ID: 1176253448

View in Genome Browser
Species Human (GRCh38)
Location 20:64138138-64138160
Sequence ATGCTGGGATAGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176253432_1176253448 20 Left 1176253432 20:64138095-64138117 CCTCTCAATGTCAGCGTTTTGGG No data
Right 1176253448 20:64138138-64138160 ATGCTGGGATAGATGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176253448 Original CRISPR ATGCTGGGATAGATGGGGCA GGG Intergenic
No off target data available for this crispr