ID: 1176241800

View in Genome Browser
Species Human (GRCh38)
Location 20:64078898-64078920
Sequence AAAGCGGCAGCCACTCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176241800_1176241802 -10 Left 1176241800 20:64078898-64078920 CCCTTGGGAGTGGCTGCCGCTTT 0: 1
1: 0
2: 1
3: 6
4: 118
Right 1176241802 20:64078911-64078933 CTGCCGCTTTGCTCCACAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176241800 Original CRISPR AAAGCGGCAGCCACTCCCAA GGG (reversed) Intronic
900287054 1:1906859-1906881 AGAGCTTCAGCCACTCCCAAGGG - Intergenic
900399148 1:2465918-2465940 AAAGCCACAGACACGCCCAAGGG - Intronic
900949701 1:5851528-5851550 AGAGCCCCTGCCACTCCCAAAGG + Intergenic
902235769 1:15056344-15056366 AAAGCAGCTGCCTCTCCCACTGG - Intronic
905448247 1:38041354-38041376 AAAGCCACAGCCAATCCCAGAGG - Intergenic
906143346 1:43546296-43546318 GAAGGGGCAGGCATTCCCAAGGG + Intronic
906286414 1:44590656-44590678 TCAGCGGCATCCACTCCCCATGG - Intronic
906803159 1:48755141-48755163 AAAGGTGGAGCCACACCCAAGGG - Intronic
909428199 1:75552714-75552736 AAAGCAACAGACACTCCAAAAGG - Intronic
912570765 1:110619399-110619421 AAATCTGCTCCCACTCCCAAGGG + Intronic
913126540 1:115795491-115795513 TAAAAGGCAGCCAATCCCAAGGG - Intergenic
915899986 1:159840002-159840024 AAAGGGAGAGCCACTCACAAGGG + Intronic
917458184 1:175203806-175203828 AAAGCAGAAGTCACTCGCAATGG - Intergenic
918546366 1:185689068-185689090 AAAACTGTGGCCACTCCCAAGGG - Intergenic
920509736 1:206542003-206542025 AAAGCGGCACCCAAGGCCAAAGG - Intronic
921273090 1:213490164-213490186 AAAGCAGAAACCACACCCAATGG - Intergenic
922201964 1:223411553-223411575 AAATGGGGAGCCACTCCAAAAGG + Intergenic
922411489 1:225380210-225380232 AAAGCGGCTGCCACTGACAGTGG + Intronic
1064265282 10:13820842-13820864 ACAGCTGCACCCACTCCTAAAGG - Intronic
1065748340 10:28862337-28862359 AAAACGGGAGACAATCCCAAAGG + Intronic
1071478908 10:86048320-86048342 AGAGAGGCAGCCACTCCCTTGGG + Intronic
1072670848 10:97427806-97427828 AAAGAAGCAGCCATTCACAAGGG + Intronic
1076003972 10:126933273-126933295 ACAGCGGCAGCCTCTCCCAGTGG + Intronic
1077481496 11:2816920-2816942 AGAGGGGCAGCCACTGCCCAGGG - Intronic
1080785521 11:35471757-35471779 AAAGCAGCAGCCACATCCCAGGG + Intronic
1083301396 11:61741260-61741282 CCAGCAGCAGCCACTCCCCACGG + Exonic
1083891965 11:65599980-65600002 GAAGCGGCAGCAAAGCCCAATGG + Intronic
1084705683 11:70814862-70814884 AAAGTGGCAGCCAGTCCCAAGGG - Intronic
1085622808 11:78050157-78050179 AAAGGGGAAGACACCCCCAAAGG + Intronic
1086640675 11:89151732-89151754 AAAGAAGCAGCCATTCCTAAAGG + Intergenic
1086747001 11:90441392-90441414 ATAGCAGCAGCCACTCCAGAGGG + Intergenic
1092112689 12:5975096-5975118 ACAGCGTCATCCTCTCCCAAAGG + Intronic
1092178389 12:6426883-6426905 GAAGGGACAGGCACTCCCAAAGG - Intergenic
1098270575 12:68766197-68766219 AAAACGGCAGCCAATCTCAGTGG + Exonic
1098521814 12:71441069-71441091 ACAGCGGCACCGACACCCAAAGG + Intronic
1103705184 12:122867460-122867482 AAAGGGGCAGAGACTCCCACAGG - Exonic
1103923335 12:124410757-124410779 ACAGCGGCTGCCCCTCCCCAGGG + Intronic
1104289791 12:127456345-127456367 AAAGGCGCCGCCACTCCCAGCGG - Intergenic
1107611634 13:42119170-42119192 AAGCCTGCAGCCACTGCCAAGGG - Intronic
1107934361 13:45332610-45332632 AAAGCCACATCCACTCCCAAAGG + Intergenic
1115750942 14:36489183-36489205 AAACCAGGAGCCACTCCCATAGG - Intronic
1115772734 14:36683225-36683247 AAACCGGCTGCCATTCCCACAGG - Intronic
1119178130 14:72584650-72584672 AAAGCGCCAGCCTCTGCCATGGG + Intergenic
1122163549 14:99803977-99803999 AATGTGGCAGCCGCTCCCAGGGG + Intronic
1123466691 15:20521996-20522018 AGAGCTGCAGCCACTGCCCAGGG - Intergenic
1123651422 15:22479045-22479067 AGAGCTGCAGCCACTGCCCAGGG + Intergenic
1123741840 15:23287906-23287928 AGAGCTGCAGCCACTGCCCAGGG + Intergenic
1123745156 15:23314652-23314674 AGAGCTGCAGCCACTGCCCAGGG - Intergenic
1123761477 15:23436578-23436600 AGAGCTGCAGCCACTGCCCAGGG - Intergenic
1124277428 15:28337972-28337994 AGAGCTGCAGCCACTGCCCAGGG - Intergenic
1124305273 15:28573634-28573656 AGAGCTGCAGCCACTGCCCAGGG + Intergenic
1126700832 15:51366223-51366245 AAATCCTGAGCCACTCCCAAAGG - Intronic
1127714803 15:61639679-61639701 CAAGAGGCAGCCACTCCTCATGG + Intergenic
1131053907 15:89364536-89364558 CAAGCAGCTGCCACTGCCAATGG + Intergenic
1131584861 15:93682417-93682439 AAAGTGGCAGCCATTCCCTAGGG - Intergenic
1135147892 16:19978991-19979013 AAAACAGCAGCAACACCCAATGG - Intergenic
1137611361 16:49820185-49820207 AAAGGGGCAGAGACTCCCAGTGG + Intronic
1139405876 16:66717224-66717246 GAAGCGGCTGACACTCCCACTGG - Intergenic
1143036966 17:4004987-4005009 ACAGCGGCGGCCACTGCCATAGG + Exonic
1146572931 17:33968443-33968465 AAAGCAGCAGCCACAGCCCATGG - Intronic
1151354969 17:73553000-73553022 GGAGCTGCAGCCAATCCCAAAGG - Intronic
1154017323 18:10630595-10630617 AAAGCTGGGGCCACTCCCATTGG + Intergenic
1154187538 18:12199002-12199024 AAAGCTGGGGCCACTCCCATTGG - Intergenic
1154386011 18:13892385-13892407 AAAGGGGCAGCCAGTCCTACAGG - Intronic
1156707238 18:39898224-39898246 AAAGAAGCACTCACTCCCAAAGG + Intergenic
1161480996 19:4510616-4510638 GAAGCCGCAGCCACTACCAAGGG - Exonic
1165090708 19:33386928-33386950 AAAGGGGAAGCCACGCACAAAGG + Exonic
1166099906 19:40565723-40565745 TCTGCTGCAGCCACTCCCAATGG - Exonic
925349615 2:3191684-3191706 GAAGCGGCTGCCACTTCTAAAGG + Intronic
928136696 2:28693303-28693325 AAAGCAACAACCACCCCCAAGGG + Intergenic
932571789 2:72942132-72942154 CAAGCCTCAGCCACTCCCAGGGG - Exonic
935127641 2:100238591-100238613 AGAGCGGCAGCCCCTCCCTGGGG + Intergenic
935177369 2:100661674-100661696 AAAGCAGCAGCCAATCCCTGAGG - Intergenic
935822343 2:106906809-106906831 CAACAGGCAGCCACTCTCAAAGG - Intergenic
938850272 2:135252429-135252451 GAAGAGACAGCCATTCCCAAAGG - Intronic
938900838 2:135797367-135797389 GAAGCGGCAGTCACTGCCCACGG - Intronic
945320835 2:208421657-208421679 AAAGCTTCAGCTACTCTCAAGGG + Intronic
948807625 2:240459807-240459829 AGAGTGGCAGCCACCCCCAGGGG + Intronic
1173414658 20:42844977-42844999 AAAGCACTAGCCACTCCCAGAGG - Intronic
1173592227 20:44233756-44233778 AAAGAGGCTGCCACTCACCAGGG + Intergenic
1173593673 20:44245095-44245117 AAAGTGGCTGCCACTCACCAGGG - Intergenic
1176241800 20:64078898-64078920 AAAGCGGCAGCCACTCCCAAGGG - Intronic
1179312426 21:40208477-40208499 AAAGTGGCAGCGAATCTCAAAGG + Intronic
1181009989 22:20034630-20034652 ACAGCCGCAGCCACCCCCAGGGG - Intronic
1182857751 22:33533139-33533161 AAAGGGCCAGCCACTAACAATGG + Intronic
1184135832 22:42549377-42549399 AGAGAGGCAGCCAGACCCAATGG + Intergenic
950444520 3:13028637-13028659 AAAGTGACAGCCAGTCCCCATGG + Intronic
956604275 3:71056504-71056526 ACAGCAGCAGGCACTGCCAAAGG + Intronic
958965853 3:100557331-100557353 AATGAGGCAGCCACTCACAGTGG + Intronic
959006457 3:101025941-101025963 ACAGCTGCAGCCTCTCCCATAGG - Intergenic
964872512 3:161328937-161328959 AAACAGGAAGGCACTCCCAAGGG - Intergenic
968298029 3:197592373-197592395 AAAGTGGCAGCCAGTGTCAATGG - Intergenic
968484391 4:851914-851936 AAAACGGCCACCACGCCCAAAGG - Exonic
977475942 4:97509740-97509762 AAAGAGGCAGCCACTTTGAAGGG + Intronic
979195888 4:117919717-117919739 TAAGAGGCAGCCACGCCCAGGGG - Intergenic
981843945 4:149145185-149145207 AAATCGGCAGCAAGTCCCATTGG - Intergenic
985651545 5:1109958-1109980 GAAGCCGGAGCCCCTCCCAAAGG - Intronic
986024582 5:3838667-3838689 AATGAGGCAGCCACAGCCAAAGG + Intergenic
986519738 5:8601927-8601949 AAAGCTTCAGCCACTGCCCATGG - Intergenic
986683680 5:10256778-10256800 AAAGTGGAACCCACCCCCAATGG - Intronic
986723392 5:10576826-10576848 AAAGTGGCAGCCAGTGCCATGGG + Intronic
990404854 5:55478930-55478952 AAAGAGGCTGCCACCACCAAAGG + Intronic
992948170 5:81830158-81830180 AAGGCCTCAGCCAATCCCAATGG + Intergenic
993264318 5:85704187-85704209 AAAGCGTAAATCACTCCCAATGG + Intergenic
994389850 5:99179262-99179284 AAAGAGGGAGCCATTGCCAAAGG + Intergenic
995870325 5:116737699-116737721 AAAGGAGCTGCCACACCCAAGGG - Intergenic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1010569563 6:77461950-77461972 CCTGCGGCAGCCAATCCCAAAGG - Intergenic
1012861584 6:104566685-104566707 AAAGCCTCAGCCACTCTCATGGG + Intergenic
1013813491 6:114070558-114070580 CAAGTGGCAGCTAATCCCAATGG - Intronic
1014176396 6:118335979-118336001 GAAGAGGCAGCCACACCTAATGG - Intergenic
1016935844 6:149448950-149448972 AAAGCGGGAGGCACTTCCCAGGG - Intronic
1018465435 6:164040082-164040104 ATAGCGGCAGCCACAGCCACAGG - Intergenic
1019340653 7:507389-507411 AAAGCAGGGGCCACTCCCAGCGG + Intronic
1023252602 7:38281418-38281440 AAAGCTGGAACCAATCCCAAGGG - Intergenic
1025764804 7:64433813-64433835 ACAGCGGCAGCCGCTCCCACAGG - Intergenic
1028817032 7:95157610-95157632 ATAGCAGCAGCCACTCCAGACGG - Intronic
1034419876 7:150984393-150984415 AAAGCAACAGAAACTCCCAAAGG - Intergenic
1043195372 8:77286803-77286825 ATGGCAGCAGCCACTCCAAATGG - Intergenic
1047862618 8:128984932-128984954 ACAGCTGCTGCCACTACCAAAGG - Intergenic
1048338847 8:133523497-133523519 AAAGTGGCAGCTACTTCAAAGGG + Intronic
1048398434 8:134038380-134038402 AAAGAGGCTGACCCTCCCAAGGG + Intergenic
1052691320 9:31820414-31820436 CTGGCAGCAGCCACTCCCAATGG - Intergenic
1055593891 9:77846307-77846329 AAAGCGCTTGCCCCTCCCAAGGG - Intronic
1062174987 9:135156659-135156681 AAAGCAGCAGCAACGCCCAGAGG + Intergenic
1187941865 X:24390436-24390458 AAAGTTGGATCCACTCCCAAAGG + Intergenic