ID: 1176244961

View in Genome Browser
Species Human (GRCh38)
Location 20:64093120-64093142
Sequence GGTGCTCCCCTCCACAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176244949_1176244961 13 Left 1176244949 20:64093084-64093106 CCCTGTCCAGGAGGCAGGGTCAG 0: 1
1: 0
2: 2
3: 39
4: 309
Right 1176244961 20:64093120-64093142 GGTGCTCCCCTCCACAGGGAGGG 0: 1
1: 0
2: 2
3: 19
4: 223
1176244944_1176244961 30 Left 1176244944 20:64093067-64093089 CCATTCAATGTTTTTGACCCTGT 0: 1
1: 0
2: 4
3: 17
4: 224
Right 1176244961 20:64093120-64093142 GGTGCTCCCCTCCACAGGGAGGG 0: 1
1: 0
2: 2
3: 19
4: 223
1176244951_1176244961 7 Left 1176244951 20:64093090-64093112 CCAGGAGGCAGGGTCAGTCCTGA 0: 1
1: 0
2: 2
3: 36
4: 307
Right 1176244961 20:64093120-64093142 GGTGCTCCCCTCCACAGGGAGGG 0: 1
1: 0
2: 2
3: 19
4: 223
1176244950_1176244961 12 Left 1176244950 20:64093085-64093107 CCTGTCCAGGAGGCAGGGTCAGT 0: 1
1: 0
2: 0
3: 24
4: 220
Right 1176244961 20:64093120-64093142 GGTGCTCCCCTCCACAGGGAGGG 0: 1
1: 0
2: 2
3: 19
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176244961 Original CRISPR GGTGCTCCCCTCCACAGGGA GGG Intronic
900114030 1:1020948-1020970 GGGGCTCCCCACCCCGGGGAGGG + Intronic
900290944 1:1923345-1923367 GGTGAGCCCCTCCCCAGGGAGGG - Exonic
900389926 1:2429368-2429390 GTTAATCCCCTCCCCAGGGAGGG + Intronic
900406606 1:2495657-2495679 GGTCCTGCCCTGCTCAGGGATGG - Intronic
900462438 1:2808097-2808119 CGTGCCCCCCTCCACAGTGCTGG - Intergenic
900811137 1:4802118-4802140 GGAGCTGGCCTCCGCAGGGATGG - Intergenic
900920208 1:5665312-5665334 GGTTCTCCCCTGCAGAGGGGAGG - Intergenic
900975101 1:6011835-6011857 AGTTCTCACCTCCACAGGCAAGG - Intronic
902205784 1:14867146-14867168 GCTGCTCCCCTGCACAGGGAGGG - Intronic
902481084 1:16712262-16712284 GGTCCTCCCAGGCACAGGGAAGG - Intergenic
903774985 1:25787281-25787303 GGTGCTTCCATCCTCAGCGAGGG - Intergenic
904200186 1:28814524-28814546 GGAGCTCCCCTAGACAGGGCAGG - Intronic
905462890 1:38133187-38133209 GCCTCCCCCCTCCACAGGGAGGG + Intergenic
905880034 1:41457384-41457406 CATGCTCCCCTCCCCAGTGAAGG - Intergenic
906980124 1:50621013-50621035 TGTGCCTCCCTCCACAGGGCTGG - Intronic
907341331 1:53738306-53738328 GGTCCTCCCCACACCAGGGAAGG - Intergenic
911260754 1:95682413-95682435 GGTGCTTCTTTCCACAGGAATGG + Intergenic
914936513 1:151985993-151986015 AGTGGTGACCTCCACAGGGAAGG + Intronic
920832007 1:209473964-209473986 GGTGCTCCCTGCCACCAGGAAGG + Intergenic
921087870 1:211812977-211812999 GGTGCACCCTTCTAGAGGGAGGG + Intronic
922305562 1:224341065-224341087 GGTGCCGCGCTCCACAGAGACGG - Intergenic
923199237 1:231695251-231695273 GCTGCTGCCTTCCACAGGGTCGG + Intronic
923400860 1:233614510-233614532 CGTGCTCTCCACCACAGGTAGGG + Exonic
1062830403 10:601744-601766 TGTTCTCTCCTTCACAGGGAAGG + Intronic
1063200437 10:3781794-3781816 GGAGCTGCCCTCGCCAGGGAAGG - Exonic
1067175779 10:43944376-43944398 GGTGGCCTCCTCCACAGGAATGG + Intergenic
1067732654 10:48823245-48823267 GGGGTTCCCCATCACAGGGAGGG - Intronic
1068952457 10:62790814-62790836 GGGGCACCCCTCACCAGGGATGG + Intergenic
1069907462 10:71740164-71740186 GCTTCTTCCCTCCACAGGGCAGG - Intronic
1070096166 10:73340165-73340187 GTAGCTCCTCTCCACAGGCAGGG + Intronic
1071501954 10:86210597-86210619 AGTGCTCACCTCCACGGGGAGGG - Intronic
1073112509 10:101071004-101071026 GGTGCTCCCCACCAAGAGGATGG - Intergenic
1075467675 10:122663766-122663788 GGTATTCCCATCCACAGGCAGGG + Intergenic
1075762109 10:124864762-124864784 GGTGGTCTCCTCCCCTGGGAGGG - Intergenic
1077503989 11:2921862-2921884 GGGGCTCCTCTCCACAAGGGAGG - Intronic
1077824354 11:5788480-5788502 TGTGCACACCTTCACAGGGATGG - Exonic
1079036405 11:17024157-17024179 GGGGGTGCCCTCGACAGGGATGG - Intergenic
1079543376 11:21603111-21603133 TGTGCTCCCTTCCATAGGCACGG - Intergenic
1080891942 11:36416783-36416805 GGGGCTTCACTCTACAGGGAGGG - Intronic
1083335300 11:61918352-61918374 AGTCCTCCCCTAGACAGGGAAGG - Intronic
1083735165 11:64676065-64676087 CTCGCTCCCCTCAACAGGGAAGG + Intronic
1084857416 11:71997955-71997977 GCTGTTCCCCTCCTCAGAGAGGG + Intergenic
1086249371 11:84795402-84795424 GTAGCTCCCCTCCACAGACAAGG - Intronic
1087218581 11:95521344-95521366 AGTGCTCCTCCCCACAGAGAAGG - Intergenic
1088110087 11:106251034-106251056 AGAGCTCCCCTACAAAGGGAGGG - Intergenic
1089528135 11:119110046-119110068 GGAGCTGCCCCCCACAGGGTTGG - Intronic
1089559922 11:119338691-119338713 GGTGCTCCCTTTCTCAAGGATGG + Intergenic
1089619394 11:119713773-119713795 GGAGCTGCCCTCCAGAGGGCGGG - Intronic
1090508198 11:127342258-127342280 AGTTCTCTCCTTCACAGGGAAGG - Intergenic
1091406214 12:211094-211116 GGTGCTCCCCTCTACAGCCTGGG - Intronic
1091614782 12:2041789-2041811 GCTGCTGCTCTTCACAGGGAAGG - Intronic
1092282776 12:7109877-7109899 GGTGGTCCCATCCTCAGAGAAGG + Intergenic
1092318663 12:7447282-7447304 GCTGCTCCACTCCTCAGGCACGG - Intronic
1092538036 12:9404846-9404868 GGTGCATCCCTCCACTGCGATGG - Intergenic
1092637853 12:10470737-10470759 GGTCCTGCCCTCCACATGTAGGG - Intergenic
1093731175 12:22567685-22567707 TGTGCTCCACTCCTCAGGGGAGG + Intergenic
1095719686 12:45386890-45386912 TGTGGTCCCCTCCTCTGGGATGG + Intronic
1096216681 12:49801649-49801671 AGTGCTCCCCACCAGCGGGAGGG - Intronic
1096585271 12:52615818-52615840 GCTGCTCTCTGCCACAGGGAAGG - Intronic
1101403080 12:104404968-104404990 GCTGCTCTCCTCCCCAGGCAGGG - Intergenic
1102074764 12:110050988-110051010 GGTGTTCACCTGCAAAGGGAAGG + Intronic
1103467687 12:121154940-121154962 GGTGCTCACCTGCAAAGGGAAGG - Exonic
1104746987 12:131216780-131216802 ACTGCTCCCCTCCACGGGGCTGG - Intergenic
1104785632 12:131446405-131446427 ACTGCTCCCCTCCACGGGGCTGG + Intergenic
1104868877 12:131979768-131979790 GGCGATGCCCTCCACAGGTATGG + Exonic
1106436541 13:29728496-29728518 GGTGCTCCCTTTCTCAGTGAAGG + Intergenic
1106791099 13:33155230-33155252 GTTGTTCCCCACCTCAGGGAAGG + Intronic
1107058461 13:36131079-36131101 GCAGCTCCCGTCCCCAGGGAAGG + Intronic
1110967045 13:81713228-81713250 TGTGCCTCCTTCCACAGGGATGG - Intergenic
1113480785 13:110619057-110619079 GGTGCTCCCCTCCACCTGACAGG + Intronic
1113593674 13:111517474-111517496 GGGTGTCCCCTCCACAGGCAGGG - Intergenic
1114396086 14:22363014-22363036 GGTGCCTCTCTCCACAGGGCTGG - Intergenic
1117734057 14:58751535-58751557 GTAGCTCCTCTCCACAGGCAGGG - Intergenic
1119204200 14:72782126-72782148 GGTGCTGCCCTCCCCAGTAAAGG + Intronic
1121279027 14:92686787-92686809 GGGCTTCCCCTCCCCAGGGAAGG - Intronic
1121586134 14:95064331-95064353 GGGTCTTCCCTGCACAGGGAAGG + Intergenic
1122762777 14:104042350-104042372 GGTGCTGCTCTCCACAGGAAGGG - Intronic
1122774422 14:104110890-104110912 GGTGCTCCCCACTCCAGGGCAGG + Intronic
1123008291 14:105334912-105334934 GGGGCTCCCCTCCATGGGGTGGG + Intronic
1123065453 14:105616791-105616813 GCTGAGCCCCTGCACAGGGAAGG - Intergenic
1123069657 14:105636257-105636279 GCTGAGCCCCTCCACAGGGAAGG - Intergenic
1123088750 14:105732040-105732062 GCTGAGCCCCTCCACAGGGAAGG - Intergenic
1123094679 14:105761297-105761319 GCTGAGCCCCTGCACAGGGAAGG - Intergenic
1123888180 15:24748701-24748723 GGTGCTGCGCTCCACAGAGCTGG + Intergenic
1125104388 15:35953684-35953706 GGTGCTCCTCTACACAGGACCGG - Intergenic
1126068223 15:44842765-44842787 GGAGTTCCCCTACACAGGGCTGG - Intergenic
1126090609 15:45048038-45048060 GGAGTTCCCCTACACAGGGCTGG + Intronic
1127073467 15:55304912-55304934 GGAGCTCCCATACAAAGGGAGGG + Intronic
1129197864 15:73981859-73981881 CGAGCTCCCCTCCACAGGGTGGG + Exonic
1131115809 15:89794624-89794646 GGTGCTGCCCTCTACAAGGAGGG - Intronic
1132473007 16:117338-117360 GGTGCTTCCCTCTTCGGGGAAGG + Intronic
1132735171 16:1382378-1382400 GGGGCTGCCCTGCCCAGGGAAGG - Intronic
1132814518 16:1819353-1819375 GGTGCTCCCCACCACGGGACTGG + Intronic
1134112634 16:11524718-11524740 GGTGCTGGCCTTCCCAGGGAGGG - Intergenic
1139614905 16:68083104-68083126 GGTCAGCCCCTCCACTGGGAAGG - Intergenic
1139654425 16:68378670-68378692 CCTGCTGCACTCCACAGGGAGGG + Intronic
1139935924 16:70571145-70571167 GGTGGTCCCGCCCACAGAGAGGG - Exonic
1143400452 17:6639463-6639485 GCTTCTCCCCTCCACAGGTGCGG + Intronic
1143404401 17:6667668-6667690 AGTGCTCACCGCCACAGGGCTGG - Intergenic
1144060546 17:11580244-11580266 GGTTCTCCCCCACACTGGGAAGG + Intergenic
1144710518 17:17398709-17398731 GCTGCTCCCCACTGCAGGGAGGG - Intergenic
1147253210 17:39165830-39165852 GGAGCTCCGCTCCCCCGGGAGGG + Intronic
1147393828 17:40125905-40125927 GGAGATCCTCTCCACTGGGAAGG - Intronic
1147899255 17:43773281-43773303 GGGGGTCCCCTCCGCTGGGAGGG + Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148818188 17:50345834-50345856 TGTGCTCCCCTCCACCTGGACGG - Intergenic
1150649755 17:67002021-67002043 GGTGCTCCAGACCACAGGTATGG + Intronic
1151829208 17:76539923-76539945 GGTTCTCCCCTCCAGCGGTAGGG - Intronic
1152531466 17:80921834-80921856 AGTGCGCCCCTCCCCAGGGCAGG + Intronic
1152878581 17:82802659-82802681 GCTTCCCCCCTCCTCAGGGAGGG + Intronic
1153267312 18:3284060-3284082 GCCCCTCCCCTCCACAGGGCAGG - Intergenic
1157101633 18:44735609-44735631 GGTGCTCCAGGGCACAGGGAGGG + Intronic
1157702096 18:49767875-49767897 GGTGCTCAGCACCTCAGGGAGGG + Intergenic
1160864545 19:1251032-1251054 GATGGGCCCCTCCACTGGGATGG - Intronic
1161170093 19:2808226-2808248 GCTGCCTCCCTCCCCAGGGAAGG + Exonic
1162544364 19:11319719-11319741 GGTGCCCCCCTCCCCAAGAAAGG - Intronic
1164428285 19:28164514-28164536 TGTGTTCCTTTCCACAGGGAGGG - Intergenic
1166141157 19:40806132-40806154 GGGGCTCCACTCCACAGCCAAGG + Intronic
1167163858 19:47784784-47784806 GGTGCTTCCCTACAGAGGGTTGG - Intergenic
1202715123 1_KI270714v1_random:38166-38188 GGTCCTCCCAGGCACAGGGAAGG - Intergenic
925718148 2:6803682-6803704 GGACCTCCCTTCCCCAGGGAGGG + Intergenic
926108853 2:10169577-10169599 GGGGCTCCCCAGCAGAGGGAGGG + Intronic
926166187 2:10523177-10523199 GCTGCTGCCCTCCACTCGGAGGG - Intergenic
929014614 2:37481949-37481971 GTAGCTCCTCTCCACAGGCAGGG - Intergenic
932592597 2:73076134-73076156 GGGGCTGCCCTCCACAGGGGCGG + Exonic
934765755 2:96879219-96879241 GGTGCGCCCCTCCACTCAGAGGG + Intronic
934957398 2:98634190-98634212 TGTGCTCCCCTGGAGAGGGAGGG - Intronic
936339613 2:111619229-111619251 GGTGCTACCCTCCAAAGGCATGG - Intergenic
938065853 2:128281647-128281669 TGGGCTCCCTTCCAAAGGGAGGG + Intronic
938083190 2:128381076-128381098 GGTGCTCACCCCCGCAGAGAGGG + Intergenic
938595313 2:132782763-132782785 GGGGCACCCCTCCTCCGGGAAGG - Exonic
938646284 2:133333761-133333783 TTTGCTCCCCTACACAGTGAGGG + Intronic
938824061 2:134987387-134987409 GGGGCTTCCATCCACAGGGAAGG + Exonic
943276506 2:185875407-185875429 GAGGCTCCCCAACACAGGGAAGG + Intergenic
944656729 2:201883010-201883032 GGGGCAGCCCTCCTCAGGGATGG - Intronic
945118092 2:206429256-206429278 GGGAGTCCCCTCCACTGGGAGGG + Intergenic
947768805 2:232654749-232654771 GGCTCTCCCCAACACAGGGAGGG - Intronic
948132355 2:235609956-235609978 GGTGTTTCCTTCCTCAGGGACGG + Intronic
948427111 2:237895213-237895235 GGGGCTCCCATCCAAAGGCAGGG + Intronic
1168740893 20:190722-190744 GGAGCTCCCATACAAAGGGAGGG + Intergenic
1168749768 20:274226-274248 GGTGTTCCCTTCCACGTGGAAGG + Intronic
1171191320 20:23161650-23161672 GCTGCGCCCCTCCACAGTGGAGG - Intergenic
1172091091 20:32433531-32433553 GATGTTCCCCTCTACAAGGATGG + Exonic
1173278410 20:41604724-41604746 TGTGCTCCCCGCCACAGGTGGGG - Intronic
1176244961 20:64093120-64093142 GGTGCTCCCCTCCACAGGGAGGG + Intronic
1178436818 21:32567317-32567339 GTGCCTCCCCTCCACAGGGCAGG - Intergenic
1179421203 21:41238252-41238274 GGGGCTCACCACCACTGGGAAGG - Intronic
1180188772 21:46153027-46153049 GGTGCTCTCCTGCAGAGAGACGG + Exonic
1181419664 22:22789007-22789029 GGAGATGCTCTCCACAGGGAAGG + Intronic
1182319346 22:29468247-29468269 GCTGCTCCCCTTCACACAGAGGG + Intergenic
1182466562 22:30520455-30520477 GGTGGCCCCCACCAAAGGGAGGG - Intergenic
1183380658 22:37489064-37489086 GGGCCTCCACTCCACAGGGGAGG + Intergenic
1184500490 22:44868564-44868586 CGTGCTCCCCTCCAAAGTGCTGG - Intergenic
1185207718 22:49549613-49549635 GGTGCTCTCCTCCAAAAAGAGGG + Intronic
950531326 3:13553807-13553829 GGTGCTCCCCTCCACATCCCTGG - Intronic
952849327 3:37714578-37714600 GCTGCTTCCCTCCCAAGGGAAGG + Intronic
952946225 3:38479348-38479370 GGTGGACACCTCCACAGGGAAGG - Intronic
953677223 3:45012401-45012423 GCTGCTTCTCTCCACAGGGATGG - Intronic
954225213 3:49176842-49176864 TCTGCTCACCCCCACAGGGAGGG + Intergenic
957915434 3:86682539-86682561 CATGCCTCCCTCCACAGGGATGG - Intergenic
959299046 3:104576042-104576064 GGTGCTCCCATCCCCAGGCAAGG - Intergenic
961394934 3:126579979-126580001 GGCTCTGCCCTCCACAGGTAAGG + Intronic
961395126 3:126581141-126581163 GGCTCTGCCCTCCACAGGTAAGG - Intronic
961442968 3:126963674-126963696 AGTGCTCCCCTCCCCAGGCTGGG - Intergenic
961727510 3:128942400-128942422 GGGGCTCCACTGCACAGGTATGG + Intronic
961742155 3:129039697-129039719 GCTGTTTCCCTCCAGAGGGAAGG + Exonic
962422112 3:135237957-135237979 TCTGCTTCCCTCCACAGGGCTGG + Intronic
964052738 3:152416633-152416655 GGTGCTCCCAGTCACAGAGAGGG - Intronic
964402789 3:156316644-156316666 GCTGCTCCCCTCTTCAGGGTTGG - Intronic
965984613 3:174736420-174736442 GTAGCTCCTCTCCACAGGCAGGG + Intronic
968008090 3:195256421-195256443 GGTGCGGCCCTGCACAGGGCAGG + Intronic
968033359 3:195523174-195523196 AGCCCTCCCCTTCACAGGGATGG - Intronic
969401405 4:6958082-6958104 GGTTCTCAGCTCCCCAGGGATGG + Intronic
970776429 4:19679705-19679727 TCCGCTCCCCTCCACAGGGCTGG - Intergenic
974272618 4:59671261-59671283 GGTGTGCCCTTCCACATGGAAGG - Intergenic
975913496 4:79297196-79297218 GGTGCTGCACTCCACAGAGCTGG + Intronic
976942492 4:90720573-90720595 GGAGCTCCCATACAAAGGGAGGG + Intronic
979038564 4:115756802-115756824 GCTGCTACCCACCACAGAGAAGG - Intergenic
980386309 4:132090873-132090895 GGAGCTCCCATACAAAGGGACGG + Intergenic
980557773 4:134431263-134431285 CCTGCCACCCTCCACAGGGATGG + Intergenic
983730782 4:170991410-170991432 TGTGCCTCCCTCCACAGGGCTGG - Intergenic
985865606 5:2511737-2511759 TGAGCACTCCTCCACAGGGAGGG - Intergenic
987010275 5:13755996-13756018 TGTGCTCCCCTCAACAGGCTGGG - Intronic
987951905 5:24687074-24687096 GTAACTCCTCTCCACAGGGAGGG + Intergenic
999291774 5:150430494-150430516 GGTGCTGGCCTCCACTGAGATGG + Intergenic
999673536 5:153977635-153977657 AGGGCTCCCCTCCATAGGGAAGG + Intergenic
1002079605 5:176729509-176729531 GGTTCTGCCCACCCCAGGGAAGG + Intergenic
1002639782 5:180625290-180625312 CGTGCTCCCCTCCACTGAGCGGG - Intronic
1004173398 6:13316850-13316872 CTTGCTCCCCTCTTCAGGGAGGG - Intronic
1005682062 6:28217613-28217635 GGTGCTCCCGGCCCCAGGGCAGG + Intergenic
1006606077 6:35259001-35259023 GGGACTCGCCTCCGCAGGGAGGG - Intronic
1009271552 6:61621223-61621245 GGGATTCCCCTCCACCGGGATGG - Intergenic
1009413881 6:63395441-63395463 TGTGTTCCCCTCCAGAGAGAGGG + Intergenic
1012556247 6:100516233-100516255 GGTCTTTCCCTCCACAGGCATGG + Exonic
1013173974 6:107661987-107662009 GGTGCTCCCCTGATAAGGGATGG + Intergenic
1017352510 6:153459033-153459055 TGTGCCTCCCTCCACAGGGCAGG - Intergenic
1018734273 6:166675561-166675583 GGTGGTCCCCTCCACAGCCATGG + Intronic
1019911092 7:4100908-4100930 GGGGCTCACAGCCACAGGGAAGG - Intronic
1020157316 7:5736932-5736954 GGTGCTCCCCACCTCCCGGACGG - Intronic
1021030228 7:15723844-15723866 TGTGCTCCCCACCTCAGGCATGG - Intergenic
1024094994 7:45976244-45976266 GATGCTCCACTCCACACTGATGG - Intergenic
1024842572 7:53603724-53603746 TGTGCCTCCCTCCACAGGGCTGG + Intergenic
1026952041 7:74354037-74354059 GGGGCTCCTCTCCCCAGGGTGGG + Intronic
1029441113 7:100587004-100587026 GGAGCTCCCCTGGACAGGAATGG + Intronic
1029623932 7:101707850-101707872 GGCACTCCACTCCCCAGGGAGGG + Intergenic
1030661134 7:112220921-112220943 GGAGCTCCCATACAAAGGGAGGG - Intronic
1032156808 7:129476148-129476170 GGTGCCCCCCTCCTCCCGGACGG + Intronic
1033429310 7:141274583-141274605 GGTCCTCACTTCCACAGGTATGG + Intronic
1033710592 7:143939089-143939111 CCTACTTCCCTCCACAGGGAGGG - Intergenic
1034210537 7:149358747-149358769 GGTGCTGCACTCCACAGAGCTGG - Intergenic
1035204157 7:157283980-157284002 GGTGCTCACTCCCACAGGCAAGG + Intergenic
1035319148 7:158017357-158017379 CATCCTCCCCTCCCCAGGGAGGG - Intronic
1037820376 8:22132190-22132212 AGGGCTCCCCTCTGCAGGGATGG - Intronic
1037845639 8:22279495-22279517 GGTGCTCCCCTGCCCAGAGCTGG - Exonic
1038361826 8:26887210-26887232 GAGGCTTCCCACCACAGGGATGG - Intergenic
1040800024 8:51330102-51330124 GATGCCCCCCTACACTGGGAGGG + Intronic
1040811289 8:51456454-51456476 AGTGCTCCCCTCCACTGGGATGG + Intronic
1044269960 8:90230393-90230415 AGTGCTTCCCTCAACAGAGAGGG - Intergenic
1044624819 8:94226716-94226738 AGTGCTCCTCTCCTCAGGTATGG - Intergenic
1048217171 8:132506890-132506912 GGTGCTCCTCCCCACTGGGTCGG - Intergenic
1048669781 8:136704961-136704983 AGTGCTCCTTTCCAAAGGGAAGG - Intergenic
1048986524 8:139737856-139737878 GATCCTCCCCTCCTCAGGGAAGG - Intronic
1049351993 8:142169577-142169599 GCTGGTCCCCTCTCCAGGGAGGG - Intergenic
1049381691 8:142319483-142319505 GGTGCTCCTCTCTCCAGGGATGG - Intronic
1049642006 8:143720046-143720068 GGTGCTCCCGTGCACAGGCTGGG + Intronic
1050423580 9:5491800-5491822 TGTGCTCCCCTGCATAGGGCTGG + Intergenic
1052974602 9:34401530-34401552 GGTGGTGCCCTGCACAGGGTGGG - Intronic
1054904793 9:70405249-70405271 GATACTCCCTTCCACAAGGACGG + Intronic
1055682602 9:78732755-78732777 GGTGGACCCCTCCATAGGTAGGG - Intergenic
1055875482 9:80936942-80936964 TGTGCTACCCTCCTCAGGGTTGG + Intergenic
1057908083 9:98997737-98997759 AGTGCTCCTCTGCACAGGTAGGG - Intronic
1058110933 9:101029789-101029811 GGATCTCTCCTCCTCAGGGAAGG + Intronic
1060260598 9:122070717-122070739 AGCGCTCCCCTCCTCAGGGCAGG + Intronic
1061620239 9:131807206-131807228 GGAGCTCACCTCTAAAGGGAGGG + Intergenic
1061874200 9:133535815-133535837 GGTCTTCCCTTCCACAGGGCAGG + Intronic
1062033376 9:134372024-134372046 TCTCCTCCCCTCCCCAGGGAGGG - Intronic
1062394824 9:136348557-136348579 GGCGCTCGCCTCCACAAGGGGGG + Intronic
1189023924 X:37371292-37371314 GTAGCTCCTCTCCACAGGCAGGG - Intronic
1197378454 X:125710194-125710216 GTAGCTCCTCTCCACAGGCAGGG - Intergenic
1197582332 X:128299026-128299048 GGTGCTCCATCCCACAGGCAAGG - Intergenic
1198282323 X:135154322-135154344 GGTGCCCTGCTCTACAGGGATGG - Intergenic
1198284612 X:135177295-135177317 GGTGCCCTGCTCTACAGGGATGG - Intergenic
1198286996 X:135200756-135200778 GGTGCCCTGCTCTACAGGGATGG - Intergenic
1198288636 X:135218200-135218222 GGTGCCCTGCTCTACAGGGATGG + Intergenic
1200178811 X:154137722-154137744 TGTGCTCCCCTCCCCATGGCAGG - Intergenic