ID: 1176249361

View in Genome Browser
Species Human (GRCh38)
Location 20:64112921-64112943
Sequence GAGATGTAGGAGAGGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176249355_1176249361 0 Left 1176249355 20:64112898-64112920 CCTGGGTGATCTCAGTGTGTCTG No data
Right 1176249361 20:64112921-64112943 GAGATGTAGGAGAGGGCTGGAGG No data
1176249354_1176249361 1 Left 1176249354 20:64112897-64112919 CCCTGGGTGATCTCAGTGTGTCT No data
Right 1176249361 20:64112921-64112943 GAGATGTAGGAGAGGGCTGGAGG No data
1176249353_1176249361 7 Left 1176249353 20:64112891-64112913 CCGTGTCCCTGGGTGATCTCAGT No data
Right 1176249361 20:64112921-64112943 GAGATGTAGGAGAGGGCTGGAGG No data
1176249352_1176249361 15 Left 1176249352 20:64112883-64112905 CCTCAGGGCCGTGTCCCTGGGTG No data
Right 1176249361 20:64112921-64112943 GAGATGTAGGAGAGGGCTGGAGG No data
1176249349_1176249361 20 Left 1176249349 20:64112878-64112900 CCTGGCCTCAGGGCCGTGTCCCT No data
Right 1176249361 20:64112921-64112943 GAGATGTAGGAGAGGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176249361 Original CRISPR GAGATGTAGGAGAGGGCTGG AGG Intergenic
No off target data available for this crispr