ID: 1176255049

View in Genome Browser
Species Human (GRCh38)
Location 20:64147300-64147322
Sequence CATCTGAGGGAGGCTGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176255049_1176255059 -5 Left 1176255049 20:64147300-64147322 CCAGCCGCAGCCTCCCTCAGATG No data
Right 1176255059 20:64147318-64147340 AGATGTGTGGGGGGTGTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176255049 Original CRISPR CATCTGAGGGAGGCTGCGGC TGG (reversed) Intergenic
No off target data available for this crispr