ID: 1176248171

View in Genome Browser
Species Human (GRCh38)
Location 20:64107257-64107279
Sequence AATCTGAAGGTCCTTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176248166_1176248171 2 Left 1176248166 20:64107232-64107254 CCCAAGCTCATCTCTGGCTCCCT 0: 1
1: 0
2: 2
3: 28
4: 320
Right 1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1176248165_1176248171 5 Left 1176248165 20:64107229-64107251 CCTCCCAAGCTCATCTCTGGCTC 0: 1
1: 0
2: 1
3: 29
4: 281
Right 1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1176248167_1176248171 1 Left 1176248167 20:64107233-64107255 CCAAGCTCATCTCTGGCTCCCTT 0: 1
1: 0
2: 3
3: 39
4: 404
Right 1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1176248163_1176248171 19 Left 1176248163 20:64107215-64107237 CCTTTGGAAACACACCTCCCAAG 0: 1
1: 0
2: 2
3: 16
4: 155
Right 1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1176248162_1176248171 20 Left 1176248162 20:64107214-64107236 CCCTTTGGAAACACACCTCCCAA 0: 1
1: 0
2: 4
3: 23
4: 197
Right 1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176248171 Original CRISPR AATCTGAAGGTCCTTCCCTC AGG Intergenic
903529808 1:24021556-24021578 CATTTGAAGCTCATTCCCTCAGG - Intergenic
906551110 1:46667426-46667448 AAGCTCCAGATCCTTCCCTCTGG + Intronic
906819096 1:48910719-48910741 ACCCTGAATGTCTTTCCCTCGGG - Intronic
909671739 1:78197190-78197212 AGTCAGAAGGTTCTTGCCTCAGG - Intergenic
910216161 1:84847269-84847291 ATTCTGAAGGCCCTTACCCCAGG - Intronic
911522281 1:98943267-98943289 AGTTTCAGGGTCCTTCCCTCTGG - Intronic
917290574 1:173468491-173468513 TTCCTGAAGATCCTTCCCTCAGG - Intergenic
917515754 1:175706622-175706644 CATCAGAAGGTGGTTCCCTCGGG - Intronic
918051225 1:180974159-180974181 AATTTGAAGGGCCTCCACTCAGG - Exonic
921906989 1:220505630-220505652 AAGATGAGGGTCCTTTCCTCAGG + Intergenic
922204575 1:223435296-223435318 ATTCTGAATGTACTTCCCTGTGG - Intergenic
922946859 1:229523749-229523771 ATTCTGCATGTCCTTCCCTCTGG - Intronic
1064787724 10:18917525-18917547 AAACTGAAGGTCTACCCCTCTGG - Intergenic
1065188573 10:23191821-23191843 AATCTAAGGGTGCTGCCCTCAGG - Intergenic
1066496382 10:35946414-35946436 AAGATGAAGTTCCTTCCCCCGGG - Intergenic
1068980772 10:63060263-63060285 AAGCTCTAGCTCCTTCCCTCAGG - Intergenic
1069477842 10:68751241-68751263 AATCTCAAACTCCTTACCTCAGG + Intronic
1070373428 10:75806935-75806957 ATTCAGAAGGTACTTCCCGCTGG + Intronic
1086457134 11:86970116-86970138 TATATGAAGGTCCTTACCACTGG + Intergenic
1086887374 11:92221794-92221816 AATCTGAAAGTGCTTTGCTCTGG - Intergenic
1087440974 11:98183498-98183520 GGTCTGAAGGTCCTTTCCTGAGG + Intergenic
1088471999 11:110196680-110196702 AATCTGCAGGTCCTCCCTCCTGG - Intronic
1090202081 11:124864373-124864395 AATCAGCAGGGCCTTACCTCAGG + Intergenic
1095786864 12:46119518-46119540 AGTCTGATCATCCTTCCCTCAGG - Intergenic
1096384877 12:51188712-51188734 CAGCTGACGGTCCTTCCCTCAGG + Exonic
1096846385 12:54409363-54409385 AATCTGAAGGCCCCTCCTCCTGG - Intronic
1098266819 12:68730180-68730202 AATCTCAAACTCCTGCCCTCAGG + Intronic
1099517456 12:83615101-83615123 CCTCTGAAGGTCCTTTCCTTAGG - Intergenic
1100506306 12:95224186-95224208 GATCTGCAGGTCCTTCCCACTGG - Intronic
1101051606 12:100869381-100869403 AACCTGCTGGTCATTCCCTCAGG - Intronic
1108427462 13:50318455-50318477 ATTCTGAATGTCGTTCCCTTTGG - Intronic
1110473542 13:75887433-75887455 AAACTGAAGTTCTTGCCCTCTGG + Intergenic
1110935058 13:81277384-81277406 TATCTGAAAGTCCTTCACGCTGG - Intergenic
1112943230 13:104892308-104892330 AATATAAAGATCATTCCCTCAGG + Intergenic
1115873135 14:37828649-37828671 AATATAAATGTCCTTCCATCTGG - Intronic
1117563527 14:56969765-56969787 TATCCTTAGGTCCTTCCCTCAGG + Intergenic
1121167289 14:91817048-91817070 AATCTGATGGTACTTTCATCAGG + Intronic
1121643238 14:95500387-95500409 AACCTGAAGGGGCTACCCTCAGG + Intergenic
1121897008 14:97657974-97657996 AAGCTGAAAGGCCTTCCCTTGGG + Intergenic
1122094729 14:99362688-99362710 AACCTGAAAGTCCCTCCCTAGGG - Intergenic
1124475132 15:30026552-30026574 GATCTGAAGCTCCTTTCCTGAGG + Intergenic
1125206036 15:37154414-37154436 AATCTGAAACTCCTGACCTCAGG - Intergenic
1133295093 16:4747736-4747758 AGTCTGAGGGTCCCTGCCTCTGG - Intronic
1133389112 16:5394961-5394983 AATCTGATGGTGTTGCCCTCTGG + Intergenic
1133408172 16:5543014-5543036 AATCAGAAGGCTCTTGCCTCAGG + Intergenic
1137879762 16:52033975-52033997 TAGCTGAAGATTCTTCCCTCTGG - Intronic
1139952005 16:70677090-70677112 AATCTGAAGCCCCCTCCCCCAGG + Intronic
1140241217 16:73202747-73202769 ATTTTGCAGGTCCTTCTCTCTGG + Intergenic
1141432520 16:83977774-83977796 AAACTTCAGGTCCTTCCCTGAGG - Intronic
1144313638 17:14038239-14038261 AATCTAAAGGTCCTGCCTTTTGG + Intergenic
1145106611 17:20123089-20123111 AATCTGATGGGCCTTCCCAAGGG + Intronic
1149046601 17:52253721-52253743 AATCTGAAGGATCTACCCTCAGG + Intergenic
1149271854 17:54988339-54988361 AATGTGAATGTCCTTCACTGGGG - Intronic
1151002536 17:70394711-70394733 ATGCTGCAGGTCCTTCCATCTGG - Intergenic
1203167573 17_GL000205v2_random:112254-112276 ATTATGAAGGTCCCACCCTCAGG + Intergenic
1154482525 18:14847727-14847749 AGTCTGAAAGGCCTTGCCTCAGG - Intronic
1155772546 18:29720265-29720287 AATGTGAATGTCCTTCCCATAGG - Intergenic
1156559391 18:38105477-38105499 AATCAGCAGGTGCTTCCATCTGG - Intergenic
1156609972 18:38714394-38714416 AATCTGAAGGTCCACTTCTCTGG - Intergenic
1158318135 18:56234909-56234931 AATCTGAAACTCCTGTCCTCGGG - Intergenic
1158696742 18:59710345-59710367 AATCTGATGCACATTCCCTCAGG + Intergenic
1160223312 18:76992750-76992772 CTTCTGAGGGCCCTTCCCTCTGG + Intronic
1162101215 19:8340414-8340436 AATCTGAGGGTGCTTCCCACAGG - Intronic
1163695904 19:18763315-18763337 AATCTCAAACTCCTGCCCTCAGG + Intronic
1163842795 19:19621543-19621565 AATCTGAAGTCCCTTTCCTAGGG + Intergenic
1164491756 19:28721026-28721048 AATTTGAATGTCATTTCCTCAGG + Intergenic
1168494167 19:56836586-56836608 ATCATGAAGGTCCTTCCCCCAGG - Intronic
1168532591 19:57141589-57141611 GATCTGAAGGTCTTTTCCTGAGG - Intronic
926421608 2:12705150-12705172 ACTGTGAAGATTCTTCCCTCTGG - Intergenic
926569060 2:14509512-14509534 AGACTGAAGGTCCTTTCCTGAGG - Intergenic
929040912 2:37743626-37743648 GATCTGAAGACCCTCCCCTCTGG - Intergenic
930131081 2:47851559-47851581 AATATGAAGGTCCATCACTGAGG + Intronic
931679905 2:64737423-64737445 AAACTGACGGTCCATCCCTGTGG + Intronic
933282300 2:80345317-80345339 CATCTGCAGGTCCTTCTGTCTGG + Intronic
935157965 2:100500683-100500705 ATTCTGGAGGTCCTTCCCTGAGG - Intergenic
937297695 2:120819663-120819685 AATCTGAAGGACTTTGCCACAGG + Intronic
940775851 2:157883399-157883421 AATCTGAAGTTACTTGCCTAGGG - Intronic
944238592 2:197463714-197463736 AATCTCAAGCTCCTGACCTCGGG - Intronic
945737780 2:213622262-213622284 GGCCTGAAGGTCCTTTCCTCAGG - Intronic
946543128 2:220707467-220707489 GATCTGAAAGTGCTTGCCTCTGG - Intergenic
947125418 2:226863604-226863626 ACCCTGAAGGTCCTTGCCACTGG - Intronic
1171516899 20:25745531-25745553 AATTTGAGGGTCCTTGCATCTGG + Intergenic
1172383070 20:34513078-34513100 ATTGTCAAGGTCCTTCCCTGTGG - Intergenic
1172621097 20:36319200-36319222 AATCAGCAGCTCCCTCCCTCCGG - Intronic
1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG + Intergenic
1176404185 21:6346881-6346903 ATTATGAAGGTCCCACCCTCAGG - Intergenic
1176432972 21:6642223-6642245 ATTATGAAGGTCCCACCCTCAGG + Intergenic
1176798075 21:13388901-13388923 AGTCTGAAAGGCCTTGCCTCAGG + Intergenic
1177086450 21:16711152-16711174 AATATGAAGAACCTTGCCTCTGG - Intergenic
1177555540 21:22683154-22683176 ACTCGGAAGGTTCTTGCCTCAGG - Intergenic
1177642602 21:23862886-23862908 AATCTGAAAGTCATGTCCTCAGG + Intergenic
1184667075 22:45994864-45994886 AAACTGGAGGTCTTTCCCCCAGG + Intergenic
1185169077 22:49281844-49281866 ATTCTGAAGGTCAAGCCCTCCGG + Intergenic
953143108 3:40247864-40247886 AATGTGTTGGTCCTGCCCTCAGG + Intronic
955529099 3:59854279-59854301 AATCTGTGGGTTCTTCCCCCTGG - Intronic
960346739 3:116542131-116542153 AATTTGACGGTCCATCCCTCTGG - Intronic
960393234 3:117104930-117104952 AATGTGAAGGCCATTCCCACAGG - Intronic
960684841 3:120285537-120285559 AATCTGAAGCTCCTCGCCCCGGG - Intergenic
961073302 3:123958172-123958194 ACTCTCAGGGTCCTTCCCTTTGG + Intronic
961180420 3:124871973-124871995 TATCTGCAGGTGGTTCCCTCTGG + Intronic
962269179 3:133965687-133965709 AATCTGAGGGTCCTCCTCACAGG - Intronic
969386867 4:6857201-6857223 ACTCTGAAGGTCTTTCAGTCTGG - Exonic
972726229 4:41748353-41748375 AAGCTGAAGGTCCTTACCTGCGG + Exonic
979511552 4:121559758-121559780 ACTCTCAAGGTTATTCCCTCAGG - Intergenic
981055779 4:140359767-140359789 CATCTGAAGGACCATCCCTGAGG - Intronic
985369044 4:189265712-189265734 AATCTCTAGGTCTTTCTCTCTGG + Intergenic
985796096 5:1963280-1963302 AATCTGAACGTCCTAACCTATGG - Intergenic
988634586 5:32969336-32969358 AATCTGATAGTCGTGCCCTCAGG - Intergenic
991394571 5:66190828-66190850 AGTCTGAAGCTCCTGACCTCAGG + Intergenic
995637501 5:114210863-114210885 AATGTGAGGGCCCTTCACTCTGG + Intergenic
996230102 5:121052714-121052736 ATTCTGAAGGTCTCTCTCTCTGG - Intergenic
998162336 5:139820694-139820716 AATATAAAGGTCATTCCCTTGGG - Intronic
999630945 5:153570900-153570922 ATTCAGAATGTCCTTCTCTCAGG + Intronic
1001328427 5:170745778-170745800 GGTCAGAAGGACCTTCCCTCGGG + Intergenic
1001409821 5:171503048-171503070 AATAAGAATGTCCTTCTCTCGGG - Intergenic
1001723829 5:173879591-173879613 AATCTGAAGGTACTTCTTTGGGG + Intergenic
1003497205 6:6674703-6674725 GATCTGAAGCTCCTGACCTCAGG + Intergenic
1003827128 6:9965514-9965536 AATCAGAAGGTACTTCCTTCAGG - Intronic
1007921547 6:45614754-45614776 AATGGGAAAGTCCTTCCCTCTGG + Intronic
1010457309 6:76072674-76072696 AATCTGCTTGTCTTTCCCTCAGG + Exonic
1015701169 6:136037565-136037587 AATCTGCAGCTGCTTCTCTCTGG - Intronic
1018535049 6:164810627-164810649 AATCTGATGGTGCATCCCTCAGG - Intergenic
1019369311 7:652622-652644 AATCTGGAGGTTCTGCCCTAGGG + Intronic
1021532064 7:21657771-21657793 CTTCTTAAGGGCCTTCCCTCTGG - Intronic
1026371248 7:69701877-69701899 AATCTCCACGTGCTTCCCTCTGG + Intronic
1029393470 7:100290649-100290671 AATCTCAAAGTCCTGGCCTCAGG - Intergenic
1030520231 7:110589256-110589278 AATCTCAAACTCCTGCCCTCAGG + Intergenic
1031083552 7:117280912-117280934 AAAATGAAGATCCTGCCCTCAGG + Intronic
1031390903 7:121213385-121213407 CATCTGAAGTTCCTACCCTGGGG + Intronic
1034886291 7:154801569-154801591 AATCTGAAGGTGGTTCCCGAAGG + Intronic
1037528858 8:19754971-19754993 AATCTCAAGGTCCTTTCATCAGG + Intronic
1041475208 8:58257612-58257634 AATCAGAAGGGCCCTCCTTCTGG - Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1044273220 8:90271461-90271483 AATCTGAAGTTTCTTCCACCTGG + Intergenic
1045664770 8:104472322-104472344 TATCTGAAAGTTCTTCCCCCAGG - Intergenic
1046757305 8:117984996-117985018 CATCTGAAAGACCTTACCTCAGG - Intronic
1048641569 8:136369416-136369438 AATCAGAAGGTTCTTCAATCTGG + Intergenic
1053307892 9:36996720-36996742 CTTCTGAAGCCCCTTCCCTCTGG + Intronic
1055059019 9:72049739-72049761 GGTCTGAAGGTCCTTTCCTGAGG - Intergenic
1055610917 9:78023137-78023159 AATCTCAAGTCCCTGCCCTCTGG + Intronic
1058318626 9:103601221-103601243 AGTTTGAAGGTCCTTTCCTGAGG - Intergenic
1058444466 9:105042241-105042263 AACCTGAATGTCCATCCATCTGG - Intergenic
1059057390 9:110998367-110998389 AAACTGAAGGTCATTCCACCTGG + Intronic
1060155012 9:121313462-121313484 AATCTGAACCTCCATCCCTGTGG - Intronic
1060969581 9:127730499-127730521 GATCTGCAGGTCTTTCCCTTTGG + Intronic
1203438563 Un_GL000195v1:166447-166469 ATTATGAAGGTCCCACCCTCAGG - Intergenic
1187973702 X:24683896-24683918 AGTCTGACGGTCTTTCCCCCTGG - Intergenic
1189759067 X:44302314-44302336 CATTTTAAGGCCCTTCCCTCAGG - Intronic
1193488716 X:82120305-82120327 AACCTGAAGCTTCTTCCCTTGGG + Intergenic
1194036654 X:88883421-88883443 AAAGTGAATGTCCTTCCCTGTGG + Intergenic
1195864680 X:109417104-109417126 AACCTGAAGATCCTCCCCTTAGG - Intronic
1196288998 X:113916578-113916600 AATCTTAAGTTCCTTCACACGGG - Intergenic