ID: 1176243807

View in Genome Browser
Species Human (GRCh38)
Location 20:64087906-64087928
Sequence CTCCCACGGAGGAGAACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176243807_1176243819 17 Left 1176243807 20:64087906-64087928 CCACCAGTTCTCCTCCGTGGGAG 0: 1
1: 0
2: 1
3: 20
4: 158
Right 1176243819 20:64087946-64087968 CTGGGCCCCTGCCAACCCCAGGG 0: 1
1: 0
2: 1
3: 51
4: 436
1176243807_1176243818 16 Left 1176243807 20:64087906-64087928 CCACCAGTTCTCCTCCGTGGGAG 0: 1
1: 0
2: 1
3: 20
4: 158
Right 1176243818 20:64087945-64087967 GCTGGGCCCCTGCCAACCCCAGG 0: 1
1: 0
2: 6
3: 54
4: 397
1176243807_1176243813 -7 Left 1176243807 20:64087906-64087928 CCACCAGTTCTCCTCCGTGGGAG 0: 1
1: 0
2: 1
3: 20
4: 158
Right 1176243813 20:64087922-64087944 GTGGGAGCGTTTCTGGGTCCAGG 0: 1
1: 0
2: 0
3: 16
4: 312
1176243807_1176243814 -6 Left 1176243807 20:64087906-64087928 CCACCAGTTCTCCTCCGTGGGAG 0: 1
1: 0
2: 1
3: 20
4: 158
Right 1176243814 20:64087923-64087945 TGGGAGCGTTTCTGGGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 169
1176243807_1176243816 -1 Left 1176243807 20:64087906-64087928 CCACCAGTTCTCCTCCGTGGGAG 0: 1
1: 0
2: 1
3: 20
4: 158
Right 1176243816 20:64087928-64087950 GCGTTTCTGGGTCCAGGGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 168
1176243807_1176243815 -2 Left 1176243807 20:64087906-64087928 CCACCAGTTCTCCTCCGTGGGAG 0: 1
1: 0
2: 1
3: 20
4: 158
Right 1176243815 20:64087927-64087949 AGCGTTTCTGGGTCCAGGGCTGG 0: 1
1: 0
2: 1
3: 17
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176243807 Original CRISPR CTCCCACGGAGGAGAACTGG TGG (reversed) Intronic
900532744 1:3162731-3162753 CTGCCACACAGGAGGACTGGAGG - Intronic
900659703 1:3776365-3776387 CTCCCACGGAGGAAAGCAGCCGG - Intergenic
901029131 1:6296373-6296395 GTACCAGGGATGAGAACTGGGGG - Intronic
901738050 1:11324762-11324784 CCCCCACACAGGAGAACTGTTGG + Intergenic
902859342 1:19233686-19233708 CTCCAATGGAGGAGATTTGGAGG - Intronic
904958044 1:34305005-34305027 GTTCCACTGAGGAAAACTGGAGG - Intergenic
907535667 1:55153500-55153522 CTCCCATAAAGGAGAAATGGAGG - Intronic
908124100 1:61013279-61013301 CTCCCAAGGAGTGGGACTGGGGG - Intronic
912366626 1:109139004-109139026 CTTCCTAGGAGGAGAACTAGGGG - Intronic
915586882 1:156848780-156848802 CTACCACGGAGTACAACTTGCGG + Intronic
915772677 1:158445318-158445340 CTTCCACTGAGGAGATCTTGAGG + Intergenic
919768992 1:201145175-201145197 CTCCTAGGTAGGAGGACTGGGGG + Intronic
919913731 1:202127734-202127756 CTCCCAGAGAGGAGACCTGTGGG - Exonic
922556682 1:226537880-226537902 CTCCCATGGAGGAGTACAAGAGG - Intergenic
924194418 1:241590868-241590890 CTGCCCCCGAGGAGAACAGGAGG + Intronic
1063595967 10:7435955-7435977 CTCCCACTGAGGAGACAGGGTGG + Intergenic
1065696619 10:28386484-28386506 CTCACACAGTGAAGAACTGGAGG - Intergenic
1067568447 10:47354453-47354475 CTCCCAGGGAGGAGAAGCAGTGG - Intronic
1069888138 10:71636793-71636815 CTCCCACAGTGGAGAAACGGAGG + Intronic
1070945638 10:80389311-80389333 CTCTTAAAGAGGAGAACTGGAGG - Intergenic
1072828225 10:98630101-98630123 CTCCCACAGGGGAGCAATGGGGG - Intronic
1076269012 10:129134176-129134198 CTCCCATGGCAGAGACCTGGAGG + Intergenic
1076362701 10:129900603-129900625 CTCAAAGTGAGGAGAACTGGAGG - Intronic
1076445913 10:130513623-130513645 CTGCCACGGATCAGAACTGGGGG + Intergenic
1077032698 11:476753-476775 CTCCCACTGGGCAGGACTGGGGG + Intronic
1077081606 11:726881-726903 CTTCTAGGGAGGAGAAATGGGGG - Exonic
1077144800 11:1040070-1040092 GTCCCCTGGAGGAGAACAGGTGG + Intergenic
1078105144 11:8353695-8353717 CTTCCTCGGAGGAGGCCTGGGGG + Intergenic
1081891681 11:46547860-46547882 CTCCCAGAGAGTAGAACTGCCGG - Exonic
1082850031 11:57756043-57756065 CTCCCACTGAGGCCAACTGGAGG + Intronic
1083970232 11:66070141-66070163 CTCCCGCGGAGTAGAAGGGGTGG - Intergenic
1084939906 11:72606993-72607015 CGCCCAGGGAGGAGAGCTGCTGG - Intronic
1089069300 11:115687096-115687118 CTCCCAGTGAGGAAAAGTGGGGG + Intergenic
1090471465 11:126984844-126984866 AACCCAGGGAGGAGACCTGGAGG + Intronic
1097192326 12:57225438-57225460 CTCCCTCGGGGGCGCACTGGCGG + Exonic
1098635822 12:72782084-72782106 CTCCCACTTATGAGAACAGGTGG - Intergenic
1099128764 12:78799930-78799952 CTCCCTTGGAGGAGAATAGGTGG + Intergenic
1103901740 12:124307001-124307023 CTCCCACGGGGGACAGCAGGTGG - Intronic
1104676478 12:130715183-130715205 CTCTCACGGAGGAGCCCTGAAGG - Intronic
1109346372 13:61119054-61119076 CCCACATAGAGGAGAACTGGCGG + Intergenic
1113773406 13:112927436-112927458 TTCCCACTGAGAAGATCTGGAGG + Intronic
1117448008 14:55823305-55823327 CTCCCAAGCAGGTGAACTGCGGG - Intergenic
1117610960 14:57483024-57483046 CTGACAGGGAGGTGAACTGGGGG - Intronic
1118877579 14:69797860-69797882 GTCCCAGGGAGGAATACTGGTGG + Intergenic
1121453288 14:94022984-94023006 GTCCCAGGGAGCAGAGCTGGGGG - Intergenic
1124631318 15:31339123-31339145 CTCCTACACAGCAGAACTGGAGG + Intronic
1130152073 15:81318907-81318929 CTCCCGCGTAGAAGAATTGGAGG + Intronic
1130932938 15:88443654-88443676 GTCCCATGGGGGAGAACTGGTGG - Intergenic
1131832259 15:96361360-96361382 CTCCCCCAGAGGAGAAAGGGGGG - Intergenic
1132733587 16:1375007-1375029 CTTCCAGGGAGGAGAAGCGGAGG - Intronic
1133199222 16:4192302-4192324 CTCCCATGTAGGAGCACTGCTGG + Exonic
1133850667 16:9500381-9500403 CTACCACTGAGGAGCACTGGAGG - Intergenic
1134086721 16:11362383-11362405 CTCCCAGGGATGAGCAATGGTGG - Intronic
1134683672 16:16144023-16144045 CTCCCACTGTGGGGACCTGGAGG - Intergenic
1137488332 16:48909975-48909997 GTCCCACAAAGGAAAACTGGGGG + Intergenic
1141360865 16:83394011-83394033 CTCCCACTTACGAGAACAGGCGG - Intronic
1144775629 17:17783264-17783286 CTTCGCCGGCGGAGAACTGGCGG + Intronic
1146757619 17:35447630-35447652 ACCCCACTGAGGAAAACTGGTGG + Intronic
1146948353 17:36889200-36889222 TTCCCAGGGTGAAGAACTGGAGG - Intergenic
1146985343 17:37211076-37211098 CTCCCATGAAGGAGAGCAGGGGG + Intronic
1148785067 17:50142239-50142261 CTCCCAGGGAGGTGGAGTGGAGG - Intronic
1150930668 17:69581407-69581429 CTCTCCCGGAGGTGAACTGCTGG + Intergenic
1151450463 17:74195597-74195619 CTACCACGGAGGAGAGGAGGGGG - Intergenic
1153458019 18:5299606-5299628 CTCCTATGGATCAGAACTGGTGG + Intergenic
1160782705 19:884900-884922 CACCCACGGGGGAGATCTGCTGG + Exonic
1161073414 19:2273605-2273627 CTCCCACGGAGGAGACCCCCTGG + Intronic
1162410628 19:10503098-10503120 CCCCTACGGAGGCGACCTGGGGG - Intronic
1162441650 19:10696019-10696041 CGCCCACTTAGGAGAGCTGGGGG - Intergenic
1163057498 19:14731525-14731547 CCCCCACGGTGGAGAGCTGGAGG + Intronic
1163183126 19:15618004-15618026 CTCCCACAGAGGAGGGCTTGAGG + Exonic
1163875368 19:19863267-19863289 CTGCCAAGGGGGAGAAGTGGGGG + Intergenic
1163885288 19:19959892-19959914 TTGCCATGGGGGAGAACTGGTGG - Intergenic
1163981306 19:20902901-20902923 CTCCCACGGTGGTGAATTAGTGG - Intergenic
1164761763 19:30733451-30733473 CTCCCAGGGAGGAGCAAAGGTGG - Intergenic
1166979533 19:46624351-46624373 CGCACACACAGGAGAACTGGGGG - Intronic
1168726204 19:58583450-58583472 ATCCCACGATGGAGGACTGGGGG + Intergenic
925612917 2:5718212-5718234 CTCCCAGGAAGGAGCGCTGGTGG - Intergenic
925731474 2:6922117-6922139 CTCCCACCAGGTAGAACTGGAGG - Intronic
929768200 2:44868485-44868507 CTCCAAGGGAGCAGAACTGAGGG - Intergenic
933888251 2:86740262-86740284 CTTCCACGGACGAGGGCTGGGGG - Intronic
933921927 2:87056444-87056466 CTTCCACGGACGAGGGCTGGGGG + Intergenic
934789681 2:97048156-97048178 CTCCCTCTGAGGAGAACTAGTGG - Intergenic
934816785 2:97334383-97334405 CTCCCTCTGAGGAGAACTAGTGG + Intergenic
934820911 2:97374101-97374123 CTCCCTCTGAGGAGAACTAGTGG - Intergenic
936615176 2:114041071-114041093 CTCCCACGTGGGAAACCTGGGGG - Intergenic
936836593 2:116717877-116717899 TTGCCAAGGAGGAGAACTGGGGG - Intergenic
937015116 2:118597927-118597949 CTTCCATGGAGGAGAAATGGAGG - Intergenic
937217932 2:120324448-120324470 CTCCCAGGGAGTAAAACTGAAGG - Intergenic
941572801 2:167192843-167192865 ATGCTACGGAGGAAAACTGGAGG - Intronic
944228760 2:197372745-197372767 GTCCCACGGTGGGGAAGTGGTGG - Intergenic
948112599 2:235468765-235468787 CTCCCAGTGAGTAGAACTGGTGG + Intergenic
1169190829 20:3658404-3658426 CTGCCAGTGAGGAGAGCTGGAGG + Intergenic
1171209489 20:23305784-23305806 CTCTTACGCAGGAGAATTGGGGG + Intergenic
1172221993 20:33280457-33280479 CTCCCAGGGAGGAGGGCAGGAGG - Intronic
1172696124 20:36824170-36824192 ATCCCAGGGAGTAGAACTGCAGG - Intronic
1172786491 20:37472219-37472241 TTCCCACCCAGGAGACCTGGTGG - Intergenic
1173306540 20:41856042-41856064 AACCCACACAGGAGAACTGGAGG - Intergenic
1174667807 20:52276535-52276557 CTCCCACTGAGAAGCACTGGAGG - Intergenic
1176243807 20:64087906-64087928 CTCCCACGGAGGAGAACTGGTGG - Intronic
1178935261 21:36856302-36856324 CTCACATGGAAGAGAACTGGAGG + Intronic
1179032668 21:37734272-37734294 CTCCCACGGGGGAGGAATTGAGG + Intronic
1180035532 21:45246243-45246265 CTCCCACGGACGTGAGCTGAGGG + Intergenic
1182860282 22:33553874-33553896 CTCTCACGGAGGTGAGCTGGAGG - Intronic
1183583615 22:38739667-38739689 CTCCCAGGGAGGAGAGCTGTGGG + Intronic
1183832284 22:40424699-40424721 CTCCCAGGGAGGAGCAAGGGAGG - Intronic
1184759998 22:46538438-46538460 CTCCTACGGAGGACAGCGGGGGG + Intergenic
1185150552 22:49161440-49161462 CTCCCCTGAAGGAAAACTGGGGG - Intergenic
954083216 3:48224495-48224517 CTCCCAAGGAGCTGAACAGGGGG + Intronic
954614758 3:51964018-51964040 CACCCGCGGAGGTGAGCTGGAGG - Intronic
957595003 3:82252342-82252364 CTCCCCTGCAGGAGAAATGGAGG + Intergenic
957672802 3:83327509-83327531 CTCCCACGTATGAGAACGTGCGG - Intergenic
962734704 3:138315628-138315650 ATTCTAGGGAGGAGAACTGGTGG - Intronic
962825088 3:139094147-139094169 CTCCCAAGGAGAACAACTGGGGG - Intronic
963020004 3:140863758-140863780 CCCCCAGGGAGCAGAAGTGGAGG + Intergenic
963718483 3:148832570-148832592 CTACCACAGAGGACAACTGGCGG + Intronic
966871183 3:184291409-184291431 ATCCCACGAAGAAGAGCTGGTGG - Exonic
968377382 4:54453-54475 CTCCCCGGAAGGAGACCTGGAGG - Intronic
968384722 4:125650-125672 CTCCCCGGGAGGAGGCCTGGAGG - Intronic
968393728 4:213788-213810 CTACCCGGGAGGAGACCTGGAGG - Intergenic
968401721 4:304309-304331 CTCCCCGGAAGGAGACCTGGAGG + Intronic
968405943 4:338964-338986 CTCCCCGGGAGGAGACCTGGAGG - Intronic
968410713 4:387288-387310 CTCCCTCGGAGGAGACCTGGAGG - Intergenic
968956949 4:3724285-3724307 CTCCAGCCGAGGAGAGCTGGGGG + Intergenic
969799161 4:9549027-9549049 CTCCCCCGGGGGAGAGATGGAGG - Intergenic
970504057 4:16708824-16708846 CTCCCACTGAGGAGAAAAGCAGG - Intronic
973724771 4:53764299-53764321 CCCACCCGGAGGAGACCTGGAGG - Intronic
975720186 4:77241790-77241812 CTCTCACAGAGGAGCGCTGGAGG + Intronic
975754009 4:77553651-77553673 ATCCCAGGGAGGAGAAGGGGTGG - Intronic
976350139 4:84051625-84051647 TTCCCAGGGAGAAGCACTGGTGG + Intergenic
981079259 4:140622602-140622624 CTCCCTTGGAGGACAAATGGAGG - Exonic
981093694 4:140757439-140757461 CTCCCGCCCAGGAGATCTGGAGG + Intergenic
986164275 5:5259934-5259956 CCCCCAGGCAGGAGAAGTGGAGG - Intronic
986569923 5:9154282-9154304 CCTCCTCTGAGGAGAACTGGTGG + Intronic
986952896 5:13112619-13112641 ATCCCACGGAGGTGATCTGAAGG - Intergenic
989198678 5:38741737-38741759 CTCCCAGAGATGAAAACTGGAGG - Intergenic
990890014 5:60637652-60637674 CTCCAACTGAGGAGAATTGGGGG - Intronic
992399959 5:76403158-76403180 CTCCCCCGGGGGAGAAGGGGCGG + Intergenic
996422906 5:123281449-123281471 CTTCCACTGGAGAGAACTGGTGG - Intergenic
997605189 5:135170202-135170224 CCCCCTCGAAGGAGAACTGCAGG - Intronic
998216686 5:140242963-140242985 CCCCCCTGGAGGGGAACTGGGGG - Intronic
998291747 5:140922580-140922602 CTTCAACTGATGAGAACTGGCGG - Intronic
999781991 5:154857543-154857565 CTCCCACCGCGGAGAACACGAGG + Intronic
1003124603 6:3346383-3346405 CACCCCAGGATGAGAACTGGGGG + Intronic
1003888368 6:10541238-10541260 CTCCCACGTATGAGAACATGCGG + Intronic
1006080020 6:31559652-31559674 TTCCCACGGAGGAGAGAGGGGGG + Intergenic
1010654647 6:78497646-78497668 CTCCCACTTAGGAGAACACGTGG + Intergenic
1010869911 6:81024781-81024803 ATCCTACAGTGGAGAACTGGAGG + Intergenic
1015591754 6:134829310-134829332 CTCCCAAGAAGTAGAAGTGGAGG + Intergenic
1015669071 6:135667172-135667194 ATCCCAGACAGGAGAACTGGAGG + Intergenic
1017847041 6:158267758-158267780 AACCCACGGAGGAAAACGGGAGG - Intronic
1019513331 7:1429208-1429230 CTTCCGGGGAGGAGAAGTGGGGG + Intronic
1019653026 7:2170878-2170900 CTCCCAAGGATGGGAACCGGAGG + Intronic
1021821886 7:24506592-24506614 GTGCCAGGGAGGAGATCTGGGGG + Intergenic
1022444965 7:30462503-30462525 CTCACACAGAGGACAACTGCTGG + Intronic
1024883702 7:54117243-54117265 CTACCATGGAGGACAACTGAAGG + Intergenic
1025236365 7:57237429-57237451 CTCCCTCTGCGGAGAACTCGGGG + Intergenic
1025253873 7:57370133-57370155 CACCCACAGGGGAGAGCTGGGGG + Intergenic
1026012040 7:66644141-66644163 CTCCCAGGGATGTGAACTGTGGG - Intronic
1028818156 7:95173273-95173295 CTCTAAAAGAGGAGAACTGGAGG + Intronic
1031665440 7:124477723-124477745 CATCCAGGGAGGGGAACTGGGGG - Intergenic
1031986337 7:128166924-128166946 CCTCCAGGGAGGAGGACTGGGGG - Intergenic
1033601576 7:142892500-142892522 CTCACAGGGAGGAGAACTTGGGG - Intergenic
1034196517 7:149252484-149252506 CTCTAATGGAGGAGCACTGGAGG + Intronic
1035125910 7:156607661-156607683 CTGCCACGGAGGAGAAGCTGGGG + Intergenic
1035328340 7:158079777-158079799 CTCCCACGCAAGAGGAATGGGGG - Intronic
1037460296 8:19101808-19101830 CTTACATGGAGGAGCACTGGGGG - Intergenic
1039592038 8:38757317-38757339 CTCCCATGGCGCAGAACTTGGGG - Intronic
1053461533 9:38274985-38275007 ATCCCTTGGAGGAGAAATGGCGG - Intergenic
1056297605 9:85208095-85208117 CCCTCATGGAGGAGCACTGGGGG - Intergenic
1058833460 9:108839840-108839862 CTCCCACTTAGGAGAACATGTGG - Intergenic
1058935699 9:109767581-109767603 CTCCCAAGGCCGAGATCTGGTGG + Intronic
1059530758 9:115033316-115033338 CCCCCAGGGACTAGAACTGGGGG - Intronic
1061563236 9:131420015-131420037 CACCCCCAGTGGAGAACTGGGGG - Intronic
1203571854 Un_KI270744v1:139793-139815 CTCCCCGGAAGGAGACCTGGAGG + Intergenic
1187900924 X:24025800-24025822 TTCCCACCGAGGAAAACAGGCGG + Intronic
1195290191 X:103424658-103424680 CCCGCAGGGAGGACAACTGGTGG + Intergenic
1198935852 X:141902724-141902746 CTCCCAGGGATGACAACAGGTGG - Intergenic
1201729252 Y:17187489-17187511 TTCCCAGGGAGCAGAACTAGTGG - Intergenic
1202182384 Y:22150660-22150682 CCTCCACGGAGGAGCATTGGGGG - Intergenic
1202208976 Y:22435742-22435764 CCTCCACGGAGGAGCATTGGGGG + Intergenic