ID: 1176255059

View in Genome Browser
Species Human (GRCh38)
Location 20:64147318-64147340
Sequence AGATGTGTGGGGGGTGTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176255050_1176255059 -9 Left 1176255050 20:64147304-64147326 CCGCAGCCTCCCTCAGATGTGTG No data
Right 1176255059 20:64147318-64147340 AGATGTGTGGGGGGTGTCCGCGG No data
1176255044_1176255059 12 Left 1176255044 20:64147283-64147305 CCTCTGTGATGCCCCCACCAGCC No data
Right 1176255059 20:64147318-64147340 AGATGTGTGGGGGGTGTCCGCGG No data
1176255048_1176255059 -2 Left 1176255048 20:64147297-64147319 CCACCAGCCGCAGCCTCCCTCAG No data
Right 1176255059 20:64147318-64147340 AGATGTGTGGGGGGTGTCCGCGG No data
1176255049_1176255059 -5 Left 1176255049 20:64147300-64147322 CCAGCCGCAGCCTCCCTCAGATG No data
Right 1176255059 20:64147318-64147340 AGATGTGTGGGGGGTGTCCGCGG No data
1176255043_1176255059 15 Left 1176255043 20:64147280-64147302 CCTCCTCTGTGATGCCCCCACCA No data
Right 1176255059 20:64147318-64147340 AGATGTGTGGGGGGTGTCCGCGG No data
1176255045_1176255059 1 Left 1176255045 20:64147294-64147316 CCCCCACCAGCCGCAGCCTCCCT No data
Right 1176255059 20:64147318-64147340 AGATGTGTGGGGGGTGTCCGCGG No data
1176255046_1176255059 0 Left 1176255046 20:64147295-64147317 CCCCACCAGCCGCAGCCTCCCTC No data
Right 1176255059 20:64147318-64147340 AGATGTGTGGGGGGTGTCCGCGG No data
1176255047_1176255059 -1 Left 1176255047 20:64147296-64147318 CCCACCAGCCGCAGCCTCCCTCA No data
Right 1176255059 20:64147318-64147340 AGATGTGTGGGGGGTGTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176255059 Original CRISPR AGATGTGTGGGGGGTGTCCG CGG Intergenic
No off target data available for this crispr