTTTGTTATAGG + Intergenic
1123733975 15:23167153-23167175 CTGCCCCCTGGCTTTGTTATAGG - Intergenic
1124284478 15:28388464-28388486 CTGCCCCCTGGCTTTGTTATAGG - Exonic
1124298219 15:28523150-28523172 CTGCCCCCTGGCTTTGTTATAGG + Exonic
1125330578 15:38578181-38578203 GTGCTCTCTGGCTTTGGAATTGG + Intergenic
1125720924 15:41844815-41844837 CAGCCCTCTGGCTTTGGCTTTGG + Intronic
1128114218 15:65095206-65095228 CTGCTCCCTGTCTATGGCCTTGG + Intronic
1132944175 16:2523405-2523427 AGGCTTCCTGGATTTGGCATTGG + Intronic
1134573229 16:15309515-15309537 CCTGTCCCCGGCTTTGGCTTAGG + Intergenic
1134729155 16:16446443-16446465 CCTGTCCCCGGCTTTGGCTTAGG - Intergenic
1134938279 16:18265421-18265443 CCTGTCCCCGGCTTTGGCTTAGG + Intergenic
1135553492 16:23416436-23416458 GAGCTCCCTGGCATTGCCATCGG - Intronic
1141469931 16:84231260-84231282 CCACTCCCTGGCTCTGCCCTTGG - Intronic
1141646876 16:85372155-85372177 CCACTCCCTGGCTTGGGCTGTGG + Intergenic
1144788869 17:17846586-17846608 CTGCTCCCTGGCATAGGCCTTGG - Intronic
1145049528 17:19648643-19648665 CCTCTCCCCGGCTCTGGCAGCGG - Intronic
1145065300 17:19757727-19757749 CAGGTCCCTGGCCATGGCATCGG + Intergenic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1146561481 17:33873923-33873945 CAGCTGCCTGGCTATGACATAGG - Intronic
1148180609 17:45602118-45602140 CCGGGCCCTGGCTCTGGCCTTGG + Intergenic
1148268293 17:46243797-46243819 CCGGGCCCTGGCTCTGGCCTTGG - Intergenic
1148617764 17:49013694-49013716 CGGCTGCCTGGCTTCGCCATGGG + Intronic
1150499273 17:65634658-65634680 TCCCTCCCTGGCTTTGGAAGTGG + Intronic
1151859347 17:76748167-76748189 CCACTGCCTGGCTTTGGCAAAGG - Intronic
1152066955 17:78117376-78117398 CCGCTCCCGGGCTGTGGCCCTGG - Intronic
1152498886 17:80695033-80695055 GGGCTGCCTGGCTTTGACATGGG + Intronic
1153794590 18:8610110-8610132 CCTCTGCCAGGCTTTGGGATTGG - Intronic
1154414920 18:14171466-14171488 CCCTGCCCTGGCTTTGGCCTTGG - Intergenic
1156091845 18:33480904-33480926 CTGCTCCCTGGTTTTGTCTTTGG + Intergenic
1163271299 19:16255900-16255922 CCACTCCCTGGCTTGGGTTTGGG - Intergenic
1166121428 19:40689781-40689803 CCACCCCCTGGCTTGGTCATGGG - Intronic
925058323 2:872136-872158 ACGCCCCTTGGCTTTGGCATGGG + Intergenic
926822408 2:16867024-16867046 CAGCTCCCTGGCATTAGTATTGG + Intergenic
929861863 2:45684963-45684985 ACCCGCCCTGGCTTTGGCACTGG + Intronic
929883812 2:45860865-45860887 GGGCTCAGTGGCTTTGGCATGGG - Intronic
930211123 2:48638246-48638268 TCTCTCCCAGGCTTTGGTATCGG - Intronic
934323368 2:91985646-91985668 CCTGTCCCTGGCTTGAGCATTGG + Intergenic
937356648 2:121202070-121202092 CTGCTCCCTTGCTTTGGGACTGG - Intergenic
937432181 2:121848343-121848365 CACCTGCCTGGCTGTGGCATGGG + Intergenic
938552927 2:132397312-132397334 CCAGTCCCTGGCTGTGGCCTTGG + Intergenic
940865238 2:158811177-158811199 CATCTCACTGGCTTTGGCAGTGG - Intronic
945375815 2:209078603-209078625 CCGCTTACTGGATTTGACATTGG - Intergenic
1170008740 20:11697495-11697517 CAGCTGCCTGGTATTGGCATTGG + Intergenic
1170850839 20:20003216-20003238 ACGGTCCCTGGTTTTGTCATTGG + Intergenic
1173227220 20:41168980-41169002 CCTCACCCTGGCTTAGGCATGGG + Intronic
1173643595 20:44620012-44620034 CCTCTCCCTGCCCTTGGCTTTGG + Intronic
1175372859 20:58504225-58504247 CATCTCCCTGGCTTTGGTAAAGG + Intronic
1175980366 20:62735671-62735693 CCGCTCCCTGGCTTGGGGGGTGG + Intronic
1176239190 20:64068053-64068075 CCGCTCCCTGGCTTTGGCATCGG - Exonic
1179584358 21:42365388-42365410 CCGCTCCCTGCCATGGGCTTGGG + Intronic
1181040143 22:20188220-20188242 CTCCACCCTGGGTTTGGCATGGG + Intergenic
1181054658 22:20255071-20255093 CTGTTCCCTGGCTTTGCCAGTGG - Intronic
1181264874 22:21625135-21625157 CTGCTTCCTGGATATGGCATGGG + Intergenic
1182567633 22:31212146-31212168 CCGCCCCCTGGCTCTGGCTCGGG - Intergenic
1182697420 22:32206381-32206403 CCGCTCCCTGCCGTAGGCAGTGG - Intergenic
1183294305 22:37020596-37020618 CCCCTCCCTAGCTTTTGCAGAGG + Intronic
1183661741 22:39225383-39225405 CAGCTCCCTGCCCCTGGCATCGG - Intronic
1184920368 22:47601253-47601275 CCCCTCCCTGGCTCTGGCTGAGG + Intergenic
1185044726 22:48523242-48523264 GTGCTCCCTGGCTTTGCCGTGGG + Intronic
1185171499 22:49297251-49297273 TCCCTCCCTGGCCCTGGCATCGG + Intergenic
954036882 3:47855603-47855625 CAGCTCAGTGGCTGTGGCATGGG - Intronic
961213196 3:125141386-125141408 CCGCTGCCTGCCTTTGGCTAAGG - Intronic
962989424 3:140564981-140565003 CAGCACACTGGCTTTGGAATTGG - Intronic
967994112 3:195153947-195153969 CCGCTCCCCGGCTCTGGCATTGG - Intronic
968509732 4:990286-990308 CTGCTCGATGGCTTTGCCATGGG - Exonic
968607669 4:1543122-1543144 CCACTCCCTGGCTTGTGCACTGG - Intergenic
970210545 4:13705600-13705622 CCGCCCTCTGGCTTTGGAACCGG + Intergenic
970471499 4:16384011-16384033 CCTCTCCTTGCCTTTGGCAGTGG + Intergenic
971346143 4:25813541-25813563 CGGCTCCCAGGGTTTGGGATGGG + Intronic
972648473 4:40992731-40992753 CAGCTCCCTGGCCTGGACATCGG - Intronic
978385008 4:108169380-108169402 TCCCTCCCTGGCTCTGGCAGAGG + Intergenic
979749033 4:124253276-124253298 CCTCTTCCTGGCCTTGGCTTGGG + Intergenic
989828098 5:45883705-45883727 TCTCTGCCTGGCTTTGGTATCGG + Intergenic
992741126 5:79774608-79774630 CTGCTCCCTGGCTCTGGCTGAGG + Intronic
997190740 5:131932568-131932590 CCACTCTCTGGCTTTGGGATTGG - Intronic
997368727 5:133342381-133342403 CCACTTCCTTGCTTTGGCAGAGG - Intronic
1000455026 5:161438050-161438072 CCACTCCCTGGCTTCTGCCTTGG - Intronic
1001344886 5:170885357-170885379 CAGTTCCCTAGGTTTGGCATAGG + Intronic
1002618644 5:180470734-180470756 GCTCTCCCTGGCTTTGGCACGGG - Intergenic
1002712359 5:181203029-181203051 CTGCTCCCTGGCTCTGGCAGAGG - Intronic
1006713015 6:36092155-36092177 CCATCCCCTGGCTTTGGCTTGGG + Intronic
1006829071 6:36958069-36958091 CCGCTGCCTGGCATGGGGATGGG - Intronic
1006923469 6:37641026-37641048 CCTCTGCCTGGCTTTGCCATGGG + Intronic
1007975834 6:46100405-46100427 CAGCTCCCTGACTTTGCCCTGGG + Intergenic
1009324050 6:62328219-62328241 CCTCTCAGTGGCCTTGGCATTGG - Intergenic
1010734445 6:79427914-79427936 CAGCTCCCTGGCTTCTGCTTTGG - Intergenic
1018937939 6:168285782-168285804 CCGCTGCCTGGGACTGGCATGGG + Intergenic
1019878832 7:3840824-3840846 CCGATCCCTAGGTCTGGCATGGG - Intronic
1021129761 7:16897434-16897456 CCTCTGCCAGGTTTTGGCATCGG + Intergenic
1022367985 7:29743984-29744006 CCGCCCTCTGGCCTTGGCCTTGG + Intergenic
1027159101 7:75789556-75789578 CCTTTCCCTGCCTTTGGCAATGG + Intronic
1029492875 7:100881869-100881891 CCGCTCCCTGGCTTCAGCCATGG - Intronic
1029515361 7:101020133-101020155 ATGGTCCCTGGCCTTGGCATCGG - Exonic
1031809386 7:126346954-126346976 CCTCTCCATGGCTCAGGCATCGG - Intergenic
1034899696 7:154899939-154899961 GAGCTCCCTGGCTTTGACTTTGG + Intergenic
1036466608 8:9003308-9003330 CAGCTCCCTGGCTTTATCCTCGG + Intronic
1037739094 8:21590995-21591017 CAGCTCCCTTGCTGTAGCATGGG - Intergenic
1038828358 8:31032443-31032465 CCTCTCCCTGTCTGTGGCAGCGG - Exonic
1038845711 8:31227883-31227905 GCCCTTTCTGGCTTTGGCATTGG + Intergenic
1039261258 8:35774423-35774445 CCAGTCCTTGCCTTTGGCATTGG - Exonic
1042653410 8:71068426-71068448 CTGCTTCCTGGCTTGGGAATTGG + Intergenic
1043627076 8:82274339-82274361 CCACTCCCTGGCTACTGCATAGG - Intergenic
1044611540 8:94096914-94096936 CCTCTCCCTGACATTGCCATGGG + Intergenic
1046704589 8:117435823-117435845 TCTCTGCCTGGCTTTGGTATCGG - Intergenic
1048898346 8:139015116-139015138 CTCCTCCCTGGCTGTGGCATGGG + Intergenic
1053280690 9:36818316-36818338 ACGCTCTCTGGCCTTGGCCTTGG + Intergenic
1058096093 9:100862109-100862131 CAGCTGCCTTGCTTTGGGATGGG - Intergenic
1058354871 9:104072738-104072760 CATCTCTCTGTCTTTGGCATTGG - Intergenic
1060895013 9:127211801-127211823 CCGCTCCCTGGGGCTGGCGTGGG - Intronic
1061063827 9:128265320-128265342 CCGTTACCTGGCTGTGGCCTTGG - Intronic
1186014604 X:5176937-5176959 CCGCTCCAGTGCTTTGGCATGGG + Intergenic
1188019711 X:25144002-25144024 TCTATCCCTGGCTCTGGCATGGG - Intergenic
1190318343 X:49165239-49165261 CCGCTCCACGGCCTGGGCATGGG - Exonic
1192210600 X:69125429-69125451 CCCCTCCCAGGGTTTAGCATGGG - Intergenic
1192828210 X:74721356-74721378 CTGCTCCCTATCTTTGTCATGGG - Intergenic
1193164350 X:78264189-78264211 CATCTCCCTGGCTCTGGCAGGGG + Intergenic
1197782466 X:130171802-130171824 CCTCTCCCTGGCTTTTGTGTTGG + Exonic
1201861963 Y:18608340-18608362 CACCTCCCTGGCTTGGGAATTGG - Intergenic
1201871360 Y:18712040-18712062 CACCTCCCTGGCTTGGGAATTGG + Intergenic
1202137437 Y:21681602-21681624 CGGCTCACTGGCATTTGCATTGG - Intergenic
1202249817 Y:22858466-22858488 TCTCTGCCTGGCTTTGGTATCGG - Intergenic
1202402804 Y:24492214-24492236 TCTCTGCCTGGCTTTGGTATCGG - Intergenic
1202467978 Y:25177869-25177891 TCTCTGCCTGGCTTTGGTATCGG + Intergenic