ID: 1176243140

View in Genome Browser
Species Human (GRCh38)
Location 20:64084220-64084242
Sequence TCCTCCCTCCGCAGGGCGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 226}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176243140_1176243147 -9 Left 1176243140 20:64084220-64084242 CCTCCCGCCCTGCGGAGGGAGGA 0: 1
1: 1
2: 0
3: 23
4: 226
Right 1176243147 20:64084234-64084256 GAGGGAGGAGGGCGTCCCGTCGG 0: 1
1: 0
2: 1
3: 24
4: 192
1176243140_1176243149 -2 Left 1176243140 20:64084220-64084242 CCTCCCGCCCTGCGGAGGGAGGA 0: 1
1: 1
2: 0
3: 23
4: 226
Right 1176243149 20:64084241-64084263 GAGGGCGTCCCGTCGGTGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 48
1176243140_1176243157 27 Left 1176243140 20:64084220-64084242 CCTCCCGCCCTGCGGAGGGAGGA 0: 1
1: 1
2: 0
3: 23
4: 226
Right 1176243157 20:64084270-64084292 ACCGGGCCCTGCCCGCCCCTCGG 0: 1
1: 0
2: 2
3: 24
4: 305
1176243140_1176243151 3 Left 1176243140 20:64084220-64084242 CCTCCCGCCCTGCGGAGGGAGGA 0: 1
1: 1
2: 0
3: 23
4: 226
Right 1176243151 20:64084246-64084268 CGTCCCGTCGGTGCCGGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 86
1176243140_1176243148 -3 Left 1176243140 20:64084220-64084242 CCTCCCGCCCTGCGGAGGGAGGA 0: 1
1: 1
2: 0
3: 23
4: 226
Right 1176243148 20:64084240-64084262 GGAGGGCGTCCCGTCGGTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 74
1176243140_1176243155 10 Left 1176243140 20:64084220-64084242 CCTCCCGCCCTGCGGAGGGAGGA 0: 1
1: 1
2: 0
3: 23
4: 226
Right 1176243155 20:64084253-64084275 TCGGTGCCGGGGCTGGCACCGGG 0: 1
1: 0
2: 3
3: 14
4: 217
1176243140_1176243150 -1 Left 1176243140 20:64084220-64084242 CCTCCCGCCCTGCGGAGGGAGGA 0: 1
1: 1
2: 0
3: 23
4: 226
Right 1176243150 20:64084242-64084264 AGGGCGTCCCGTCGGTGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 54
1176243140_1176243154 9 Left 1176243140 20:64084220-64084242 CCTCCCGCCCTGCGGAGGGAGGA 0: 1
1: 1
2: 0
3: 23
4: 226
Right 1176243154 20:64084252-64084274 GTCGGTGCCGGGGCTGGCACCGG 0: 1
1: 0
2: 1
3: 31
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176243140 Original CRISPR TCCTCCCTCCGCAGGGCGGG AGG (reversed) Exonic