ID: 1176241193

View in Genome Browser
Species Human (GRCh38)
Location 20:64076710-64076732
Sequence CAGGGCTACCCATGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 257}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176241193_1176241208 19 Left 1176241193 20:64076710-64076732 CCACCTTCCCATGGGTAGCCCTG 0: 1
1: 0
2: 0
3: 28
4: 257
Right 1176241208 20:64076752-64076774 TCTGGCCTCCCGGGTGTTCAGGG 0: 1
1: 1
2: 0
3: 9
4: 143
1176241193_1176241207 18 Left 1176241193 20:64076710-64076732 CCACCTTCCCATGGGTAGCCCTG 0: 1
1: 0
2: 0
3: 28
4: 257
Right 1176241207 20:64076751-64076773 TTCTGGCCTCCCGGGTGTTCAGG 0: 1
1: 1
2: 1
3: 10
4: 122
1176241193_1176241204 10 Left 1176241193 20:64076710-64076732 CCACCTTCCCATGGGTAGCCCTG 0: 1
1: 0
2: 0
3: 28
4: 257
Right 1176241204 20:64076743-64076765 CATGACCCTTCTGGCCTCCCGGG 0: 2
1: 0
2: 0
3: 20
4: 228
1176241193_1176241203 9 Left 1176241193 20:64076710-64076732 CCACCTTCCCATGGGTAGCCCTG 0: 1
1: 0
2: 0
3: 28
4: 257
Right 1176241203 20:64076742-64076764 ACATGACCCTTCTGGCCTCCCGG 0: 1
1: 1
2: 2
3: 14
4: 164
1176241193_1176241200 1 Left 1176241193 20:64076710-64076732 CCACCTTCCCATGGGTAGCCCTG 0: 1
1: 0
2: 0
3: 28
4: 257
Right 1176241200 20:64076734-64076756 TCCCAGGCACATGACCCTTCTGG 0: 2
1: 0
2: 1
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176241193 Original CRISPR CAGGGCTACCCATGGGAAGG TGG (reversed) Intronic
900581895 1:3413513-3413535 CAGGGCTAGGCTTGGGGAGGGGG + Intronic
902492090 1:16790241-16790263 AAGGCCTACCTCTGGGAAGGGGG + Intronic
902882506 1:19381988-19382010 AAGGGCCACCCAGGGGAAGGAGG - Intronic
903179560 1:21598347-21598369 CAGGGCTACCTTGGGGTAGGAGG - Intronic
904444161 1:30554211-30554233 CAGGGCATCACATGGCAAGGAGG + Intergenic
904625418 1:31799513-31799535 CAGGGGTGCCCAGGGGAAAGGGG + Intronic
905256898 1:36690673-36690695 CAGGGGTGCCCTTGGGGAGGAGG - Intergenic
905517071 1:38569791-38569813 CAGGGCTGCCCAGGGAAAGGAGG - Intergenic
905914419 1:41675047-41675069 CAGGGACACCCATGGGAGGATGG - Intronic
907342666 1:53747991-53748013 CAGGGAGACCAATGGGAAGCTGG - Intergenic
907584930 1:55608529-55608551 CAGGGCTGCACATAGGAGGGGGG + Intergenic
907804123 1:57801622-57801644 CTGGGCTCCCCATGCTAAGGAGG - Intronic
907886009 1:58592980-58593002 CAGGGATAGGTATGGGAAGGGGG - Intergenic
908484686 1:64578931-64578953 CAGGTCTACCCTTTGGCAGGTGG - Intronic
910226652 1:84942851-84942873 CAGGGCATCACATGGTAAGGGGG - Intronic
910990336 1:93049402-93049424 CAGGGCCAGCCTTGGGAAAGAGG - Intergenic
912427547 1:109608084-109608106 AAGGGCAAACCAAGGGAAGGTGG - Exonic
913958940 1:143324514-143324536 CAGGGCTAGCCATGGAGCGGGGG - Intergenic
914053257 1:144149894-144149916 CAGGGCTAGCCATGGAGCGGGGG - Intergenic
914125940 1:144816647-144816669 CAGGGCTAGCCATGGAGCGGGGG + Intergenic
914716230 1:150257224-150257246 CAGGCCTCACCGTGGGAAGGGGG + Exonic
914827147 1:151144676-151144698 CAGGGCTAGCCTTGGCAAAGGGG + Intronic
914922760 1:151858862-151858884 CAGGGCCACCCAAGACAAGGAGG - Intergenic
917724298 1:177814282-177814304 CAGGGCTGCCCAGGGGGAGGAGG + Intergenic
919815579 1:201436496-201436518 CAAGGACACACATGGGAAGGAGG + Intergenic
920747172 1:208639874-208639896 CAGGGCTATCCAGGCAAAGGAGG - Intergenic
920752808 1:208697085-208697107 CAGGGCATCACATGGCAAGGGGG + Intergenic
921257356 1:213354654-213354676 CAGGACAACACATGGCAAGGGGG + Intergenic
921314155 1:213874897-213874919 AAGGGCTGCCCCGGGGAAGGGGG - Intergenic
922611751 1:226935492-226935514 CAGGGCAACCCATAAGAAAGAGG + Intronic
922786360 1:228284313-228284335 CAGGGCATCCCATGGGGAGGGGG + Intronic
923790577 1:237107859-237107881 CAGGGGAACCCCAGGGAAGGAGG - Intronic
923945371 1:238880759-238880781 CAGAGCTACCCCTGGGAAGAAGG + Intergenic
1065973373 10:30822493-30822515 CAGGGCTTCTCAGGGGCAGGAGG + Intronic
1067213751 10:44283114-44283136 CAGGGCTCCCCACAGGACGGCGG - Intergenic
1069788254 10:71003583-71003605 CAGGGGTACCCAGGTGAAGTGGG + Intergenic
1072692669 10:97582249-97582271 CTGTGGTACCCCTGGGAAGGCGG - Intronic
1073615205 10:104988003-104988025 CAGTGCCACACATGGGAAGGTGG - Intronic
1074297397 10:112203192-112203214 TAGGGCTACCCCAGAGAAGGGGG - Intronic
1074503507 10:114045594-114045616 CACGGCTTCCCAGGGGAACGAGG + Exonic
1079211357 11:18463319-18463341 CAGGGCATCACATGGCAAGGAGG - Intronic
1083951505 11:65959133-65959155 CAGGGCTGCCGAGGGCAAGGTGG - Intronic
1084857791 11:72000021-72000043 TGGGGCTACGCATGGGCAGGCGG + Intronic
1084973890 11:72785895-72785917 CAGGGTTACCCCTGAGGAGGGGG - Intronic
1085003305 11:73061223-73061245 CATGGCTTCCCCTGGGTAGGGGG - Intronic
1085219174 11:74859107-74859129 CAGGGGCACAGATGGGAAGGTGG - Intronic
1086527948 11:87751100-87751122 TTGGGCTACTCATTGGAAGGTGG + Intergenic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1088607119 11:111542214-111542236 CAGGGATACCCCCGGGAAGGGGG - Intronic
1089533972 11:119149561-119149583 CAGGGCGGACCAGGGGAAGGCGG - Intronic
1089557400 11:119321809-119321831 CAGGGCTACCCCTGGGATGCTGG - Intergenic
1090118350 11:123998725-123998747 ATGGGCTACAAATGGGAAGGGGG - Intergenic
1091191620 11:133700289-133700311 CAGGGCGTCACATGGGGAGGGGG - Intergenic
1091754326 12:3041696-3041718 CTGGCCTCCCCATGGGAGGGAGG - Intergenic
1092112493 12:5973655-5973677 CAGGGCCACCCCAGGGAATGGGG - Intronic
1093131249 12:15393929-15393951 CAGGGCATCACATGGCAAGGAGG + Intronic
1094240348 12:28215029-28215051 GAGGGCTACCCATATTAAGGAGG - Intronic
1094649278 12:32359425-32359447 CAGGGCATCACATGGCAAGGGGG + Intronic
1094826727 12:34275291-34275313 CAGGGACACCCTTGGGAGGGTGG + Intergenic
1096282204 12:50265920-50265942 GAAGGTTCCCCATGGGAAGGAGG - Intronic
1096728939 12:53590402-53590424 TAAGGCTGCCCATGGGAAGAAGG + Intronic
1098720963 12:73896856-73896878 CAGAGTTTCCCATGGAAAGGTGG + Intergenic
1099390505 12:82073238-82073260 CATAGCTCCCCATGGGATGGTGG + Intergenic
1100410609 12:94314357-94314379 CAGGGCTAGTGATTGGAAGGGGG - Intronic
1102257731 12:111425794-111425816 CAGCGGTGCCCAGGGGAAGGAGG - Intronic
1102298205 12:111753403-111753425 CAAGGCTACTCCTGGGAATGAGG - Intronic
1102957728 12:117070238-117070260 CAGGGCTGCTCAGGGGAAGATGG + Intronic
1103212938 12:119179577-119179599 CAGGGCTCCCCAGGGAAGGGTGG - Exonic
1103703127 12:122858284-122858306 CAGGGCTGGGGATGGGAAGGAGG - Intronic
1107929018 13:45291155-45291177 CAGGTCTAGCCAAGGAAAGGAGG + Intergenic
1108590065 13:51905448-51905470 CAGAGCAACCCAAGGGAAGCCGG + Intergenic
1112862500 13:103849923-103849945 CAGGGCGAACCATGGGAAGTGGG + Intergenic
1113721285 13:112559549-112559571 CAGTGCCACCCATCCGAAGGCGG + Intronic
1113946128 13:114044538-114044560 CAGGGCTGCCGGTGGGAGGGCGG - Intronic
1114637930 14:24198946-24198968 CAGGGCACACCATGGTAAGGGGG - Intronic
1118743897 14:68760341-68760363 CAGGGCTTAGTATGGGAAGGTGG + Intergenic
1120751188 14:88199730-88199752 CTGGGCTACTCATGGGAGTGGGG - Intronic
1121266699 14:92608000-92608022 CAGGGCTAGTGATGGGGAGGGGG + Intronic
1122982731 14:105198922-105198944 CAGGGGTACCCAGGAGAGGGGGG - Intergenic
1123032092 14:105456767-105456789 CAGGGGTACCCTGGGGAAGCTGG - Intronic
1124441251 15:29687906-29687928 CAGGGCCAGCCCTGGGAATGGGG + Intergenic
1124475805 15:30033483-30033505 GAGGGCTCTCCACGGGAAGGTGG - Intergenic
1125540263 15:40466148-40466170 TGGGGCTACCCATGGGCAAGTGG + Exonic
1127120857 15:55770932-55770954 CAGGGCTCCCCATAGGAGGCTGG + Intergenic
1127465182 15:59237368-59237390 GAAGGCTACCCAGCGGAAGGTGG - Intronic
1128311573 15:66634282-66634304 CAGGGCCACCCATTTGTAGGCGG + Intronic
1129470823 15:75752424-75752446 CAGGGGTCCCCTTGGGGAGGTGG + Intergenic
1131135754 15:89933805-89933827 CAGCGATACCCATGGTGAGGGGG - Intergenic
1131445732 15:92496802-92496824 CAGGGCTTCCCCGGGGACGGGGG - Intronic
1132110669 15:99099959-99099981 CAAGGCTACCTCTGGGAAGTAGG + Intronic
1132466295 16:78780-78802 CTGGCCTCCCCATGGGTAGGGGG - Intronic
1132543243 16:521245-521267 CAGGGCTGCACGTGGGAAGAGGG - Exonic
1133972640 16:10578763-10578785 CCTGGCTCCCCATGGGATGGAGG + Intronic
1137481924 16:48858994-48859016 CTGGGCTAAGCATGGGGAGGGGG + Intergenic
1138418339 16:56884233-56884255 CATGGCTACCCTGGGGGAGGAGG - Intronic
1138588148 16:57984990-57985012 CAGGACTGCCCTTGGGGAGGGGG + Intronic
1139334686 16:66223541-66223563 CAGAGCTTCCCAGGGGATGGAGG - Intergenic
1139372952 16:66479887-66479909 AAGAGCTCCCCATGGGGAGGGGG - Intronic
1140274541 16:73496933-73496955 CAGGGCTACCTGTTGGAAGGTGG - Intergenic
1140985583 16:80155466-80155488 CAGGCCTACCCATGTGCTGGTGG + Intergenic
1141134359 16:81456015-81456037 CAGGTCTGCCCATTGGAAAGGGG + Intronic
1142291945 16:89197239-89197261 CAGGGCCTCTCATGGGGAGGAGG - Intronic
1142500699 17:331400-331422 CAGGGCCACCCCTGTGAACGTGG - Intronic
1144859284 17:18290116-18290138 CAATGCTCCACATGGGAAGGAGG + Intronic
1147192732 17:38747314-38747336 CTGGGCGTCCCAGGGGAAGGGGG + Intronic
1148020059 17:44547721-44547743 AATGGATACCCCTGGGAAGGAGG - Intergenic
1148587031 17:48788307-48788329 CAGGGCTGTGAATGGGAAGGTGG - Intronic
1149556500 17:57577139-57577161 AAGGACTACCCCTGGGAGGGGGG + Intronic
1151694673 17:75708183-75708205 CAGGGCTGCCCAGAGGAAAGCGG - Intergenic
1152288561 17:79425909-79425931 CAGGCCTGCGCCTGGGAAGGTGG + Intronic
1152703723 17:81832617-81832639 GACGGCTACCCAGGGGCAGGAGG + Intronic
1153487029 18:5609455-5609477 CAGGGCCAGGCCTGGGAAGGAGG - Intronic
1154021727 18:10669096-10669118 CAGGGCCAGCCATGGGCATGTGG - Intronic
1154233324 18:12578690-12578712 CAGGGCTACACATCGGATAGTGG - Intronic
1154435327 18:14337692-14337714 GGGGGCTACCCATGGGAATTGGG + Intergenic
1155110783 18:22712427-22712449 CAGGGCTCCCCCTGGTAGGGAGG + Intergenic
1157315036 18:46579823-46579845 CAGGGCTAGGGATGGGAAGCAGG - Intronic
1157322795 18:46647156-46647178 CAGGGCTGCCCAGGAGAAGCTGG + Intronic
1157630047 18:49086290-49086312 CAGGGCATCACATGGGGAGGGGG + Intronic
1158040197 18:53084179-53084201 CAGGGCATCACATGGCAAGGAGG + Intronic
1160178243 18:76613139-76613161 CAGGGCTCCACATGGAGAGGGGG + Intergenic
1160347435 18:78145292-78145314 CAGGGCTGTCCAAAGGAAGGGGG + Intergenic
1160436538 18:78856512-78856534 CAGGTCAGCCCATGGGAGGGAGG - Intergenic
1162744041 19:12789424-12789446 CAGAGCTACTCTAGGGAAGGAGG + Intronic
1162748032 19:12810265-12810287 CATGGCCACCAAAGGGAAGGAGG + Intronic
1162927629 19:13938170-13938192 CAGGGCTGGCCATGGTAAGGTGG - Exonic
1162968158 19:14165462-14165484 GAGGTCAACCCAGGGGAAGGGGG + Intronic
1163491591 19:17620149-17620171 CAGGGATACCCATGGTAACTTGG + Intronic
1163621717 19:18364785-18364807 CAGGGCCACCTGTGGAAAGGCGG + Exonic
1164231894 19:23296762-23296784 CAGGGCTAGTCAGGGGATGGGGG - Intergenic
1164475162 19:28569984-28570006 CACGGCTGCACCTGGGAAGGCGG - Intergenic
1166630452 19:44401682-44401704 CAAGGCTACCCTGGTGAAGGTGG + Intergenic
1166939808 19:46355808-46355830 CAGGGCTCCAGGTGGGAAGGGGG + Intronic
1167005965 19:46776921-46776943 CAGGGGTACCCCTGGGAAAGAGG - Intronic
1168130069 19:54312264-54312286 AAGGGCCACCCATGGGCAGCTGG - Intronic
1168589139 19:57618251-57618273 CAGGGCAACCCATGGCAGTGTGG + Intronic
927372063 2:22367607-22367629 CAGGACTTCCCAAGGAAAGGTGG + Intergenic
927854244 2:26517947-26517969 TATGGACACCCATGGGAAGGCGG - Intronic
929234941 2:39595475-39595497 CATGGCTACCCACGGGAAAGAGG + Intergenic
929242682 2:39667678-39667700 CTGAGTTAGCCATGGGAAGGAGG - Intronic
930774552 2:55159304-55159326 CAGGGCCACACATGGGAAGCAGG - Intergenic
931231165 2:60376051-60376073 CAGAGCTCCCCAAGGGAAGAAGG - Intergenic
931980066 2:67685235-67685257 CAGGGCAAGCCTTGGGGAGGAGG - Intergenic
932334420 2:70921795-70921817 CAGTCCTACCCAGGTGAAGGGGG - Intronic
933063069 2:77762164-77762186 CAGGGCATCACATGGCAAGGGGG - Intergenic
933779024 2:85788633-85788655 CAGGGCTGGCCAAGGAAAGGGGG + Intergenic
933820000 2:86102553-86102575 AAGGGCAACCCATGGAATGGGGG - Intronic
934673067 2:96228929-96228951 CAGGGTGTCCCATGGCAAGGGGG + Intergenic
935303896 2:101718544-101718566 CAGGGCTGACAGTGGGAAGGTGG + Intronic
935678554 2:105617076-105617098 AGGGGCTACCCTTGGGAGGGTGG - Intergenic
936017218 2:108968689-108968711 CAGGGCTACCCAGAGTAAAGGGG - Intronic
936242805 2:110802478-110802500 AAGGGAAACCCATGGGGAGGTGG - Intronic
937449960 2:121993817-121993839 CAGGGCTTGGCATGTGAAGGTGG - Intergenic
938145868 2:128834629-128834651 CACGGCTGCTCATGGGATGGTGG - Intergenic
940788051 2:158003078-158003100 CAGGGATAGCCATGAGGAGGTGG - Intronic
943820417 2:192314748-192314770 CATGGGTAGCCATGGGCAGGCGG + Intergenic
945022486 2:205587832-205587854 CAGGGCTATAAATGGGAAGCTGG - Intronic
946153798 2:217793891-217793913 CAGGGCCAGACCTGGGAAGGGGG + Intergenic
948118108 2:235508882-235508904 CAGGGTTACACAGAGGAAGGTGG + Intronic
948426047 2:237887070-237887092 CTGGGCTGCCCATGGGGAAGGGG + Intronic
948467645 2:238159861-238159883 CAGGGCTGCCCCAGGGAAGCCGG + Intronic
948701860 2:239765679-239765701 CAGGCATCCCCATGGGAAGCAGG + Intronic
948872572 2:240810939-240810961 CAGTGCTACCCTTGGGGAGCAGG + Intronic
948974974 2:241458400-241458422 CAGGGCTACCCGTGGGATGCTGG + Intronic
1169015358 20:2288239-2288261 AAGGGCTACCCAGGGGAGTGTGG - Intergenic
1169388644 20:5171728-5171750 AAGGAATCCCCATGGGAAGGAGG + Intronic
1169777147 20:9267925-9267947 CAGGGCATCACATGGCAAGGAGG + Intronic
1171059526 20:21942977-21942999 CAGTGCTAGCCAGGGGAAGCAGG + Intergenic
1171373534 20:24676573-24676595 CAGGGCTGCCCCAGGGAAAGCGG - Intergenic
1174704970 20:52646155-52646177 CAGGGCACAGCATGGGAAGGGGG - Intergenic
1175396739 20:58669598-58669620 CAGGGTTTCACATGGGGAGGAGG - Intronic
1175983213 20:62751759-62751781 CACGGCTCCCCAGGGGAAGGAGG + Intronic
1176061765 20:63175673-63175695 TAGGGTGACCCAAGGGAAGGGGG + Intergenic
1176241193 20:64076710-64076732 CAGGGCTACCCATGGGAAGGTGG - Intronic
1178534298 21:33399654-33399676 CAGGGCATCACATGGCAAGGGGG - Intergenic
1178555372 21:33586363-33586385 CATGGTTACCTATGGGAAGCGGG + Intronic
1178617021 21:34143510-34143532 CAGGGCACCCCCTGGGAAGGGGG - Intergenic
1179040289 21:37796654-37796676 CAGGGCTACATCTGGGAAGTTGG - Intronic
1180998837 22:19978527-19978549 CAGGGCCTCCCAGGGGTAGGAGG + Intronic
1181064495 22:20299174-20299196 CAGGGCTTCCCACGGAATGGGGG + Intergenic
1182303559 22:29352495-29352517 TATGACTCCCCATGGGAAGGAGG + Intronic
1183484794 22:38082974-38082996 CAGGGCTACCCACGTGAGGGTGG + Intronic
1183606795 22:38871166-38871188 GGGGGATGCCCATGGGAAGGGGG - Intronic
1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG + Intronic
1184683338 22:46084852-46084874 CAGGGATGCCCGTGGGAAGAAGG + Intronic
1185253063 22:49815836-49815858 CAGGACGACACATTGGAAGGAGG - Intronic
950179414 3:10900812-10900834 CAGTGCTGCCCATGGGATGTGGG + Intronic
950464354 3:13144533-13144555 CAGGGCTTCCCCTGTGAATGGGG - Intergenic
951791605 3:26491626-26491648 CAGGGCTACCAAGTGGAAGGAGG + Intergenic
953470598 3:43162851-43162873 CAGGGCTACTCAAGGGGAAGGGG + Intergenic
953636145 3:44666739-44666761 GAGGGCTATCCAATGGAAGGAGG - Intergenic
953919169 3:46940081-46940103 CAGGGCTAGGCATGGGAGGGAGG + Intronic
954576650 3:51680075-51680097 CAGAGCTACCCAAGTTAAGGGGG - Intronic
954699492 3:52443849-52443871 CTGGGCTTCCCAGGGGAAGGTGG + Intronic
955151833 3:56375216-56375238 CAGGGCTAAGCATGGGAGAGCGG + Intronic
955277450 3:57559734-57559756 CTGGGCTTCCAATGGGGAGGAGG + Exonic
959234094 3:103695669-103695691 CAGGGTTACCCATTGTATGGAGG + Intergenic
960189865 3:114690546-114690568 CTAGGCTAGCCATGGGAAGCTGG + Intronic
960857369 3:122116861-122116883 CATGGTTATCCATGGGATGGGGG + Intronic
961346806 3:126268408-126268430 CAGGGAGGCCCATGGGATGGGGG + Intergenic
961527081 3:127511268-127511290 CAGGGCATCACATGGCAAGGGGG - Intergenic
963222976 3:142831332-142831354 CAGGGCATCACATGGCAAGGGGG - Intronic
963344275 3:144075262-144075284 CAGGGCATCACATGGCAAGGGGG - Intergenic
963507831 3:146209259-146209281 CAGGGGTAATGATGGGAAGGGGG + Intronic
965051906 3:163662210-163662232 CAGGGCATCCCATGGTGAGGAGG - Intergenic
968089916 3:195893344-195893366 CAGGGCCACCCCAGGGGAGGGGG - Intronic
968461953 4:730588-730610 CAGGGTTACCCGTGGGCCGGAGG - Intronic
968473452 4:792169-792191 CAGGGCTGCGCATCGGAATGCGG + Intronic
969046777 4:4342120-4342142 CAGGGCATCCCATGGTGAGGGGG - Intergenic
969232817 4:5843343-5843365 CAGGGCTACAAAGGGGAAGGTGG - Intronic
969279110 4:6157636-6157658 CAGGGCTACGCTGGGGAAGATGG - Intronic
970782435 4:19754252-19754274 CACAGATATCCATGGGAAGGAGG - Intergenic
973556886 4:52092438-52092460 CACGGCTTCCCTTGGGTAGGGGG + Intronic
974255170 4:59443077-59443099 CAGGGCATCCCATGGCAAGGGGG - Intergenic
977460465 4:97319281-97319303 CAGGGCATCGCATGGTAAGGGGG - Intronic
977741663 4:100491500-100491522 CAAGGCTCCCCATAGGCAGGTGG + Intronic
983956292 4:173702462-173702484 CAGGCCTACCCATTAGAAAGTGG - Intergenic
983961292 4:173757808-173757830 GATAGCTACCCATGGGAAGTTGG + Intergenic
986360975 5:6977910-6977932 CAGGGCTATGCATGGAATGGGGG + Intergenic
986423863 5:7611087-7611109 CAGAGCTTCCCATGGTCAGGTGG - Intronic
987093178 5:14525458-14525480 CTGGCCTAGCCATGGGAAGAAGG - Intronic
987968188 5:24904818-24904840 TAGGGTTATCCATGGGAAGGTGG + Intergenic
990265431 5:54070426-54070448 CAGGGCATCACATGGCAAGGGGG - Intronic
990339893 5:54811991-54812013 CAGGGCTGCTGATGGGGAGGAGG + Intergenic
993079382 5:83276548-83276570 CAGGGCATCACATGGCAAGGGGG - Intronic
993913613 5:93713901-93713923 CAGGGCTCACCATGGGGAGAGGG - Intronic
995571983 5:113490306-113490328 CAGGGCATCACATGGCAAGGGGG - Intergenic
999208054 5:149864146-149864168 CAGGGCCACCCCAGGGAATGAGG - Intronic
999288986 5:150411351-150411373 CAGGGAATCCCATGGCAAGGAGG - Intronic
1001933288 5:175687828-175687850 CAGGGCTACCTATGTGCAGGCGG - Intergenic
1003409357 6:5849622-5849644 CAGTGCTACTGATGGGAGGGTGG - Intergenic
1004107050 6:12675634-12675656 CAGGGATACCAATGGCAATGGGG + Intergenic
1004933290 6:20482715-20482737 CATGGCTACTCATGGGAGGGAGG - Intronic
1006296376 6:33171801-33171823 CAGGGCTCCCCTGGGGAACGAGG - Exonic
1010645871 6:78387018-78387040 CTGGGCTGCACATGGCAAGGGGG + Intergenic
1011063737 6:83301034-83301056 CAGGGCCTGCCATGGGATGGGGG + Intronic
1011115470 6:83886151-83886173 TAGGGCATCCCATGGTAAGGGGG + Intronic
1011735260 6:90303699-90303721 CAGGGGTAAACATGGGTAGGTGG + Intergenic
1013193389 6:107823427-107823449 CAGTGCTCCACCTGGGAAGGAGG + Intronic
1014250403 6:119110135-119110157 CTGGGCTACCCATCTGTAGGTGG - Intronic
1018100032 6:160429429-160429451 CAGGGTTTACCATGGGCAGGGGG - Intronic
1018905339 6:168072450-168072472 CAGGGCCTCCCATAGGGAGGGGG + Intronic
1019578917 7:1750551-1750573 CAGGGCTGCCCCTCGGAAGCTGG - Intergenic
1020152196 7:5691205-5691227 CAGGTCTACCCATGGTGAAGGGG + Intronic
1022969724 7:35505848-35505870 CAGGGCTGCCCCTGAGAAGCTGG + Intergenic
1024291538 7:47807759-47807781 AAGGGCTGCCTAGGGGAAGGAGG + Intronic
1024673361 7:51616572-51616594 CAGGGCATCCCATGGCAAGGGGG + Intergenic
1028445947 7:90924203-90924225 CAGGGCATCACATGGCAAGGGGG + Intronic
1028850734 7:95534532-95534554 CAGGGCTAGTGCTGGGAAGGAGG - Intronic
1029032755 7:97486111-97486133 CAGGGCATCCCATGGTGAGGAGG + Intergenic
1033286664 7:140047393-140047415 CAGGGCATCACATGGCAAGGGGG - Intronic
1034160928 7:148993776-148993798 CTGGGGCACCCATGGAAAGGCGG + Intergenic
1034345727 7:150384154-150384176 CAGGGCCAGGCGTGGGAAGGGGG + Intronic
1035175534 7:157047284-157047306 CATGGCTGGCCTTGGGAAGGAGG + Intergenic
1035940262 8:3892179-3892201 TAGGGCTACACATTGGAAGCAGG - Intronic
1035976970 8:4323756-4323778 CAGGTCTGGCCAGGGGAAGGGGG - Intronic
1038347711 8:26747553-26747575 CAGGGCTTGCCCAGGGAAGGTGG + Intergenic
1039229729 8:35430351-35430373 CAGGGCAACGCATGGGAAAAGGG - Intronic
1039990229 8:42481499-42481521 CAGGGAGAGACATGGGAAGGAGG + Intronic
1042824032 8:72962302-72962324 CATGGCTGCCTTTGGGAAGGAGG + Intergenic
1043069446 8:75620415-75620437 CAGCCACACCCATGGGAAGGAGG + Intergenic
1043526085 8:81097799-81097821 AAGGTCTACCCATGGGAGTGAGG - Intronic
1044405204 8:91818669-91818691 CATGGCTTCCCTTGGGTAGGGGG - Intergenic
1045060109 8:98403609-98403631 GAGGGCTGCCCCTGGGGAGGGGG + Intronic
1045279931 8:100741446-100741468 CTGGGCATCCCAAGGGAAGGGGG + Intergenic
1045886891 8:107108703-107108725 CAGGGAGACCCAGCGGAAGGTGG - Intergenic
1046345190 8:112914836-112914858 CTGGGCTAGCTCTGGGAAGGAGG - Intronic
1047659993 8:127023131-127023153 CAGAGCTCCCCATGGGTTGGTGG - Intergenic
1048602602 8:135933947-135933969 CAGGGCTTCACATGGTGAGGGGG - Intergenic
1050415997 9:5418526-5418548 CAGGGCTCCCCAGGGGGTGGCGG - Intronic
1053256923 9:36625505-36625527 CATGCCTATCCCTGGGAAGGAGG - Intronic
1053257276 9:36628294-36628316 CATGCCTATCCCTGGGAAGGAGG + Intronic
1053723482 9:40973302-40973324 CAGGGCTACCCATGCCCATGGGG - Intergenic
1054342481 9:63878694-63878716 CAGGGCTACCCATGCCCATGGGG + Intergenic
1056776862 9:89519305-89519327 CTGGGCTTCCCATGGCATGGTGG - Intergenic
1060670689 9:125466755-125466777 TAGGGGGACCCAGGGGAAGGAGG - Intronic
1062381302 9:136288132-136288154 AGGGGCTGCCCTTGGGAAGGGGG + Intronic
1186790210 X:12990195-12990217 CAGGGCATCACATGGCAAGGGGG - Intergenic
1191601042 X:63007369-63007391 CAGGGGAAAGCATGGGAAGGGGG + Intergenic
1192977350 X:76300248-76300270 CATGGCTTCCCTTGGGTAGGGGG + Intergenic
1195750376 X:108157815-108157837 CAGGGCTACACATGAGCTGGTGG + Intronic
1199984692 X:152941999-152942021 CAGGGCTGCCCAGGGGGAGGGGG + Intronic
1199997243 X:153033048-153033070 CAGGGCTGTCCAGGGTAAGGGGG + Intergenic
1200796533 Y:7346115-7346137 CAGGGACACCCATAGGCAGGGGG - Intergenic
1201774504 Y:17648520-17648542 CAGGGAAACCCCTGGGAGGGCGG + Intergenic
1201827052 Y:18257469-18257491 CAGGGAAACCCCTGGGAGGGCGG - Intergenic