ID: 1176248171

View in Genome Browser
Species Human (GRCh38)
Location 20:64107257-64107279
Sequence AATCTGAAGGTCCTTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176248166_1176248171 2 Left 1176248166 20:64107232-64107254 CCCAAGCTCATCTCTGGCTCCCT 0: 1
1: 0
2: 2
3: 28
4: 320
Right 1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1176248162_1176248171 20 Left 1176248162 20:64107214-64107236 CCCTTTGGAAACACACCTCCCAA 0: 1
1: 0
2: 4
3: 23
4: 197
Right 1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1176248163_1176248171 19 Left 1176248163 20:64107215-64107237 CCTTTGGAAACACACCTCCCAAG 0: 1
1: 0
2: 2
3: 16
4: 155
Right 1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1176248165_1176248171 5 Left 1176248165 20:64107229-64107251 CCTCCCAAGCTCATCTCTGGCTC 0: 1
1: 0
2: 1
3: 29
4: 281
Right 1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1176248167_1176248171 1 Left 1176248167 20:64107233-64107255 CCAAGCTCATCTCTGGCTCCCTT 0: 1
1: 0
2: 3
3: 39
4: 404
Right 1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176248171 Original CRISPR AATCTGAAGGTCCTTCCCTC AGG Intergenic