ID: 1176244636

View in Genome Browser
Species Human (GRCh38)
Location 20:64091566-64091588
Sequence TGTCGAGAGCTGGCCGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 291}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176244630_1176244636 4 Left 1176244630 20:64091539-64091561 CCGCTTGTTTACGACGAAGCTTT 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1176244629_1176244636 5 Left 1176244629 20:64091538-64091560 CCCGCTTGTTTACGACGAAGCTT 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1176244625_1176244636 30 Left 1176244625 20:64091513-64091535 CCGTGTCCTGGACCCAAGCATCT 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1176244626_1176244636 24 Left 1176244626 20:64091519-64091541 CCTGGACCCAAGCATCTTACCCG 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1176244628_1176244636 17 Left 1176244628 20:64091526-64091548 CCAAGCATCTTACCCGCTTGTTT 0: 1
1: 0
2: 0
3: 0
4: 89
Right 1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG 0: 1
1: 0
2: 0
3: 25
4: 291
1176244627_1176244636 18 Left 1176244627 20:64091525-64091547 CCCAAGCATCTTACCCGCTTGTT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG 0: 1
1: 0
2: 0
3: 25
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176244636 Original CRISPR TGTCGAGAGCTGGCCGGGTG GGG Intronic
900074436 1:801704-801726 TGTGGAAAGGTGGCCAGGTGCGG - Intergenic
900097003 1:943884-943906 TGCAGAGAGATGGCCTGGTGGGG - Intronic
900240097 1:1612483-1612505 GGTGGAGGGCTGGCTGGGTGTGG + Intergenic
900486555 1:2925390-2925412 TGGAGAGAGCCTGCCGGGTGAGG - Intergenic
900678783 1:3904578-3904600 TGCCCTGACCTGGCCGGGTGGGG - Intergenic
901039702 1:6356483-6356505 TGTCCAGGGCTGGCCAGGTGTGG - Intronic
901184454 1:7363780-7363802 TGTGGTTAGCTGGCCAGGTGAGG + Intronic
901200387 1:7463719-7463741 CGTAGAGAGCTGGCCGGGAAGGG + Intronic
901553687 1:10015055-10015077 TGTTGAGAGTAGGCCAGGTGTGG + Intronic
901660306 1:10794894-10794916 TGGCGGGGGCTGGCCGGGCGCGG - Intronic
901704933 1:11066469-11066491 AATCCAGAGCCGGCCGGGTGCGG - Intergenic
901826699 1:11866640-11866662 TGTTGAAATCTGGCTGGGTGTGG - Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902305277 1:15533205-15533227 TCTCCAAAGCTGGCCGGGTGTGG + Intronic
903547175 1:24132708-24132730 TGTCTTAAGTTGGCCGGGTGCGG + Intronic
903565238 1:24260220-24260242 GTTCTAGAGCTGGCCGGGCGCGG + Intergenic
903801357 1:25970878-25970900 TGTAGTGCCCTGGCCGGGTGTGG - Intronic
904493824 1:30875935-30875957 TGTGGAGGGCTGCCTGGGTGTGG - Intronic
904774000 1:32895735-32895757 TGTCCAGCGCTGGACGGGGGAGG + Exonic
905128603 1:35734387-35734409 TGTAGAAAACCGGCCGGGTGCGG + Intronic
905774993 1:40662712-40662734 AGTCTAGAGCTGGCAGGGGGAGG - Intronic
906454838 1:45985382-45985404 GGTCGAAAGCTGGCTGGGTGCGG - Intronic
906500711 1:46340350-46340372 TTTCGGGACCTGGCCGGGCGTGG - Exonic
907352566 1:53844871-53844893 AATCAAGAACTGGCCGGGTGCGG - Intergenic
908259948 1:62332475-62332497 TGTCTAGAGCTGGAAGAGTGTGG + Intergenic
910444504 1:87286553-87286575 AGTGGAGAATTGGCCGGGTGTGG + Intergenic
911033235 1:93511674-93511696 AGTCAAGACCCGGCCGGGTGCGG + Intronic
915233072 1:154460282-154460304 TGTCCAGAGCTGGCCTGGATGGG - Intronic
916797643 1:168181500-168181522 TATGGAGAGGAGGCCGGGTGCGG - Intronic
917291501 1:173476826-173476848 TGTAGGGAGCTGGCCGCGAGTGG + Intergenic
917869577 1:179229538-179229560 TGCCGTGAGGAGGCCGGGTGCGG - Exonic
918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG + Intronic
920132050 1:203739810-203739832 TGTAGAGAGCTGTCCGACTGGGG - Exonic
922270283 1:224026608-224026630 TGTGGAAAGGTGGCCAGGTGCGG - Intergenic
922496578 1:226062421-226062443 GGGCGGGGGCTGGCCGGGTGCGG + Intronic
922922560 1:229318848-229318870 AGTGCAGTGCTGGCCGGGTGTGG - Intergenic
924688699 1:246324122-246324144 GGTCTAAAACTGGCCGGGTGCGG + Intronic
1065385840 10:25132239-25132261 AGTCCAGAGATGGCCAGGTGCGG - Intergenic
1069036264 10:63648936-63648958 AGTGGAGAGGAGGCCGGGTGTGG + Intergenic
1069560965 10:69429101-69429123 GTTCCAGAGCTGGCTGGGTGCGG + Intergenic
1070622491 10:78024071-78024093 ACTGGAGAGCTGGCCGGGTGTGG + Intronic
1072959176 10:99913959-99913981 TGCCCAGAGCTGGCTGTGTGTGG + Intronic
1074325595 10:112447499-112447521 TGGGGAGAGCTGGGAGGGTGCGG + Intronic
1075712734 10:124539333-124539355 TGGACAGAGTTGGCCGGGTGAGG + Intronic
1075873186 10:125786016-125786038 TGTTTGGAGCTGGCAGGGTGGGG + Intronic
1076235861 10:128863440-128863462 AGTTGAGTGCAGGCCGGGTGCGG - Intergenic
1076658715 10:132041313-132041335 AGTGGAGAGCTGGCTGGGTCCGG + Intergenic
1077269473 11:1668617-1668639 TGGAGAGTGCTGGCCGGGCGCGG + Intergenic
1083858710 11:65407539-65407561 TGTAGATCTCTGGCCGGGTGCGG - Intronic
1084336355 11:68460292-68460314 GGTGGCGAGCTGGCCGGGCGGGG - Intergenic
1084738153 11:71119289-71119311 TCTCCAGCACTGGCCGGGTGCGG + Intronic
1085468451 11:76740060-76740082 TGTCGAGCACAGGCAGGGTGAGG + Intergenic
1085579980 11:77641690-77641712 CTCAGAGAGCTGGCCGGGTGTGG - Intergenic
1086389238 11:86344456-86344478 TGCTGAAAGCTGGCTGGGTGCGG - Intronic
1086932027 11:92704262-92704284 TGTCCAGAGCTGGGTGGATGGGG - Intronic
1088619645 11:111668911-111668933 TGTGGAGAGAGGGCAGGGTGTGG + Intronic
1089557984 11:119325845-119325867 TGTGTAAAGCTGGCTGGGTGCGG + Intergenic
1091125562 11:133092430-133092452 ACTCAAGAGCTGGCTGGGTGTGG + Intronic
1091631027 12:2161108-2161130 TAACCAGAGCTAGCCGGGTGCGG - Intronic
1091941952 12:4493800-4493822 TGTCTACAGCTGGCCGGGAGTGG + Intronic
1092369435 12:7904337-7904359 TGTTAATAGCAGGCCGGGTGCGG - Intergenic
1092424342 12:8362225-8362247 TGTCTAGAACTTGCCAGGTGTGG - Intergenic
1096452508 12:51756172-51756194 TGACGAGGGGTGGCCTGGTGAGG - Intronic
1096739960 12:53685847-53685869 TGACTACAGGTGGCCGGGTGCGG + Intergenic
1099155925 12:79175998-79176020 AGTACAGAGCGGGCCGGGTGTGG + Intronic
1100355155 12:93821825-93821847 TGTAGACAGCAGGCCAGGTGTGG + Intronic
1100617214 12:96240059-96240081 TGTCAAGTGCTGGCCGTGTTAGG + Intronic
1101099811 12:101380570-101380592 TGTAGAGGATTGGCCGGGTGTGG + Intronic
1103796018 12:123503709-123503731 TCTCAAGATCTGGCCGGGAGTGG + Intronic
1104278534 12:127352776-127352798 AGTAGAGAGATGGCTGGGTGTGG - Intergenic
1105289149 13:19036344-19036366 AGTAGAGAGCTGGTCAGGTGTGG + Intergenic
1105414163 13:20194120-20194142 TGTGCAGAGCAGGCTGGGTGGGG + Intergenic
1105495170 13:20924165-20924187 TGTAGAGACCAGGCCGGGAGCGG + Intergenic
1107466568 13:40655925-40655947 TGAGGAGAGCTGTCCGGGCGCGG - Intronic
1111119191 13:83823756-83823778 TGTCACGACCTGGCCGGGTGTGG + Intergenic
1111993094 13:95136443-95136465 AGTTGAGATCTGGCCGGGTACGG - Intronic
1115235125 14:31201994-31202016 AGTGGAGAGCCGGCCGGGCGCGG + Intronic
1115766910 14:36632401-36632423 TGTGGGGAGGTGGCCGGGCGCGG + Intergenic
1115863420 14:37714885-37714907 TATTGAGGGCTGGCCAGGTGTGG + Intronic
1117048504 14:51837147-51837169 AGTTGAGATCAGGCCGGGTGCGG - Intronic
1119039110 14:71256329-71256351 TGTTGATAACTGGCCTGGTGTGG + Intergenic
1119319144 14:73719115-73719137 TGACGCGAGCTGGCCGGCCGCGG - Exonic
1121100644 14:91247818-91247840 TGTATAGTGCTGGCTGGGTGAGG + Intronic
1121525348 14:94615534-94615556 TGTCTGGAGGTGGCCAGGTGGGG + Intronic
1121982481 14:98467030-98467052 TGCCGAGAGAGGGGCGGGTGTGG + Intergenic
1122295772 14:100704925-100704947 TGCAGAGGGCTGGCTGGGTGTGG + Intergenic
1122329605 14:100903702-100903724 TGCCGAGTGCTGGGGGGGTGTGG + Intergenic
1125035865 15:35122737-35122759 TGACTACAGTTGGCCGGGTGCGG + Intergenic
1128108443 15:65061178-65061200 TGTAGAGAGATGGCAAGGTGAGG + Intronic
1128390985 15:67182408-67182430 TGTAGAGAGATGGCAGAGTGAGG + Intronic
1130518544 15:84644865-84644887 TGTAGCAAGTTGGCCGGGTGCGG - Intronic
1130828917 15:87579762-87579784 TGTCTAGAGCTGGCGGGGGGAGG + Intergenic
1131186192 15:90276148-90276170 TGTCAATGACTGGCCGGGTGTGG + Exonic
1131563352 15:93463196-93463218 TATTCAGAGCTGGCCGGGCGTGG + Intergenic
1132273299 15:100544742-100544764 GGTCGAGGGATGCCCGGGTGCGG + Intronic
1134911369 16:18029736-18029758 TGCAGAGAACTGGCCTGGTGCGG + Intergenic
1137575926 16:49600397-49600419 TGGGGAGAGCTGCCCGAGTGAGG - Intronic
1137807216 16:51319001-51319023 TGCAGAGCCCTGGCCGGGTGCGG + Intergenic
1138665539 16:58564681-58564703 TGGCAAGAATTGGCCGGGTGTGG + Intronic
1139377803 16:66511372-66511394 TGGGGAGAGCTGGCAGTGTGCGG - Exonic
1139462712 16:67135434-67135456 AGGGGAGAGCTGGCCAGGTGCGG - Intronic
1139750424 16:69106416-69106438 GGCTGGGAGCTGGCCGGGTGCGG - Intronic
1140213056 16:72986045-72986067 TGTGGGGAGTTGGCGGGGTGGGG - Intronic
1140813783 16:78602520-78602542 TATCGAGAAGAGGCCGGGTGTGG - Intronic
1141596862 16:85102414-85102436 TGTGGAGGGCTGTCCGTGTGGGG + Intronic
1141636168 16:85315094-85315116 TGTCCAGGGCGGGCAGGGTGGGG - Intergenic
1141924458 16:87158716-87158738 GAACAAGAGCTGGCCGGGTGTGG + Intronic
1142520431 17:500774-500796 TGTCGCTAGCTGGCCGGGCGTGG - Intergenic
1142550709 17:737300-737322 ATTCTAGAGCTGGCCGGGTTCGG - Intronic
1142655754 17:1392557-1392579 TGTCTATATCTGGCCGGGTGCGG + Intronic
1142748582 17:1973746-1973768 TAAAAAGAGCTGGCCGGGTGTGG + Intronic
1145718589 17:27047130-27047152 TTTAAAGAGCTGGCCAGGTGCGG + Intergenic
1146069723 17:29668956-29668978 TGAGTAGAGCAGGCCGGGTGTGG + Intronic
1146208990 17:30927321-30927343 TGTCTAGAGCTGGCCAGGCACGG + Intronic
1146444993 17:32926677-32926699 TGACAAGAACAGGCCGGGTGCGG + Intergenic
1147556883 17:41485424-41485446 TGTCCAGAGCTGGCAGAGTTAGG + Intergenic
1147589495 17:41672706-41672728 TTTAAAGAGCTGGCCAGGTGAGG - Intergenic
1147760512 17:42794987-42795009 AGTGGAGAGCTGGTGGGGTGTGG - Exonic
1148885283 17:50767737-50767759 TGGAGGGAGCTGGCTGGGTGCGG + Intergenic
1150956450 17:69865640-69865662 TGTTTAGAGCTGGCCAGGTGTGG - Intergenic
1151082204 17:71342120-71342142 TGGCCAGAAATGGCCGGGTGTGG + Intergenic
1151500124 17:74482998-74483020 GGCCAGGAGCTGGCCGGGTGTGG - Intronic
1152071981 17:78138550-78138572 TGGCGAGAGATGGCCAAGTGGGG - Intronic
1152759618 17:82101125-82101147 TGTCAGGTGCTGGCAGGGTGGGG - Intergenic
1153292722 18:3517525-3517547 TGAAGAGAGTTGGCCGGGCGCGG + Intronic
1154470566 18:14696260-14696282 AGTAAAGAGCTGGCCAGGTGCGG - Intergenic
1157510044 18:48264679-48264701 TGGTGGGAGCTGGCCGGGTTAGG - Intronic
1160181581 18:76641428-76641450 TGGTGAGGGCTGGCTGGGTGGGG - Intergenic
1160860261 19:1234593-1234615 TTGGGAGAGGTGGCCGGGTGGGG + Exonic
1160991001 19:1860296-1860318 AGCCGAGAGCTGGCCGGGCTAGG + Intronic
1162955466 19:14095457-14095479 GGCCCAGAGTTGGCCGGGTGTGG - Intronic
1163041389 19:14605384-14605406 TGTGGGGAGGTGGCCGGGCGCGG - Intronic
1163306711 19:16484465-16484487 CATCGAGAGTTGGCCGGGCGTGG - Intronic
1164762542 19:30738675-30738697 TTTGGAGAACTGGCCTGGTGAGG + Intergenic
1165557844 19:36650939-36650961 TTCCTAGAGCTGGCCGGGCGTGG + Intronic
1165791593 19:38496051-38496073 TTCCTACAGCTGGCCGGGTGCGG - Intronic
1166144116 19:40822529-40822551 TAGCTAGAGCTGGCCGGGCGCGG + Intronic
1166183496 19:41124551-41124573 TAGCTAGAGCTGGCCGGGCGCGG - Intronic
1166542433 19:43614355-43614377 TGTGGAGAGCTGGCCGGGGAGGG - Exonic
1167111796 19:47466775-47466797 TGTTCATAGCAGGCCGGGTGCGG + Intronic
1167238816 19:48331098-48331120 AGTCCAGAACTAGCCGGGTGTGG - Intergenic
1168007253 19:53500683-53500705 AGTCCAGATATGGCCGGGTGTGG - Intergenic
925887058 2:8402120-8402142 TGTGGCAAGCTGGCCAGGTGAGG + Intergenic
927169932 2:20360890-20360912 TGTCCAAAGCTGGCTGGGCGTGG + Intergenic
927889678 2:26740536-26740558 TGCCGACAGCTGGCCTGGTCTGG - Intergenic
928424032 2:31163377-31163399 TGTGGAGGGCTGGCCAGGGGAGG + Intergenic
929488412 2:42375037-42375059 TGTGTAAATCTGGCCGGGTGCGG + Intronic
930493644 2:52109760-52109782 AGTAAAGAGCTGGCCGGGCGCGG + Intergenic
931655130 2:64504086-64504108 AGTAGAGATCAGGCCGGGTGTGG + Intergenic
932594212 2:73084082-73084104 TCTGGGGAGCTGGCCGGGAGAGG - Intronic
933353813 2:81190504-81190526 AGTCAATAGCTGGCCGGGGGCGG - Intergenic
934562401 2:95320106-95320128 AGGCTAGAGCTGGCTGGGTGTGG + Intronic
936937070 2:117848793-117848815 AGGTGAGAGCTGGCCGGGCGCGG + Intergenic
937335782 2:121061623-121061645 TGAGGCGAGTTGGCCGGGTGCGG - Intergenic
937417223 2:121725396-121725418 TGTCTATAGCTGGCTGGGGGTGG + Intergenic
939563213 2:143755683-143755705 TGTCTAAAACTGGCCAGGTGTGG + Intronic
940339208 2:152561866-152561888 GGTTGACAACTGGCCGGGTGTGG - Intronic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
942044209 2:172090073-172090095 TCTCAAGAGCTGGCTGGGTGTGG - Intergenic
944245362 2:197525053-197525075 AGTAGATAGCTGGCCGGGTGCGG + Intronic
947653365 2:231806257-231806279 TGTAGAAAACTGGCTGGGTGTGG + Intronic
947814968 2:233030636-233030658 TGTCCTCAGCTGGCCGGGCGTGG + Intergenic
948393488 2:237628063-237628085 TGGCCCGGGCTGGCCGGGTGGGG + Intronic
948451181 2:238074012-238074034 TGCAGGGAGCTGGCTGGGTGTGG + Intronic
948637464 2:239348705-239348727 TGTGGAGGGCTGGCCGGGCAAGG + Intronic
1169250649 20:4058290-4058312 TGTAGAGAGGTGGGCGGGGGGGG + Intergenic
1170692219 20:18625937-18625959 TCTCCAGAGCTGGCCCTGTGTGG - Intronic
1172058241 20:32169107-32169129 ACTCGTGAGCTGGCCGGGTGCGG + Intergenic
1172171882 20:32940961-32940983 TGTAGAAAGCTGGCCAGGTACGG + Intronic
1172520960 20:35565153-35565175 TGGTGAGCGCTGGCCGGGAGCGG - Intergenic
1172614242 20:36273044-36273066 TGTGAAGAGCTGGCCGGGCATGG + Intergenic
1173140170 20:40474987-40475009 TGTGGAAGGTTGGCCGGGTGCGG + Intergenic
1173179990 20:40799014-40799036 AGCCGGCAGCTGGCCGGGTGCGG + Intergenic
1173412314 20:42823382-42823404 TGTTGAGGGGTGGCAGGGTGAGG + Intronic
1173800186 20:45890487-45890509 TGTAGAGCCCTGGCCGGCTGCGG + Exonic
1173921754 20:46751384-46751406 TGTGTAGTGCTGGCCGGGTGCGG - Intergenic
1175264267 20:57693068-57693090 TGTTGTGAGCAGGCCGGGAGTGG + Intronic
1175637938 20:60601161-60601183 AATCGAGACCAGGCCGGGTGTGG - Intergenic
1175761252 20:61563369-61563391 TGTGGAGAGCTGGCCGGCCCAGG + Intronic
1176174640 20:63714133-63714155 TGACTAGAGCGGGCCGGGGGTGG + Intronic
1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG + Intronic
1176803916 21:13461604-13461626 AGTAAAGAGCTGGCCAGGTGTGG + Intergenic
1177369234 21:20180123-20180145 AGCCAAGAGCTGGCCGGGCGCGG - Intergenic
1178138569 21:29656071-29656093 TGAAGAGAGAAGGCCGGGTGCGG + Intronic
1178723519 21:35031056-35031078 AGTTAAGAGATGGCCGGGTGCGG + Intronic
1178851588 21:36216784-36216806 AGCTGAGGGCTGGCCGGGTGTGG + Intronic
1180217365 21:46333914-46333936 TGTTTAGAGCTGGCCAGGTGTGG + Intronic
1182008673 22:26982326-26982348 AAAGGAGAGCTGGCCGGGTGCGG + Intergenic
1182176485 22:28294855-28294877 TGTCAAGAGCTGGCCAGGCACGG - Intronic
1182619971 22:31613551-31613573 TGTGGGGAGCAGGCAGGGTGTGG + Intronic
1183702516 22:39458026-39458048 AGTCGGGGGCTGGGCGGGTGCGG + Intronic
1183865676 22:40702345-40702367 TGGCCAGACTTGGCCGGGTGTGG - Intergenic
1184286734 22:43476248-43476270 TGCCCAGTGCTGGCAGGGTGAGG + Intronic
1184496199 22:44843079-44843101 TGTCCACAGCTGGCCTCGTGAGG - Intronic
1184611610 22:45607486-45607508 TGCAGAGAGCTGGCCGGGCGTGG + Intergenic
1184731600 22:46373776-46373798 TGTCCAGAGCAGGCCGGTTGGGG - Intronic
1184782867 22:46657801-46657823 TGTGGTGGGCTGGCCAGGTGTGG + Intronic
1185027100 22:48421002-48421024 TGCTTAGTGCTGGCCGGGTGTGG + Intergenic
1185236795 22:49718578-49718600 TGTGGACAGCTGGGCAGGTGTGG + Intergenic
949408686 3:3741105-3741127 TGCTGAGAGCTGGCCTTGTGGGG - Intronic
950465484 3:13150918-13150940 GGTCCAGGGCTGGCCTGGTGGGG + Intergenic
952487174 3:33824547-33824569 TGTCATGAGTTGGCCGGGTGCGG - Intronic
952722131 3:36544458-36544480 TGCAGACACCTGGCCGGGTGCGG - Intronic
954259489 3:49428429-49428451 TGGGGAGGGGTGGCCGGGTGCGG + Intronic
955187198 3:56725902-56725924 TGGTGAGAGCTGGCCGGGCGTGG + Intergenic
955228472 3:57079412-57079434 TGTCGAGCGGTGGCCGGGCGTGG - Intergenic
955258240 3:57357031-57357053 TGTGGAAAAATGGCCGGGTGCGG - Intronic
959694988 3:109239736-109239758 TGCCAAAAGCAGGCCGGGTGTGG + Intergenic
959737188 3:109672956-109672978 TATCCAGAGATGGCTGGGTGGGG + Intergenic
960938866 3:122920761-122920783 TGGGGAGAGATGGTCGGGTGTGG - Intronic
963208935 3:142667124-142667146 TTTCATGAGATGGCCGGGTGCGG + Intronic
967987626 3:195107181-195107203 AGAAGAGAGGTGGCCGGGTGCGG + Intronic
968061655 3:195730638-195730660 TGGGGAGAGGGGGCCGGGTGCGG - Intronic
968091846 3:195903038-195903060 TGGTGTTAGCTGGCCGGGTGCGG - Intronic
968539105 4:1154105-1154127 TGTCGAGGGGAGGCTGGGTGCGG + Intergenic
968688875 4:1979623-1979645 TTTCGAGGCCTGGCCGGGTTGGG + Exonic
969690862 4:8703419-8703441 AGCCGAGAGCTGGCAGGGAGGGG + Intergenic
969741161 4:9027885-9027907 TGTCTAGAACTTGCCAGGTGTGG + Intergenic
969800503 4:9560763-9560785 TGTCTAGAACTTGCCAGGTGTGG + Intergenic
970067525 4:12116062-12116084 TTTGGAGAGATGGCTGGGTGTGG + Intergenic
970311526 4:14787471-14787493 TGTGGAGATCTGCCTGGGTGTGG - Intergenic
970716799 4:18936058-18936080 TGTGAAGAGCTGGCTGTGTGTGG + Intergenic
972858088 4:43132468-43132490 TGTCTAGTCCTGGCAGGGTGCGG + Intergenic
976245695 4:83004105-83004127 TGTAGAAAACAGGCCGGGTGCGG + Intronic
978579013 4:110214049-110214071 TCTAGAGAGTTGGCCAGGTGTGG + Intergenic
979023420 4:115533536-115533558 ACTCTAAAGCTGGCCGGGTGGGG - Intergenic
979480788 4:121214530-121214552 TATGGAGAGGTGGCCGGGTGAGG + Intronic
979499463 4:121422590-121422612 TCACGAGAGGAGGCCGGGTGCGG - Intergenic
982014103 4:151135717-151135739 GGTATAGAGCTGGCAGGGTGCGG - Intronic
982254803 4:153441463-153441485 TTACTAGAGCAGGCCGGGTGCGG + Intergenic
983733667 4:171030628-171030650 TGTCGGGAGCTGGGGGGCTGGGG + Intergenic
986488847 5:8269094-8269116 TCTCGAAAGCTGGCCGGGGGAGG - Intergenic
986550894 5:8953732-8953754 TATCAAAAGCTGGCCGGGCGTGG - Intergenic
988477621 5:31601365-31601387 AGCTGAGAGCTGGCCGGGCGCGG + Intergenic
988823210 5:34908456-34908478 AGTCTAAAGGTGGCCGGGTGTGG - Exonic
988827083 5:34948574-34948596 TAGTGAGAGCTGGCCAGGTGCGG + Intronic
988984908 5:36608245-36608267 TGCCAAGAGCTTGCCTGGTGTGG + Intronic
993095180 5:83472543-83472565 TGTCAGGAGCTGCCCGGGAGTGG - Intronic
993793195 5:92232967-92232989 TATAGAAACCTGGCCGGGTGCGG - Intergenic
995614591 5:113946762-113946784 TGACAAAATCTGGCCGGGTGCGG - Intergenic
995783936 5:115808267-115808289 AGCCTAGGGCTGGCCGGGTGTGG - Intronic
996359335 5:122628089-122628111 ATTCTAGAGCTGGCCGGGCGCGG - Intergenic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
998208627 5:140176777-140176799 TCTCTAGACCTGGCCTGGTGCGG + Intronic
998510251 5:142707117-142707139 ACTGGAGAGATGGCCGGGTGTGG - Intergenic
1000023533 5:157339270-157339292 TGTGCAGAGGGGGCCGGGTGGGG + Intronic
1001993359 5:176134850-176134872 TGTCCAGAGCCGGCCTGCTGAGG + Intergenic
1002000988 5:176196179-176196201 TGTCCAGAGCCGGCCTGCTGAGG + Intergenic
1002253347 5:177942793-177942815 TGTCCAGAGCCGGCCTGCTGAGG - Intergenic
1004521432 6:16364591-16364613 TATCTAGAACTGGCTGGGTGCGG - Intronic
1004633306 6:17442595-17442617 TCCTGAGAGCTGGCTGGGTGTGG + Intronic
1005235803 6:23760977-23760999 TTGGGAGAGTTGGCCGGGTGTGG + Intergenic
1006336992 6:33425995-33426017 CGGCGGGAGCTGGCCGGGGGCGG + Intronic
1006432547 6:34006792-34006814 AGTAGAAAGCAGGCCGGGTGCGG + Intergenic
1009355352 6:62738389-62738411 TGTCGGGAGGTGGAGGGGTGGGG - Intergenic
1009936332 6:70238846-70238868 AGTTGAGTGTTGGCCGGGTGTGG + Intronic
1010578470 6:77564171-77564193 GGCCGGGAGCTGGCCAGGTGCGG + Intergenic
1010963057 6:82168919-82168941 TGAAGAAAGCTGGCCGGGCGTGG - Intergenic
1017530103 6:155281429-155281451 TGTTGAGAACTGGCTGGGCGTGG + Intronic
1018682981 6:166280261-166280283 GTACAAGAGCTGGCCGGGTGCGG - Intergenic
1019396821 7:824840-824862 AGTCCAGAGCAGGGCGGGTGCGG + Intronic
1020867892 7:13590208-13590230 TGCTGAAAACTGGCCGGGTGTGG - Intergenic
1025989684 7:66487137-66487159 AGTCAAGAGCTGACCAGGTGTGG + Intergenic
1027179240 7:75926503-75926525 TATTGAGTGCTGGCCAGGTGTGG + Intronic
1027196911 7:76037072-76037094 TAAGAAGAGCTGGCCGGGTGCGG - Intronic
1027212244 7:76159588-76159610 AGTCAAGAGCTGACCAGGTGTGG + Intergenic
1027922540 7:84413335-84413357 TGTAGAAAGCAGGCCGAGTGTGG + Intronic
1029071352 7:97901512-97901534 TGTCTAGAACTTGCCAGGTGTGG - Intergenic
1029700123 7:102241108-102241130 TGAAGAGAACTGGCTGGGTGCGG - Intronic
1031926418 7:127642863-127642885 AGTCAAGAGCAGGCCAGGTGCGG - Intergenic
1032373352 7:131383011-131383033 TATCCGTAGCTGGCCGGGTGTGG - Intronic
1033204170 7:139402812-139402834 TGCAGAGAGCTGGCCAGGCGTGG - Intronic
1033214280 7:139482802-139482824 GGTCCAGGGCTGGGCGGGTGTGG + Intronic
1033814891 7:145059756-145059778 TGTCAAGATGTGGCCGGGCGCGG + Intergenic
1035221003 7:157406541-157406563 TGCCGGGACCTGGCCGGGGGCGG + Intronic
1035541207 8:439775-439797 TGTGGAAAGGTGGCCAGGTGCGG + Intronic
1036016917 8:4795550-4795572 TTAAGAAAGCTGGCCGGGTGCGG - Intronic
1036548105 8:9791637-9791659 GGTTGAGACCTGGCCAGGTGCGG + Intergenic
1036887909 8:12573542-12573564 TGTCTAGAACTTGCCAGGTGTGG - Intergenic
1036895509 8:12631643-12631665 TGTCTAGAACTTGCCAGGTGTGG - Intergenic
1037371997 8:18190078-18190100 TGTCAATAGCAGGCTGGGTGTGG - Intronic
1038513316 8:28161281-28161303 AGTAGAGAGGTGGCCGGGAGTGG + Intronic
1039604812 8:38871628-38871650 ACCCAAGAGCTGGCCGGGTGCGG + Intergenic
1039801722 8:40963505-40963527 TTTCAAGGGCTGGCAGGGTGAGG + Intergenic
1040775548 8:51038922-51038944 TGTAAAAACCTGGCCGGGTGCGG + Intergenic
1042284077 8:67088576-67088598 TCTCAAAAACTGGCCGGGTGCGG - Intronic
1044869943 8:96608748-96608770 TGTAGAGAGATGGCAGAGTGTGG + Intronic
1044975944 8:97665834-97665856 TGTAAAGATCTGGCCGGGCGCGG + Intronic
1046036363 8:108846539-108846561 AGTTGAGAGCTGGTGGGGTGGGG - Intergenic
1047312537 8:123704685-123704707 TGTCAACCGCAGGCCGGGTGCGG - Intronic
1047997905 8:130354355-130354377 TGTCGACAGCAGGCCTGGTATGG + Intronic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1056798911 9:89677813-89677835 TGTGGAGTGCTGAACGGGTGGGG + Intergenic
1057709356 9:97424344-97424366 ATAAGAGAGCTGGCCGGGTGTGG - Intronic
1058292623 9:103261081-103261103 TCTTGAGATATGGCCGGGTGCGG - Intergenic
1059376717 9:113887657-113887679 TGGGCAGAGCTGGCAGGGTGGGG + Intronic
1059733302 9:117077455-117077477 AGTAAGGAGCTGGCCGGGTGCGG + Intronic
1060630940 9:125157977-125157999 TGTAGATTGCCGGCCGGGTGGGG - Intronic
1060642178 9:125248332-125248354 TATGAAGAGCTGGCCGGGCGCGG + Intergenic
1060646669 9:125286432-125286454 GGTCAAGAGCTGGCCAGGAGTGG - Intronic
1061981303 9:134105053-134105075 TGATGAGAGTGGGCCGGGTGCGG - Intergenic
1062020620 9:134317839-134317861 TGCTGTGAGCTGGCTGGGTGGGG - Intronic
1062020682 9:134318058-134318080 TGCTGTGAGCTGGCTGGGTGGGG - Intronic
1062020692 9:134318093-134318115 TGCTGTGAGCTGGCTGGGTGGGG - Intronic
1062201105 9:135303172-135303194 TGCCGGGAGCTGGACCGGTGGGG + Intergenic
1062332070 9:136049245-136049267 TCTCTAGACCTGGCCGGGTGAGG + Intronic
1062537077 9:137025736-137025758 TGCCCATAGCAGGCCGGGTGTGG - Intronic
1062585373 9:137246993-137247015 TGTGGAGTCCTGGCCGGGCGTGG + Intronic
1185488721 X:503110-503132 TGTGGACATCTGGCCGGGCGCGG + Intergenic
1186448469 X:9652564-9652586 TGTTTAGTGCTGGCCGGGCGTGG + Intronic
1187953402 X:24492709-24492731 TGACCAGAGCTGGCTGGGCGCGG + Intronic
1187996745 X:24935009-24935031 AGGAGAGACCTGGCCGGGTGTGG - Intronic
1188699347 X:33238964-33238986 TGTTGAATACTGGCCGGGTGTGG + Intronic
1190247935 X:48702772-48702794 TGTGGAGAGCAGGAAGGGTGAGG - Intronic
1195645792 X:107229414-107229436 AGGAGAGAGCAGGCCGGGTGCGG - Intronic
1196308886 X:114137666-114137688 TATAGAGTGCTGGCCGGGCGCGG + Intergenic
1200206243 X:154318407-154318429 GTTCGAGACCAGGCCGGGTGCGG + Intronic