ID: 1176242523

View in Genome Browser
Species Human (GRCh38)
Location 20:64081645-64081667
Sequence GTCAGGGCGCAGAGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176242523_1176242529 -6 Left 1176242523 20:64081645-64081667 CCCAGGACCCTCTGCGCCCTGAC 0: 1
1: 0
2: 1
3: 21
4: 194
Right 1176242529 20:64081662-64081684 CCTGACAGCCCTCAATATATTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1176242523_1176242531 1 Left 1176242523 20:64081645-64081667 CCCAGGACCCTCTGCGCCCTGAC 0: 1
1: 0
2: 1
3: 21
4: 194
Right 1176242531 20:64081669-64081691 GCCCTCAATATATTGGGCTTTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1176242523_1176242530 -5 Left 1176242523 20:64081645-64081667 CCCAGGACCCTCTGCGCCCTGAC 0: 1
1: 0
2: 1
3: 21
4: 194
Right 1176242530 20:64081663-64081685 CTGACAGCCCTCAATATATTGGG 0: 1
1: 0
2: 0
3: 18
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176242523 Original CRISPR GTCAGGGCGCAGAGGGTCCT GGG (reversed) Intronic
900188576 1:1343959-1343981 GGCAGGCCGCAGAGGGTCAGGGG + Intronic
900352167 1:2240301-2240323 GTCAGGGAGGAGGGAGTCCTGGG + Intronic
900488183 1:2933380-2933402 GGCAGAGAGCAGAGGGTGCTGGG + Intergenic
900724792 1:4208861-4208883 GTGATGGTGCAGAGGCTCCTGGG - Intergenic
900791853 1:4685924-4685946 GTCAGAGGACAGAGGGACCTGGG + Intronic
901049566 1:6419571-6419593 GGCGGAGGGCAGAGGGTCCTGGG - Intronic
901635071 1:10666698-10666720 GATAGGGCACCGAGGGTCCTGGG + Intronic
901771847 1:11534574-11534596 GGCAGGAGGCAGAGGGACCTGGG + Intronic
902447546 1:16476603-16476625 GCCACAGCGCAGAGGGTCCTTGG - Intergenic
902467446 1:16626818-16626840 GCCACAGCGCAGAGGGTCCTTGG - Intergenic
902507138 1:16945917-16945939 GCCACAGCGCAGAGGGTCCTTGG + Intronic
903016775 1:20366648-20366670 GTCGGGGCGCGGAGGGTGCTGGG - Intergenic
906097766 1:43235849-43235871 GACAGGGCACAGAGGGTGCTAGG - Intronic
907755100 1:57303406-57303428 GTCAGGCAGCAGATTGTCCTTGG - Intronic
908858529 1:68456132-68456154 GTCATGGGGAAGAGGGACCTAGG + Intergenic
912704211 1:111899925-111899947 GTCATGTTGCAGAGAGTCCTGGG - Intronic
912718510 1:112000296-112000318 GTCAAGGAGCAGAGGTTTCTGGG - Intergenic
916676903 1:167071700-167071722 GTTAGTGGGCAGAGGGTCCTGGG - Intronic
918999055 1:191804326-191804348 CTCAGGGCCCACAGGGTCCACGG + Intergenic
922179045 1:223219310-223219332 GCCAGGGCTCAAAGGGTCCCTGG + Intergenic
1062836684 10:640437-640459 GTCAGGGCGCAAGGGAGCCTTGG - Intronic
1063357189 10:5412501-5412523 GTGAGCGCGCAGCGGTTCCTAGG - Intergenic
1063723551 10:8611049-8611071 GACTGGGGGCAGAGGGTCATGGG + Intergenic
1065960216 10:30727894-30727916 GACAGAGTCCAGAGGGTCCTGGG - Intergenic
1069800873 10:71080752-71080774 GTCAGTGAGCAGAGGGTATTAGG - Intergenic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1076495957 10:130898067-130898089 TTCAGGGCTGAGAGGGGCCTGGG + Intergenic
1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG + Intergenic
1076710266 10:132329744-132329766 GTCAGGGTGCAGAGGTGCCACGG + Intronic
1076868118 10:133179283-133179305 GTCTGGGCCCAGGCGGTCCTGGG + Intronic
1076887311 10:133268622-133268644 GTCGGGGCACAGAGGAGCCTGGG + Intronic
1077140429 11:1021923-1021945 GTCTGAATGCAGAGGGTCCTGGG - Intronic
1077602404 11:3582515-3582537 CTCAGGGAGTAGAGGGGCCTAGG - Intergenic
1077837510 11:5937628-5937650 ACCAGGGCGGAGAGGGTCGTAGG - Intronic
1080808880 11:35682477-35682499 GTCAGAAGGCAGAGGCTCCTCGG - Intronic
1083336454 11:61924525-61924547 GTGGGGGCGCTGAGGGGCCTGGG - Intergenic
1083657685 11:64237547-64237569 GTCAGGGCGCTGGTGGTGCTGGG - Exonic
1085388563 11:76170823-76170845 GGCAGTGAGCAGAGGGGCCTTGG - Intergenic
1087163407 11:94973561-94973583 CTCTGGGCGCAGAGGTTTCTGGG - Exonic
1088557723 11:111079761-111079783 GTCATGGTGCAGAGGGTGCTGGG - Intergenic
1088914918 11:114220179-114220201 CTCTGGGCCCAGATGGTCCTTGG + Intronic
1089406684 11:118203340-118203362 GTGAGGCCGGAGAGGTTCCTAGG - Intronic
1089518665 11:119049416-119049438 CTCAGAGCCCAGAGGATCCTGGG + Intronic
1089619590 11:119714603-119714625 GTCAGGATGCAGAGGGACCGTGG - Intronic
1089755119 11:120680860-120680882 TACAGGGAGAAGAGGGTCCTTGG - Intronic
1091316160 11:134615477-134615499 CTCAGAGCCCAGAGGGTGCTGGG - Intergenic
1091453716 12:589932-589954 GTCAGGACCCAAGGGGTCCTAGG + Intronic
1093146728 12:15575382-15575404 GTCAGGTGGGAGGGGGTCCTTGG - Intronic
1094853323 12:34392038-34392060 CTCAGGGCCCAGAGGATTCTGGG + Intergenic
1094871282 12:34600516-34600538 CACAGGGCCCAGAGGATCCTGGG + Intergenic
1095683321 12:45003906-45003928 GTAAGGGAGCTGAGGGTCTTTGG - Intergenic
1102208610 12:111107620-111107642 GTGAGGGAGCAGAGGGTGCAGGG + Intronic
1102349618 12:112182756-112182778 GTCAGGGCGCTGAAGGCCGTGGG - Intronic
1102520036 12:113472320-113472342 TTCAGGGCGCAGAGGGGGCGCGG - Intergenic
1107293797 13:38888370-38888392 GTCAGGAGGCAGAGGGAGCTAGG + Intergenic
1112087003 13:96041874-96041896 GTCTGGGCTCAGACTGTCCTTGG - Intronic
1113638855 13:111943176-111943198 AACAGGGCCCAGAGGGTGCTCGG + Intergenic
1113885877 13:113658175-113658197 GTCTGGGCGTAGAGGGTGCAGGG - Exonic
1114694330 14:24612555-24612577 GTCTGGGCTCAGAGTCTCCTTGG + Intergenic
1115771478 14:36666825-36666847 GTCAGGGCGCTGGGGGTCTGGGG + Intronic
1117546048 14:56795343-56795365 GCCAGGGAGGAGAGGGTCATTGG + Intergenic
1118311572 14:64697390-64697412 TTTAGGCTGCAGAGGGTCCTGGG + Intergenic
1118709412 14:68507462-68507484 TTCAGATTGCAGAGGGTCCTAGG + Intronic
1120558399 14:85958951-85958973 ATCGGGGGGCAGAGGATCCTTGG - Intergenic
1122084737 14:99291728-99291750 ATGATGGCCCAGAGGGTCCTAGG + Intergenic
1122397109 14:101441548-101441570 GACAGGGCCCAGAGGGACCCGGG - Intergenic
1122634486 14:103123661-103123683 GTCCGGGCGCAGAGGGGCCAAGG + Exonic
1122957338 14:105076840-105076862 GAGAGGGCTCAGAGGATCCTAGG + Intergenic
1123067527 14:105626114-105626136 CCCAGGGCGCAGAGGCCCCTCGG + Intergenic
1123071544 14:105644838-105644860 CCCAGGGCGCAGAGGCCCCTCGG + Intergenic
1123091208 14:105743119-105743141 CCCAGGGCGCAGAGGCCCCTGGG + Intergenic
1123096975 14:105771454-105771476 CCCAGGGCGCAGAGGCCCCTCGG + Intergenic
1124954241 15:34349510-34349532 GTCAAGGAGCCCAGGGTCCTAGG + Intronic
1125541633 15:40472937-40472959 GGCTGGGCACAGAGGGTCTTTGG - Exonic
1126566695 15:50108438-50108460 ATCAAGTCGCAGAAGGTCCTAGG - Intronic
1130666131 15:85871613-85871635 CTCAGAGCTCAGAGGGTCCAAGG - Intergenic
1132534095 16:468292-468314 GTCAGGGAGGAGGAGGTCCTGGG + Intronic
1132742238 16:1420586-1420608 GTCCGGGCGCTGAGGCTCATAGG - Exonic
1134244675 16:12531258-12531280 GTCAGGGCGCACTGGGACCTGGG + Intronic
1135656580 16:24255834-24255856 GCCAGGGCGCTGACTGTCCTCGG + Exonic
1137010527 16:35316028-35316050 GTAAGGAAGCTGAGGGTCCTTGG + Intergenic
1137024129 16:35456324-35456346 GTAAGGAGGCTGAGGGTCCTTGG + Intergenic
1137458574 16:48637311-48637333 GTCAGGGAGCAGAGGGTGTAGGG - Intergenic
1139593866 16:67947287-67947309 GCCAGGGCGCAGAGGTTCTTAGG - Intronic
1142244312 16:88962545-88962567 CTCAGGGTGCAGAGTGGCCTGGG - Intronic
1143120889 17:4606065-4606087 GGCAGGAGGCAGAGGGCCCTGGG + Intronic
1143642504 17:8207131-8207153 GTGAGGGAGCAGAGGGGCTTCGG + Intronic
1144675433 17:17158659-17158681 CTCAGGGCGCAGGGGCTCGTGGG - Exonic
1144851813 17:18247607-18247629 GTCAGGGTGCGAAGGATCCTGGG + Intronic
1144855547 17:18265422-18265444 TTCAGGCAGCTGAGGGTCCTGGG + Exonic
1148695742 17:49556945-49556967 GTGTGGGAGCAGAGGGTGCTGGG - Intergenic
1151386931 17:73760667-73760689 TTCAGGGCTCAGAGGAGCCTGGG + Intergenic
1152140236 17:78532231-78532253 GTCAGGAGGCAGAGGGAGCTGGG - Intronic
1152561935 17:81082986-81083008 GTCAGTGCTCAGAGGGTCTGTGG + Intronic
1154356819 18:13627844-13627866 GCCAGAGGGCAGACGGTCCTGGG + Intronic
1157068153 18:44375521-44375543 GTCAGGGGGCACAGGGACCAGGG - Intergenic
1160024971 18:75209368-75209390 GGGAGGGCGGAGAGGATCCTTGG - Intergenic
1160058652 18:75509740-75509762 GTCTGGGCTCAGAGTCTCCTTGG - Intergenic
1161163306 19:2772480-2772502 GGCTGCGCGCAGAGGGTCCCTGG - Intronic
1161307134 19:3574314-3574336 GGCAGGGCTCAGAGGGGCATGGG - Intronic
1162016847 19:7850833-7850855 CTCAGGGCGCAGAGAGCCCCTGG + Intronic
1162420187 19:10561748-10561770 GTCGGGGGGCTGAGGGGCCTGGG - Intronic
1163699057 19:18778041-18778063 GACAGGGCGAGGAGGGTCGTGGG - Exonic
1164615711 19:29665733-29665755 GTCAGGGGTCAGAGCGTCCGAGG + Intronic
1164680186 19:30129330-30129352 TTCAGGGCACAGGGAGTCCTGGG + Intergenic
1164960672 19:32426581-32426603 CTCAGGGAGCAGAGAGGCCTGGG + Intronic
1165698527 19:37919681-37919703 CTCAGGGCCCAAAGGGGCCTGGG - Intronic
1167072839 19:47230714-47230736 GTCTGGGCGCACAGGTGCCTCGG - Intronic
1168353374 19:55688571-55688593 GGCAGGGCTCAGAGGTTGCTGGG + Intronic
1168686638 19:58353049-58353071 GTCAAGGTGCACAGGCTCCTGGG + Exonic
925429452 2:3778487-3778509 ACCAGGGAGCAGAGGGCCCTGGG + Intronic
926155772 2:10453237-10453259 GGCAGGCCTCAGAGGGTCCTGGG - Intergenic
927027091 2:19079579-19079601 GTCAGGGAACTGAGGGTCTTTGG - Intergenic
927826696 2:26314372-26314394 GTCAGGGGTCAGAGGGACCAGGG - Intronic
931447877 2:62342016-62342038 CTCAGGAAGCAGAGGCTCCTGGG - Intergenic
933559671 2:83874687-83874709 ACCAGGGCGGAGAGGGTCGTAGG + Intergenic
936144313 2:109969468-109969490 GTTGGGAAGCAGAGGGTCCTGGG - Intergenic
936180995 2:110267428-110267450 GTTGGGAAGCAGAGGGTCCTGGG - Intergenic
936200376 2:110402001-110402023 GTTGGGAAGCAGAGGGTCCTGGG + Intergenic
937376320 2:121338319-121338341 GGCAGGGTGCAGCCGGTCCTCGG - Exonic
942292497 2:174486749-174486771 GCCAGGGCGCAGAGGGTCGGCGG + Intronic
947627318 2:231628109-231628131 TGCAGGGCTCAGAAGGTCCTGGG + Intergenic
1169197728 20:3692502-3692524 CTCTGTGAGCAGAGGGTCCTTGG - Exonic
1170776719 20:19381003-19381025 GTCAGGGGGCAAAGGGTGGTAGG + Intronic
1171544576 20:25990457-25990479 GTCAGGGAGCCGAGGGGACTGGG + Intergenic
1174138662 20:48397999-48398021 GTCCAGGGGCAGAGGGTCCAGGG - Intergenic
1174180887 20:48673573-48673595 GTCAGAGCCCAGAGGAGCCTGGG - Intronic
1175190799 20:57211098-57211120 GTCAGGGTGCTGAGGGCCCCCGG - Intronic
1175895877 20:62335389-62335411 GTCAGGGTGCAGGGGCTCCTGGG - Intronic
1175970943 20:62686545-62686567 GTCTGGGGTCAGAGGGCCCTCGG - Intergenic
1176242523 20:64081645-64081667 GTCAGGGCGCAGAGGGTCCTGGG - Intronic
1180755975 22:18161492-18161514 GGCAGGGTGCAGAGGGGCCAAGG + Intronic
1180918565 22:19506402-19506424 GTCAGGGAGCTGAGGATGCTGGG + Intronic
1180979322 22:19871359-19871381 GCCCGGGCGCAGAGGGACATGGG + Intergenic
1181075793 22:20375911-20375933 GGCAGGGTGCAGAGGGGCCAAGG - Intronic
1181689253 22:24549270-24549292 GCAAGGGTGCAGAGGGTGCTAGG - Intronic
1182075854 22:27495036-27495058 GGCAGGGCCCAGGGGGACCTGGG - Intergenic
1183467022 22:37984916-37984938 GTGAAGGCGGTGAGGGTCCTGGG + Intronic
1183544318 22:38447526-38447548 CTCACAGGGCAGAGGGTCCTGGG + Intronic
1184071888 22:42151860-42151882 GACAGGAGGCACAGGGTCCTTGG + Intergenic
952963250 3:38605911-38605933 GTGAGGGCTTAGAGGCTCCTCGG + Intronic
953626918 3:44579310-44579332 CTCAGGGCGCAGGGGCTCGTGGG + Intronic
959689721 3:109185795-109185817 CTCAGGGAGCAGAGGATGCTGGG + Intergenic
961037987 3:123656205-123656227 GTCAAGGCCCAGAAGGGCCTGGG + Intronic
961370362 3:126424876-126424898 GGCTGGGCGAAGAGGGTCCCAGG + Intronic
961818407 3:129563064-129563086 GGCAGGGCGGGGAGGGTCCCAGG - Intronic
962069434 3:132017849-132017871 ATCAGGGCTCAGAGGCTCCACGG + Intronic
966905820 3:184525470-184525492 GCCAGAGCCCAGAGAGTCCTCGG + Intronic
968360125 3:198140817-198140839 GTCACGGCCCAGAGGACCCTAGG - Intergenic
968463093 4:735685-735707 GCCATGGAGCAGATGGTCCTGGG + Intronic
968472191 4:787227-787249 GGCAGCCGGCAGAGGGTCCTGGG + Intronic
968570299 4:1336832-1336854 GACAGAGAGCAGAGGGTCCTGGG - Intronic
969737109 4:8999439-8999461 CTCAGGGAGTAGAGGGGCCTAGG + Intergenic
969796301 4:9531027-9531049 CTCAGGGAGTAGAGGGGCCTAGG + Intergenic
969973255 4:11070210-11070232 GTCAGGAGGCAGAGAGACCTGGG + Intergenic
973037505 4:45424269-45424291 GTCAGGGCTCAGACTCTCCTTGG + Intergenic
981969768 4:150653477-150653499 GTCAGAGGCCAGAGGGTCCTGGG - Intronic
984892163 4:184503826-184503848 GTGAGGGCCCAGAGGTGCCTTGG + Intergenic
985587653 5:749188-749210 TTTAGGGTGCAGAGGGTCCAGGG - Intronic
985695571 5:1338273-1338295 GTCAGTGCGCAGAGGGCCCTGGG - Intronic
985707036 5:1407397-1407419 GTCTGGGGGCCGAGGGGCCTTGG - Intronic
989290648 5:39761184-39761206 GTCAGTGCACAAAGGATCCTGGG - Intergenic
990603718 5:57386311-57386333 GCCAGGGAGCAGAGAGTCCTGGG + Intergenic
995462750 5:112420005-112420027 GCCAGGCCGCAGAGGCTCCGGGG + Intergenic
1001245750 5:170105015-170105037 AAGAGGGCGCAGAGGGGCCTGGG - Intergenic
1003569624 6:7247419-7247441 GCCAGGCAGGAGAGGGTCCTTGG + Intronic
1004921561 6:20380989-20381011 GTCAGGGCACATAGAGTTCTAGG - Intergenic
1005011547 6:21340541-21340563 GTAAGGGCTCAGATGTTCCTGGG + Intergenic
1006153384 6:32001235-32001257 GTGAGGGGGCAGAGAGCCCTGGG + Intronic
1006159692 6:32033972-32033994 GTGAGGGGGCAGAGAGCCCTGGG + Intronic
1006295325 6:33167584-33167606 GGCAGGGGGCAGAGGGTCCAAGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006580208 6:35072723-35072745 GCCAGGAGGGAGAGGGTCCTGGG + Intronic
1007266032 6:40596565-40596587 GTCAGGGAGCACAGAATCCTGGG + Intergenic
1012446005 6:99307635-99307657 GTCAGGGGTCAGAGGGCCCCAGG + Intronic
1012495705 6:99831387-99831409 GTTAGGGCCCAAGGGGTCCTTGG - Intergenic
1017674071 6:156795736-156795758 GGAAGGGCGCAGAGGGTCTCGGG - Intronic
1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG + Intergenic
1026300073 7:69090044-69090066 GACAGGGCGCAGTGGTTCTTAGG + Intergenic
1030615435 7:111733584-111733606 GTCAGGAGGAAGAGGGTCCTAGG - Intronic
1035183539 7:157108290-157108312 ATCAAGGCGCAAAGGGTCCCTGG - Intergenic
1035446854 7:158949036-158949058 CTCAGGGCGCAGAGGCTGCCCGG - Intronic
1037924145 8:22831625-22831647 GTTACAGCACAGAGGGTCCTTGG - Intronic
1047509992 8:125508728-125508750 GTGAGGCCCCAGAGGGACCTGGG - Intergenic
1047922926 8:129654008-129654030 CTCAGTGCTCAGAGGGTCTTGGG - Intergenic
1049292710 8:141812980-141813002 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292718 8:141813004-141813026 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292775 8:141813165-141813187 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292799 8:141813235-141813257 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292863 8:141813417-141813439 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292949 8:141813644-141813666 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1050774140 9:9238901-9238923 GGAAGTACGCAGAGGGTCCTAGG - Intronic
1052820654 9:33135681-33135703 GTCAGAGCGGGGAGGGTCCTGGG - Intronic
1052995749 9:34550937-34550959 CTCAGAGCACAGAGTGTCCTGGG - Intergenic
1057129325 9:92642140-92642162 GTCAGTCCGCAGTGGGGCCTGGG - Intronic
1057758062 9:97853053-97853075 GTCAGGGCGGGGAGGGCGCTTGG - Intergenic
1058622553 9:106898678-106898700 GTCAGGGTGGAGAGAGTCATAGG + Intronic
1058687154 9:107489177-107489199 GTGGGGGCCCAGAAGGTCCTCGG + Exonic
1060334242 9:122706364-122706386 GTCATGGCTCAAAGGGTCCTAGG - Intergenic
1060800857 9:126545245-126545267 GTCAGGGGGCATAGGGTTCAAGG - Intergenic
1060961599 9:127684681-127684703 GTCAGAGCCCAGAGGGTTCATGG - Intronic
1061422179 9:130478380-130478402 GGCAGGCTGCGGAGGGTCCTGGG + Intronic
1061451997 9:130672616-130672638 CTCAGGGCTCAGATGGGCCTAGG - Intronic
1061456390 9:130701102-130701124 GTCAGGGTTCACAGGGTCATGGG + Intronic
1061804033 9:133128304-133128326 GACAGGGCGCAGAGGGGCTGCGG + Intronic
1062247061 9:135574550-135574572 CTCAGGGTTCAGCGGGTCCTGGG + Intergenic
1062270182 9:135704695-135704717 ATCAGGGCCTAGAGGGTCCCAGG - Intronic
1062459343 9:136656414-136656436 ATCAGGGCGTGGAGGGTCTTGGG - Intergenic
1062538307 9:137030462-137030484 TTCAGGGTGGGGAGGGTCCTCGG + Exonic
1062708052 9:137956079-137956101 GTCAGGGCACAGAAGGGACTTGG - Intronic
1062744828 9:138204645-138204667 GTCACGGCCCAGAGGACCCTAGG - Intergenic
1188004067 X:25005431-25005453 TTCAGGGCGCAGAAAGTCCCGGG - Intronic
1191251427 X:58261932-58261954 GGCCTGGCGCAGAGGGTGCTGGG - Intergenic
1192539280 X:71954650-71954672 GTCAGGGCGCAGAAGGCAATGGG - Intergenic
1192726496 X:73758728-73758750 ATCAGGAAGCAGAGGGTCCTTGG - Intergenic
1193885537 X:86981470-86981492 GCCATGGCTCAGAGGGCCCTAGG - Intergenic
1196789614 X:119452087-119452109 GTGAAGGCCCAGGGGGTCCTGGG + Exonic