ID: 1176246086

View in Genome Browser
Species Human (GRCh38)
Location 20:64097787-64097809
Sequence TGGTGTGCCTGCGGAGTAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176246086_1176246092 16 Left 1176246086 20:64097787-64097809 CCCTCTACTCCGCAGGCACACCA 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1176246092 20:64097826-64097848 CAATATTTACATCTTTAACCTGG 0: 1
1: 0
2: 2
3: 28
4: 265
1176246086_1176246093 22 Left 1176246086 20:64097787-64097809 CCCTCTACTCCGCAGGCACACCA 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1176246093 20:64097832-64097854 TTACATCTTTAACCTGGCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176246086 Original CRISPR TGGTGTGCCTGCGGAGTAGA GGG (reversed) Exonic
901653819 1:10757878-10757900 TTGTGTGCCTGGGGAGAAGTTGG - Intronic
905777611 1:40679291-40679313 TTGTGTGCCTGGGGAGGGGATGG - Intergenic
915476475 1:156155599-156155621 TGGTGTGGCTGCGGGATGGAAGG - Intronic
919621753 1:199871463-199871485 TGGTGTCTCTGCGGACTAGCAGG - Intergenic
920218349 1:204377607-204377629 CGGTGGGCCTACGGAGTTGACGG - Intronic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
1065809256 10:29426430-29426452 TGGTGTGACCCTGGAGTAGATGG + Intergenic
1070776341 10:79112047-79112069 TGGTGTGGCTGGAGTGTAGAGGG + Intronic
1070793510 10:79203572-79203594 TGGTGTGCCTGCCATGCAGAGGG - Intronic
1079593035 11:22204704-22204726 TGGTGAGGCTGTGGAGAAGAAGG + Intronic
1081835734 11:46152288-46152310 TGGTGAGGCTGTGGAGTAAAGGG - Intergenic
1084270236 11:68025623-68025645 TCATGTGCCTGCTGAGTGGAGGG - Intronic
1084447118 11:69210096-69210118 GGGTGTGCCCGCGGAGTCGCAGG + Intergenic
1084669607 11:70597283-70597305 TGGGGTGCCTGGGTAGTGGAAGG - Intronic
1084682297 11:70673510-70673532 TGGTGGGGGTGGGGAGTAGATGG + Intronic
1086041774 11:82487827-82487849 TGGTGAGACTGTGGAGTAAAAGG - Intergenic
1087085121 11:94210405-94210427 TGGTGAGGCTGCGGAGGAAAAGG + Intergenic
1087591083 11:100188596-100188618 TGGTGAGGCTGTGGAGAAGAGGG + Intronic
1088822028 11:113464568-113464590 GGGTGTGCTTGGGGAGTAGGAGG - Intronic
1091446198 12:545560-545582 TGGTGTGACAGCGGGGAAGAAGG + Intronic
1093547830 12:20369134-20369156 TTGTGGGCCTGGGGAGAAGAAGG + Intergenic
1093575722 12:20727334-20727356 TGGTGAGGCTGCGGAGAAAAGGG - Intronic
1098569023 12:71968368-71968390 TGGTGTGCCTGCGAGAAAGATGG - Intronic
1099706622 12:86162004-86162026 TGGTGAGGCTGCAGAGTAAAGGG + Intronic
1099886446 12:88537012-88537034 TGGTGTGGCTGCAGAGAAAAGGG + Intronic
1105609859 13:21958899-21958921 TGGTGAGCCTGCAGAGAAAAAGG - Intergenic
1106045951 13:26142236-26142258 TGGTGAGCCTGCAGAGAAAAGGG + Intronic
1106863568 13:33937874-33937896 TGGGGTGCCTGTGGAGTATCTGG + Intronic
1109052622 13:57504143-57504165 TGGTGTGCATGTGGAGAAAAGGG - Intergenic
1109662095 13:65474404-65474426 TGGTGAGGCTGCAGAGTAAAGGG + Intergenic
1110311173 13:74051041-74051063 TGGTGAGACTGCGGAGAAAAGGG + Intronic
1111828552 13:93298400-93298422 TGGTGTGCCTGCCTGCTAGAAGG - Intronic
1112857432 13:103788210-103788232 TGGTGGGGCTGTGGAGTAGTGGG - Intergenic
1114747230 14:25162704-25162726 TGGAGTACCTGTGGAGTAAAGGG - Intergenic
1118351742 14:64977014-64977036 TGATGTGCCCGCGGTGCAGAAGG + Intronic
1121956012 14:98214063-98214085 TGGAGTGGCTGTGGAGCAGAAGG - Intergenic
1122534240 14:102451138-102451160 CAGTGTCCCTGCGGAGTACAGGG + Intronic
1124095957 15:26648919-26648941 TGGGGTGCCTGCAGAGTGGGTGG + Intronic
1126553149 15:49954682-49954704 TGGTGAGGCTGCGGAGAAAAGGG + Intronic
1127579242 15:60322212-60322234 TGGTGGGCTTGCTGAGTGGATGG - Intergenic
1128634758 15:69296019-69296041 GTGAGTGCCTGAGGAGTAGATGG + Intergenic
1130311035 15:82754521-82754543 GTGTGTGCTTGGGGAGTAGAAGG - Intergenic
1130443631 15:83978720-83978742 AGGTGTGCCTGGGGAGTAAACGG - Intronic
1131394913 15:92078490-92078512 TGGTGTGGCTGTGTAGGAGATGG - Intronic
1131818567 15:96247792-96247814 TGGTGAGGCTGTGGAGAAGAGGG - Intergenic
1133052472 16:3124891-3124913 TGGAGTGCCTGAGGGGCAGAGGG + Intergenic
1138662787 16:58534005-58534027 TGGAGTGCCTCCGAAGTAGCTGG - Intronic
1139536918 16:67581616-67581638 TCGTTAGCCTCCGGAGTAGATGG + Intronic
1139952668 16:70679734-70679756 TGGGGTCCCTGCGGAGTGGGGGG + Intronic
1140692175 16:77495136-77495158 TGGTATGCCTGAAGTGTAGAGGG - Intergenic
1141201217 16:81899698-81899720 TGGTGTTCCTGAGCAGGAGAAGG + Intronic
1142309855 16:89306107-89306129 TGGCGTGTCTGCGGAGTGGGAGG - Intronic
1142473145 17:174358-174380 CAGTGTGCCTGCGGTGTAGGAGG + Intronic
1143548611 17:7614887-7614909 CGGTGCGCCTGCGCAGTAGGCGG - Intronic
1145683950 17:26635897-26635919 TGGTGTGCCTGTGGTGGAAAAGG + Intergenic
1149779774 17:59388158-59388180 TGGTGTGGGGGCGGAGAAGAGGG - Intronic
1151821719 17:76500547-76500569 GGGTGTGTCTGAGGAGCAGAAGG - Intronic
1152127029 17:78453356-78453378 TCGTGTTCCTGCCCAGTAGAGGG + Exonic
1152264300 17:79285140-79285162 CGATGTGCCTGCGTCGTAGAAGG - Intronic
1159216733 18:65401745-65401767 TGGTGAGCCAGCGGAGCAGGTGG + Intergenic
1161114360 19:2488544-2488566 TGGCGTGCCTGCTGTGTACACGG - Intergenic
1165315518 19:35053068-35053090 TGGTGTGCCTGCCAAGTTGTTGG - Intronic
1165548715 19:36564604-36564626 TGGTGAGGCTGCGGAGAAAAGGG + Intronic
1167112026 19:47468216-47468238 TGGTGAGGCTGAGGAGCAGAGGG - Intronic
1167245092 19:48368492-48368514 TCTTGTGCCTCCGGAGTAGCTGG + Intronic
1168479717 19:56709374-56709396 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
925203596 2:1988412-1988434 TGGAGAGCCAGCAGAGTAGACGG - Intronic
927636584 2:24821206-24821228 TGCTGTGCCTGCTGAGGACATGG - Exonic
933630366 2:84649596-84649618 TGGTGTACCTGGGAAGTATATGG - Intronic
934109533 2:88729263-88729285 TGGCGGGCCTGCGGAGGACAGGG - Exonic
934954924 2:98609106-98609128 TGGGGGGCCTGCGAAGTGGAGGG + Intronic
935989226 2:108704551-108704573 TGGTGTTCCTGCAGGGCAGAGGG - Intergenic
937879070 2:126851525-126851547 GTGTTTGCCTGCGCAGTAGATGG - Intergenic
937886073 2:126900795-126900817 TAGTGTGCCTGGGGAGTAGGGGG - Intronic
940276883 2:151948863-151948885 CTGTGTGCTTGCAGAGTAGAAGG - Intronic
940449891 2:153824124-153824146 TGGTGAGCCTGCAGAGGAAAGGG + Intergenic
941240895 2:163036351-163036373 TGGTGAGCCTGTGGAGAAAAAGG - Intergenic
942000319 2:171640022-171640044 TGGTGAGGATGCGGAGTAAAGGG - Intergenic
944006768 2:194918502-194918524 TGGTCTGCCTCCCGAGTAGCTGG - Intergenic
946708036 2:222478363-222478385 TGGTTTGCCTCCAGAGTTGAAGG + Intronic
947320264 2:228909310-228909332 TGGTGAGGCTGCGGAGAAAAAGG - Intronic
1168998814 20:2151878-2151900 TTGGGTGCCTGCAGGGTAGAGGG + Intronic
1172375223 20:34433545-34433567 GGGTGTGCCTGTGGAATAGGAGG + Intronic
1176246086 20:64097787-64097809 TGGTGTGCCTGCGGAGTAGAGGG - Exonic
1177870623 21:26568940-26568962 TGGTGAGCCTGTGGAGAAAAGGG + Intronic
1178879990 21:36441850-36441872 GGGTGTGTCACCGGAGTAGAAGG - Intergenic
1181307765 22:21926760-21926782 TGCTGTGCCTGGGGACTAGAAGG - Intronic
1183334436 22:37238614-37238636 TCGTGTGCCTGTGGCATAGAGGG - Intronic
950322020 3:12065208-12065230 TGGTGAGGCTGCAGAGTAAAGGG + Intronic
950977983 3:17270128-17270150 TGGTGAGACTGCGGAGAAAAGGG - Intronic
951462568 3:22967225-22967247 TGGTGTGGCTGCGGAGAGGCAGG - Intergenic
952829687 3:37554344-37554366 TGGTGTGTCTGAGGAGGAGCAGG + Intronic
952968131 3:38633490-38633512 AGGTGTGCCTGTGGAGTTGTTGG - Intronic
953822193 3:46216370-46216392 TGGTGTGCCTGAGGAAGAAAGGG + Intronic
959182398 3:102998241-102998263 TGGTGAGGCTGTGGAGTAAAGGG + Intergenic
959667013 3:108933688-108933710 TGGTGAGGCTGCAGAGAAGAAGG + Intronic
960341583 3:116480667-116480689 TGGTGAGCCTGCAGAGAAAAGGG + Intronic
963322696 3:143826524-143826546 TAGTGTGCCTGCTGTGTACAGGG - Intronic
964084218 3:152797095-152797117 TGGTGAGCCTGCAGAGAAAAAGG - Intergenic
965332974 3:167400338-167400360 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
965787475 3:172351367-172351389 TGGTGTCCCTGTGGAGCAGCAGG + Intronic
966595747 3:181723547-181723569 TGGTGTCCATGCGGAGGAGAGGG - Intergenic
968090673 3:195896423-195896445 TGGTGTGCTTGGGGTGTGGAAGG - Intronic
968354390 3:198092845-198092867 TGGTGGGGCTGCGGAGAAAAGGG - Intergenic
968571126 4:1341271-1341293 TGGTGTGGATGTGGAGCAGATGG - Intergenic
970875788 4:20868350-20868372 TGGTGAGGCTGCAGAGTAAAGGG + Intronic
972994686 4:44865326-44865348 TGGTGTGGCTGCAGAGAAAATGG - Intergenic
974119987 4:57626695-57626717 TGGTGAGGCTGTGGAGAAGAGGG + Intergenic
979614431 4:122726431-122726453 TGGTGTGGATGCGGTGAAGAGGG + Intergenic
985188543 4:187345755-187345777 TGGTGTTCCTGCGTAGTGGGTGG - Intergenic
985229311 4:187798355-187798377 TGGTGTTCCTGCTGGGGAGATGG - Intergenic
987037542 5:14033194-14033216 GGGTGTGGCTGGGGAGGAGAGGG - Intergenic
987848756 5:23322273-23322295 TGGTGAGGCTGCAGAGAAGAGGG + Intergenic
988103288 5:26709586-26709608 TGGTGAGGCTGTGGAGTAAAGGG + Intergenic
990365434 5:55065805-55065827 TGGAGTTCCTGCAGAGTTGAAGG - Intergenic
995994979 5:118286971-118286993 TGGTGAGCTTGCAGAGTAAAGGG - Intergenic
999740558 5:154547025-154547047 TGGTGAGGCTGCGGAGAAAAGGG + Intergenic
999786926 5:154899170-154899192 TGGTAAGCCTGAGGAGTGGAGGG - Exonic
1000138880 5:158381990-158382012 GGGTGTGCCTGTGGAGGAGAGGG - Intergenic
1001330741 5:170760634-170760656 TGTTGAGCCTGGGGAGTAGTAGG - Intergenic
1001876925 5:175209774-175209796 TGTTGTGCATGAGGAGAAGATGG - Intergenic
1006425747 6:33961944-33961966 TGGTGTGCCTGGGGAGGGGGTGG - Intergenic
1007741949 6:44016958-44016980 TGGTGTGCCTGGAGAGGACATGG + Intergenic
1009773329 6:68173698-68173720 TGGTGAGGCTGTGGAGAAGAGGG + Intergenic
1011238718 6:85247307-85247329 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
1012146890 6:95695344-95695366 TAGTGTGGCTGCGGAGGAGTGGG + Intergenic
1013520173 6:110925441-110925463 GTGTGTGCATGCGCAGTAGAAGG - Intergenic
1020416613 7:7953348-7953370 CTGTGTGCCTTCTGAGTAGAGGG + Intronic
1020644219 7:10794509-10794531 TGGTGAGGCTGCGGAGAAAAGGG - Intergenic
1023497207 7:40810400-40810422 TGGTGAGGCTGCAGAGAAGAAGG - Intronic
1024708648 7:51989863-51989885 TGGTGTGGCTGTGGAGAAAAGGG - Intergenic
1028699942 7:93765779-93765801 TGGTGAGGCTGTGGAGAAGAGGG + Intronic
1032291059 7:130590928-130590950 TGGTGTGGCTGCCGGGCAGAGGG - Intronic
1034966275 7:155393172-155393194 TTGTGTGACTGCTGAGCAGAGGG + Intronic
1036766919 8:11555227-11555249 TGGGGTGGCTGGGGAGTGGAGGG + Intronic
1038320121 8:26518098-26518120 TTGTTTGCCTGAGGAGCAGATGG - Intronic
1041180666 8:55244697-55244719 TGGTGTGATTGCGGAGAAAAGGG - Intronic
1045162449 8:99563622-99563644 ATGGGTGCCTGCAGAGTAGAGGG + Intronic
1046024730 8:108708499-108708521 TGGTGAGGCTGCGGAGAAAAGGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049380880 8:142315237-142315259 GGGTGTGCCTGTGGAGACGACGG - Intronic
1049412324 8:142478785-142478807 TGGGGTGACTGTGGAGTAGTGGG + Intronic
1050372936 9:4940860-4940882 TTGTTTGCCAGCGGAGCAGAAGG + Intergenic
1057284660 9:93742321-93742343 TGGTGTCCCTGCAGAATTGATGG - Intergenic
1057783818 9:98072026-98072048 TGGGCTGCCTGGGGAGCAGAGGG - Intronic
1185699675 X:2221182-2221204 TGGGGTGACTGCTGCGTAGATGG + Exonic
1187459714 X:19475893-19475915 TGGGGTGCCTGCGGAAAAGAAGG - Intronic
1188681600 X:33015023-33015045 TGGTGGGGCTGCGGAGAAAATGG + Intronic
1189793118 X:44622269-44622291 TGGTGAGCCTGTGGAGAAGTAGG + Intergenic
1192493782 X:71599351-71599373 TGGTCTGGGTGCAGAGTAGAGGG + Intronic
1200802488 Y:7399270-7399292 TGGTGGGCTTGGGGAGTAGGAGG - Intergenic