ID: 1176255820

View in Genome Browser
Species Human (GRCh38)
Location 20:64152414-64152436
Sequence CTGCAGACTCAGAGGGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 1, 2: 1, 3: 49, 4: 296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176255805_1176255820 30 Left 1176255805 20:64152361-64152383 CCCAGTGTGTAAGGGTACTTCCT 0: 1
1: 0
2: 0
3: 1
4: 84
Right 1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG 0: 1
1: 1
2: 1
3: 49
4: 296
1176255806_1176255820 29 Left 1176255806 20:64152362-64152384 CCAGTGTGTAAGGGTACTTCCTC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG 0: 1
1: 1
2: 1
3: 49
4: 296
1176255813_1176255820 7 Left 1176255813 20:64152384-64152406 CCTGCCGGGACTGCCAGGCGGGA 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG 0: 1
1: 1
2: 1
3: 49
4: 296
1176255816_1176255820 -6 Left 1176255816 20:64152397-64152419 CCAGGCGGGACGGCTTCCTGCAG 0: 1
1: 0
2: 0
3: 7
4: 208
Right 1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG 0: 1
1: 1
2: 1
3: 49
4: 296
1176255810_1176255820 10 Left 1176255810 20:64152381-64152403 CCTCCTGCCGGGACTGCCAGGCG 0: 1
1: 0
2: 1
3: 10
4: 173
Right 1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG 0: 1
1: 1
2: 1
3: 49
4: 296
1176255815_1176255820 3 Left 1176255815 20:64152388-64152410 CCGGGACTGCCAGGCGGGACGGC 0: 1
1: 0
2: 1
3: 12
4: 136
Right 1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG 0: 1
1: 1
2: 1
3: 49
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176255820 Original CRISPR CTGCAGACTCAGAGGGTCCA AGG Intronic
900124209 1:1062365-1062387 CTGCAGACTAGGAAGGTCCTGGG + Intergenic
900420589 1:2554394-2554416 ATGCAGACTCCAGGGGTCCAGGG - Intergenic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
902981583 1:20127195-20127217 CTGCAGACTCTCAGGGTTCCAGG - Intergenic
903049755 1:20591727-20591749 CTTCAGAGTCAGAGGTTCCTGGG + Intronic
903693526 1:25191349-25191371 ATACAGACTCACAGGATCCAGGG + Intergenic
903850427 1:26302521-26302543 CTGCAAACACAGATGGTCTACGG - Intronic
904289342 1:29474058-29474080 CTGCAGGTCTAGAGGGTCCAGGG + Intergenic
904485240 1:30820459-30820481 CTGCAGAATCAGAAACTCCAGGG - Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904812150 1:33170501-33170523 CTGAAGACTCAGCGAGGCCAGGG - Intronic
905168865 1:36098582-36098604 CTGCAGACCCAGGAAGTCCAGGG + Exonic
908185687 1:61650655-61650677 CTGCTTACACTGAGGGTCCATGG - Intergenic
909690293 1:78399259-78399281 CTGCAGAATCCAAGGGACCAGGG - Intronic
909884168 1:80919908-80919930 CTGCAGACTGAGAAGTTCGAGGG + Intergenic
910602521 1:89047389-89047411 CTGCAGAGGCAGAGGTTGCAGGG - Intergenic
913075746 1:115338929-115338951 CTACAGTTTCAGAGGGGCCAAGG - Intergenic
913220240 1:116654323-116654345 CTGCAGTCTCAGAGGGCTCACGG + Intronic
913452062 1:118999284-118999306 CTGCGGACTCAGTGGGTGGAGGG - Intergenic
916511517 1:165475888-165475910 CAGCAAAGTCAGAGGTTCCATGG - Intergenic
916547201 1:165817145-165817167 CTGTAAACCCAGAGGGTCCAGGG - Intronic
916598096 1:166265445-166265467 CTGCAGTCTCCCAGTGTCCATGG + Intergenic
917313813 1:173704167-173704189 CTCTAGGCTCAGAGGGTTCAGGG + Intergenic
918084229 1:181231606-181231628 CTGCAGGCTCAAAGAGTTCAGGG - Intergenic
920053745 1:203178505-203178527 CTGCTGGCCCTGAGGGTCCAGGG + Intergenic
920058111 1:203207324-203207346 CAGCAGATTCAGAGTCTCCAGGG + Intergenic
922986541 1:229870297-229870319 CAGGAGACCCAGAGGGCCCATGG + Intergenic
924060951 1:240173670-240173692 CTGCAGACACGGAGGAACCATGG + Intronic
1063024974 10:2168722-2168744 CTGCACACTCAGAAACTCCAGGG - Intergenic
1063056364 10:2509202-2509224 CTGCTGACTCAGAGGGTCCAGGG + Intergenic
1065352321 10:24806663-24806685 CTGCAGTCTCAGGGTGTCCATGG + Intergenic
1067057868 10:43062823-43062845 CTGCAGACACAGAAGTCCCAGGG - Intergenic
1067286747 10:44912596-44912618 GTGCAGCCTCAGAGGGGTCAGGG - Intronic
1067755241 10:49000141-49000163 CTGCAGTGGCAGAGGGGCCATGG + Intergenic
1067824565 10:49560865-49560887 CTGAAGACCCAGAGAGTTCAGGG - Intergenic
1068574240 10:58666115-58666137 CAGCAGATTCAGAGACTCCAGGG + Intronic
1068960540 10:62862596-62862618 CTGCAAAATCAGAGGGCCCTGGG + Intronic
1069460260 10:68588231-68588253 CTGCAGACTCACAAAGTGCAGGG + Intronic
1069519367 10:69106318-69106340 CTGTAGATTCAGAGGTTCAAAGG - Intergenic
1070816171 10:79324926-79324948 CTGGGGACTCAGAGACTCCAGGG + Intergenic
1072741546 10:97912927-97912949 CTGCTGATGCAGAGGGTGCAGGG - Intronic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1075194278 10:120341532-120341554 GTTCTGACTCAGTGGGTCCAGGG + Intergenic
1075259365 10:120949445-120949467 CTGCAGACACAGGGTGTGCAAGG - Intergenic
1075615612 10:123889144-123889166 CTGCAGACTCAGGGGTTACATGG - Intronic
1075733915 10:124652561-124652583 CTGCAGAGGCAAGGGGTCCAAGG + Intronic
1076837206 10:133027157-133027179 CCCCAGGCTCACAGGGTCCACGG - Intergenic
1079107235 11:17579362-17579384 CTTCAGTCTCAGAGCATCCATGG + Intronic
1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG + Intergenic
1080924806 11:36745048-36745070 CTTCAGGCTCAGTGGATCCAGGG - Intergenic
1081673960 11:44957489-44957511 CTGCAGACCCAGAGGACCCCAGG + Intergenic
1083706180 11:64518003-64518025 CTGCCGCCTCAGTGGGTCCCAGG + Intergenic
1083744591 11:64728360-64728382 CCTCAGCCTCAGAAGGTCCAGGG + Intronic
1084421889 11:69064396-69064418 CTGCAGTCAGAGAGGGTACAGGG - Intronic
1084520310 11:69658603-69658625 CGACAGGCTCAGAGGGCCCAGGG - Intronic
1086101696 11:83106896-83106918 TTGCAGACTCTGAGGGCCCATGG - Intergenic
1089005905 11:115090613-115090635 CTGAGGACACAGCGGGTCCAGGG + Intergenic
1089169911 11:116504752-116504774 CTGCAGACACACAGCGCCCAGGG - Intergenic
1089440668 11:118514105-118514127 CTGGAGACTCTGAGGGTACAAGG - Intronic
1091079344 11:132652105-132652127 CTGGATCCACAGAGGGTCCAGGG + Intronic
1094411602 12:30172792-30172814 ATGCAGACTCATAGGGTTCTGGG + Intergenic
1095257104 12:40051585-40051607 CTGAAGAGTCAGAGGGGCCTTGG + Intronic
1097077586 12:56406995-56407017 CTCCAGAGTCTGAGGGTCAAAGG + Intergenic
1099019721 12:77388618-77388640 CTGTAGATTCAGCAGGTCCATGG - Intergenic
1100578808 12:95919185-95919207 CAGCAGAGTCAGAGACTCCAGGG + Intronic
1100916191 12:99425047-99425069 CAGCAGATTCAGAGACTCCAGGG - Intronic
1101602320 12:106221469-106221491 CTGAAGACATTGAGGGTCCAGGG - Intergenic
1101656801 12:106729510-106729532 CTTCAGAGTCAGACAGTCCAGGG + Intronic
1101834538 12:108286291-108286313 CTGCAGCCTCAGATGAGCCATGG - Intergenic
1102947266 12:117000514-117000536 CTTCCGACTCAGTGGGTCGAGGG + Intronic
1103842441 12:123876108-123876130 CTGCACACTCGGAGGCTCCAGGG + Intronic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1105245603 13:18647194-18647216 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1106671628 13:31912240-31912262 CTGCAGATTCAGAATCTCCAGGG + Intergenic
1107677071 13:42808520-42808542 TTGCTGGATCAGAGGGTCCAGGG - Intergenic
1107716040 13:43200308-43200330 GTGCAGACTCAGAGTGGCCAAGG + Intergenic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1110155091 13:72307020-72307042 TTGTGGACTCAGTGGGTCCAAGG + Intergenic
1110360761 13:74622364-74622386 CTGCTGCTTCAGAGGATCCATGG - Intergenic
1111033890 13:82644604-82644626 GTGCAGTCTCACAGGGTCCTAGG + Intergenic
1112504249 13:99966048-99966070 CTGCAGTCCCAGAGGGATCAGGG + Intronic
1113010689 13:105762260-105762282 CAGCAGACTTAGAGAGGCCATGG + Intergenic
1113397908 13:109965841-109965863 CTGCCGACTCAGAATGTCCGCGG - Intergenic
1113523588 13:110956898-110956920 ATGCAGACGCTGAGGGTCCTTGG + Intergenic
1113697048 13:112354254-112354276 CTGCAGCCTCAGAGGGGCTTTGG + Intergenic
1113701678 13:112393337-112393359 ATGCAGACGCTGAGGGTCCTTGG - Intronic
1114791195 14:25660300-25660322 CTGCAGTCTCAGAGGATTCAAGG + Intergenic
1115430805 14:33316432-33316454 CTGCAGACTCAGAGAGACACAGG + Intronic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1118820581 14:69342862-69342884 CTGCAAACTCAGAGTGTTCAGGG - Intronic
1119261711 14:73241633-73241655 CTGCAGACTCACAGAGGGCAGGG - Intronic
1119986877 14:79148219-79148241 CTGGAAGCTCAGAGGGTTCATGG + Intronic
1120066789 14:80050958-80050980 CAGCAGATTCAGAGACTCCAGGG + Intergenic
1120611386 14:86646159-86646181 CTGCAGTCTGGGAGGGTCCCAGG - Intergenic
1121101057 14:91250624-91250646 TTGAAGCCTCAGAGGTTCCAGGG + Intronic
1121622765 14:95361639-95361661 CTGCAGAGTCCGAGGGTCTCCGG + Intergenic
1122423392 14:101591187-101591209 CTGCAGTCTCTGAAGGTCCCGGG - Intergenic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1125403352 15:39327777-39327799 CCTCAGACTCTCAGGGTCCAGGG + Intergenic
1125710353 15:41780337-41780359 CTTCAGACTCAGAGGGTTGGTGG - Intronic
1125987397 15:44067580-44067602 CTGCATCCTCAGAGGGTGGAGGG + Intronic
1126156063 15:45566641-45566663 CTTCAGACCCAGAGGGCCAAGGG - Intergenic
1127422105 15:58816486-58816508 CTGCAGCCTCAGATGGCTCAAGG + Intronic
1127722220 15:61714314-61714336 CAGCAGATTCAGAGACTCCAGGG - Intergenic
1128241347 15:66103257-66103279 CTGCAGACTTAGCTGCTCCAAGG - Intronic
1128744362 15:70103186-70103208 CTGCACACTCCAAGGGTCCTTGG - Intergenic
1129798822 15:78398088-78398110 CTGCAGACTCAGTAGGTCTGGGG - Intergenic
1131267300 15:90924262-90924284 CTGCAGACCCAGCTGGTCCTGGG - Intergenic
1131952421 15:97694942-97694964 CTGCACACACAGAGAGTCCAGGG + Intergenic
1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG + Intergenic
1132170676 15:99650853-99650875 CTGCAGATTCAGAAGGTCTAAGG - Intronic
1132878290 16:2149814-2149836 CTGCAGGCTCAGCGGGGCCAGGG - Intronic
1134223545 16:12374268-12374290 CTGCAGACTGTGTGAGTCCAGGG - Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136927093 16:34384513-34384535 CTGCAGACTCCTAGGATCCACGG + Intergenic
1136977481 16:35027294-35027316 CTGCAGACTCCTAGGATCCACGG - Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1139339094 16:66255892-66255914 CTGCAGAGCCAAAGGCTCCAAGG + Intergenic
1140509946 16:75499751-75499773 CTGAAGACTCAGCAGGACCATGG - Intergenic
1140938726 16:79700926-79700948 TTTGAGATTCAGAGGGTCCATGG + Intergenic
1142062516 16:88039887-88039909 GTGGGGACTCAGAGGGGCCACGG - Intronic
1142227749 16:88885745-88885767 CTGCAGACTCAGATGCTCCGGGG - Intronic
1143409031 17:6697358-6697380 CTGCAGACTCTGGGGCTGCATGG + Intronic
1143848120 17:9788523-9788545 CTGCAGACACAGTGGGTACAAGG + Intronic
1144306484 17:13973355-13973377 ATGAAGACTGAGAGGGCCCAGGG + Intergenic
1144888384 17:18479027-18479049 CTGTTGCCTCAGAGGCTCCACGG - Intronic
1145143822 17:20465275-20465297 CTGTTGCCTCAGAGGCTCCACGG + Intronic
1145792044 17:27633419-27633441 CCGCTGCCTCAGAGGCTCCATGG - Intronic
1150489391 17:65563878-65563900 CTGGTGGCTAAGAGGGTCCATGG - Intronic
1151822067 17:76501800-76501822 CTACAGACTAAAAGGGTCAAGGG - Intergenic
1151966535 17:77434467-77434489 CTGCAGACTCAGAGGCAGTACGG - Intronic
1151989565 17:77565519-77565541 CTGTAGAGTCAGAGAGTCCTGGG + Intergenic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1154106519 18:11528131-11528153 CTGCAGACCCTGAGGGCTCAGGG - Intergenic
1154443343 18:14412736-14412758 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1155667830 18:28332695-28332717 CAGCAGATTCAGAGACTCCAGGG + Intergenic
1156399543 18:36728122-36728144 CTTCAGTTGCAGAGGGTCCAGGG + Intronic
1157205207 18:45692066-45692088 CTGCTGCATCAGAGGGTCCAAGG - Intergenic
1157312498 18:46562609-46562631 CTGTAGACTCAGAGGCCACAGGG + Intronic
1157327984 18:46682623-46682645 CTGCATAGTCACAGGTTCCAGGG - Intronic
1157582764 18:48782906-48782928 CACCAGACTCAGAGAGCCCATGG + Intronic
1160886386 19:1350929-1350951 CTGGAGACCCAGGGGCTCCACGG - Intergenic
1161780938 19:6291422-6291444 CTCCAGAGTCTGAGGGTCAAAGG + Intergenic
1161781137 19:6292806-6292828 CTCCAGAGTCTGAGGGTCAAAGG - Intergenic
1165351573 19:35278800-35278822 CCGCAGACACTGAGGGTCCGGGG - Intronic
1165386352 19:35512693-35512715 CTGGGGACTCCGTGGGTCCACGG - Exonic
1165473126 19:36014768-36014790 CTGAAGGCCCAGGGGGTCCAGGG - Exonic
1167380294 19:49134426-49134448 GTGCAATCTCAGAGGGTTCAGGG - Intronic
1167484979 19:49757441-49757463 CTGAAGACTCAGAAGGTCTTGGG + Intronic
925846917 2:8043039-8043061 CTGCAGGGACAGAGGGGCCATGG + Intergenic
927185010 2:20475759-20475781 CTGCAGCCTCAGATGGGCCGTGG + Intergenic
927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG + Intronic
928781898 2:34833423-34833445 CTGCAGCCTCACAGGGTTCTTGG - Intergenic
929057472 2:37890952-37890974 CTACAGAATCAGAATGTCCAGGG + Intergenic
929557138 2:42932444-42932466 CTGCAGACTCTGAGATTGCAGGG - Intergenic
930878289 2:56244525-56244547 CTGCAGTCTCTTAGGGTCCCTGG - Intronic
930994375 2:57698589-57698611 CAGCAGACTCAGAGGATGCAGGG + Intergenic
931642666 2:64395540-64395562 CTGAAGACACTGTGGGTCCATGG + Intergenic
931707621 2:64960401-64960423 CTGCACACTCTGAGGGGCCAAGG - Intergenic
932421507 2:71604105-71604127 CAGCAGGTTCAAAGGGTCCAAGG + Intronic
932530495 2:72525088-72525110 CTGCAGACTCTGTCGGTCCCCGG - Intronic
933191603 2:79339944-79339966 CTGCAGACTCAGATGACCCCTGG - Intronic
933404987 2:81846632-81846654 CTGCAGATTTAAAGTGTCCATGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
936259829 2:110949198-110949220 GTCCATACTCAGAGGGTCCAAGG + Intronic
936536595 2:113316579-113316601 CAGCAGGCTCAGAGGCTACATGG + Intergenic
936721470 2:115256464-115256486 CCACAGGCTCAGAGGGTCCCAGG - Intronic
936839449 2:116752408-116752430 CAGCAGATTCAGAGGGGACAAGG - Intergenic
939100788 2:137892312-137892334 CTGCAGGCCCAGAGGATGCAGGG - Intergenic
939329128 2:140735624-140735646 CTGCAAACTCTGCGAGTCCAAGG - Intronic
939843708 2:147219386-147219408 CTGCAGGCTAATAGGGTCCTAGG + Intergenic
940084512 2:149843541-149843563 CTGCAGACTGAAAGTGTCCCAGG - Intergenic
941055499 2:160783396-160783418 CTGCAGGCCCAGAGGGTTTAGGG - Intergenic
941417092 2:165234238-165234260 CTGCAGACTAATATGGTCTATGG + Intergenic
942128910 2:172857803-172857825 CTGCAGTCTCAGACTCTCCAGGG - Intronic
943664186 2:190591179-190591201 CATCATACTTAGAGGGTCCAGGG + Intergenic
946434772 2:219644236-219644258 CAGCACACTCAGGGGGACCATGG + Intergenic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948208205 2:236173816-236173838 GGGAAGACTCATAGGGTCCATGG - Intergenic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171229957 20:23476113-23476135 CTGCAGCCTCCCAGGGTCCAGGG - Intergenic
1172231437 20:33339268-33339290 ATGCAACTTCAGAGGGTCCAGGG + Intergenic
1172249537 20:33469191-33469213 GAGGAGGCTCAGAGGGTCCAGGG + Intergenic
1172429409 20:34877021-34877043 CTGCAGACTTGGAGGGTCCGTGG + Intronic
1172637967 20:36422735-36422757 CTGCAGACACAGAGGCACCATGG + Intronic
1174803397 20:53584350-53584372 CTGCAGGCTCAGAGAAGCCAAGG + Intronic
1175795521 20:61767989-61768011 CTGCAGAATCAGGAGCTCCAAGG - Intronic
1175910868 20:62404956-62404978 CTGCAGGCCCAGAGCCTCCATGG - Intronic
1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG + Intronic
1176452749 21:6878472-6878494 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1176830922 21:13743521-13743543 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1176925374 21:14743205-14743227 CTTCAGATTCAGAGGGAACAAGG + Intergenic
1177118731 21:17116100-17116122 CTGCAGCCTCAGAGCCTCCTTGG - Intergenic
1177751087 21:25284717-25284739 CAGCAGATTCAGAGACTCCAGGG - Intergenic
1178623164 21:34193991-34194013 GTGGAGACTCAGAGGGTCTGGGG - Intergenic
1178805330 21:35834531-35834553 CTGGAGCCTCAGAGAGTTCAGGG - Intronic
1179419390 21:41223432-41223454 CTGGAGTCTCAGAGGATGCATGG - Intronic
1179802693 21:43818694-43818716 CTGCAGGCTGAGGGGGTCCTTGG - Intergenic
1180223648 21:46376082-46376104 CTGCAGACGGAGAGGGTAGAGGG - Intronic
1180821540 22:18832342-18832364 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
1180928383 22:19572053-19572075 TTGCAGAGACAGAGGGGCCAAGG - Intergenic
1181081592 22:20419272-20419294 CTGCAGACTCAGGGAGGCCCAGG + Intergenic
1181191438 22:21143703-21143725 CTGCAGTCTCAGAGGGCTCACGG - Intergenic
1181207760 22:21266807-21266829 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
1181266314 22:21632974-21632996 CTGCAGACGCATGGGGGCCATGG + Intronic
1182114614 22:27748913-27748935 CTGCAGAATCAGAGGGGTCATGG + Exonic
1182288154 22:29260069-29260091 CTGCCCACTCCGAGGGTCCTGGG - Exonic
1182520964 22:30884385-30884407 ATGTGGGCTCAGAGGGTCCAAGG + Intronic
1183193618 22:36337793-36337815 CTGCAGACCCCGAGGCTCCACGG + Intronic
1183440279 22:37819001-37819023 CTGCAGAATCAGAGGCTCTGAGG + Intergenic
1183752630 22:39730478-39730500 CTGCAGACTCTGAGGGGTCCTGG + Intergenic
1184355761 22:43978577-43978599 GTGAAGACTCAGAAGGTCCACGG - Intronic
1184411921 22:44330957-44330979 CTGCGGACCCAGAGGGGCCTGGG - Intergenic
1185314948 22:50174947-50174969 CTGCAGGTGCAGCGGGTCCAGGG + Intronic
1203219160 22_KI270731v1_random:28609-28631 CTGCAGTCTCAGAGGGCTCACGG - Intergenic
1203271665 22_KI270734v1_random:58218-58240 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
950638002 3:14329634-14329656 CTGCTGACTCAGAGGAACAAGGG + Intergenic
951574768 3:24102305-24102327 ATGCAGATTCAGTAGGTCCAGGG - Intergenic
952122764 3:30264335-30264357 AAGCAGACTCTGAGGGTCCTTGG - Intergenic
952578133 3:34799443-34799465 CAGCAGATTCAGAGACTCCATGG - Intergenic
952696622 3:36272194-36272216 CATCAGACTCAGTGGGACCATGG + Intergenic
952824546 3:37514087-37514109 CTGCAGACACCCAGGGGCCAAGG + Intronic
953867234 3:46595055-46595077 ATGTAGGCTCAGAGGGTTCATGG + Intronic
954292944 3:49659290-49659312 CTGCAGGCACAGAGGTCCCATGG + Intronic
954757233 3:52847702-52847724 CTACACACTCACAGGTTCCAGGG - Intronic
955391343 3:58524564-58524586 CTGCAGACTCAGATGTCCCCTGG - Exonic
956487039 3:69733850-69733872 CTGCAAGCTCAGAGGCACCAAGG - Intergenic
957538804 3:81541316-81541338 ATACAGCCTCAGAGGGTTCATGG + Intronic
957624722 3:82642924-82642946 CTCCAGAGTCTGAGGGTCAAAGG - Intergenic
957948083 3:87089563-87089585 CTGCAGGATCAGTGGGTCCTAGG - Intergenic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961331040 3:126138114-126138136 CTGTGGACTCAGATGGTCCCGGG + Intronic
961458185 3:127034463-127034485 CGGCAGAGTCTGAGGGTCCCGGG + Exonic
961810329 3:129518387-129518409 CTGCAGACTCAGTCAGTGCAAGG - Intronic
962825413 3:139096207-139096229 CTGCAGTCTCAGACTGTCCAGGG - Intronic
963724096 3:148899919-148899941 ATGCAGTCTCTGAGGGTCAATGG - Intergenic
964395823 3:156244544-156244566 GAGAAGACTCAGAGGATCCAAGG - Intronic
965205742 3:165717942-165717964 CTCCAGAGTCTGAGGGTCAAGGG + Intergenic
965513446 3:169594464-169594486 CTGCAGAATCAGAAATTCCAGGG + Intronic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968623279 4:1614235-1614257 CTGCAGACCCTGGGGCTCCACGG + Intergenic
969468642 4:7372757-7372779 AAACAGACTCAGGGGGTCCAGGG - Intronic
969694603 4:8727599-8727621 CTGCAGAGTCAGAGGGCTCAGGG + Intergenic
970003323 4:11386527-11386549 CAGCAGATTCTGAGGTTCCATGG - Intergenic
970941563 4:21640500-21640522 CTGCAGAATAAGAGATTCCAAGG - Intronic
971384885 4:26133497-26133519 CTGCAGACCCATATGGTCCATGG + Intergenic
973031156 4:45342007-45342029 CTGCAAACTCAGGGGCTCAAGGG + Intergenic
973077134 4:45943266-45943288 CTGCTAACTCGGAGGGTACATGG - Intergenic
973580792 4:52342199-52342221 CTGTAGACTAAAAGGGGCCAAGG - Intergenic
973875427 4:55213483-55213505 ATGCAGATTCAGCTGGTCCAGGG - Intergenic
975761609 4:77625626-77625648 CTGCAGGGTCAGGGGCTCCAGGG - Intergenic
976530089 4:86141864-86141886 CTGCAGGCTGAGAAGTTCCAGGG + Intronic
976922300 4:90455432-90455454 CTCCAGAGTCTGAGGGTCAAAGG + Intronic
977797050 4:101178930-101178952 CTGCTGACTAAGAGTGACCAGGG - Intronic
978347450 4:107787172-107787194 CTGCAGACCCAGATGTTCTATGG + Intergenic
979597523 4:122550705-122550727 TTGTAGACTCAGGGGGTACATGG - Intergenic
980299686 4:130972799-130972821 CTCCAGACTCAGTGGGTAGAAGG + Intergenic
981061197 4:140427280-140427302 CTGAAGACACAAAGGGTCCCAGG + Intronic
982072510 4:151707795-151707817 CAGCTGAAGCAGAGGGTCCATGG - Intronic
982772305 4:159407969-159407991 CTGCAGACGCAGAAGACCCATGG - Intergenic
983028910 4:162773442-162773464 CTGCAGGCTCACAGGGTTCAGGG + Intergenic
983537850 4:168877719-168877741 CTGGAGCTTCAGAGGGTCCCTGG - Intronic
985149473 4:186931202-186931224 CAGCAGAGTCTGGGGGTCCAGGG - Intergenic
985575122 5:670324-670346 CTGCAGGCCCAGAGAGCCCAGGG - Intronic
986314527 5:6577665-6577687 ATGCATATTCAGAGGGCCCATGG - Intergenic
986452639 5:7881476-7881498 CTGCAGGCTCAAAGAGTTCAAGG + Intronic
987076387 5:14386133-14386155 CTGCAGTTTAAGGGGGTCCAGGG + Intronic
988684049 5:33511103-33511125 ATGCAGATACAGATGGTCCAAGG - Intergenic
990947193 5:61261802-61261824 CTGCAGCCTCAGGGGCTCCTGGG - Intergenic
992028338 5:72693680-72693702 CTGGAGACTCTCAGGCTCCACGG - Intergenic
993025618 5:82642452-82642474 CTGGAGACCCAGAGAGTCAATGG + Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
997203377 5:132026395-132026417 GTGCAGATGCAGAGGGTTCAGGG + Intergenic
998142587 5:139708604-139708626 CAGCAGGCACAGAGGCTCCAAGG - Intergenic
998226364 5:140329802-140329824 CTGCAGGTTCAGAGGCTCCTAGG + Intergenic
999257011 5:150215343-150215365 CAGCAGATTCAGAGGGGCCATGG - Intronic
1000593099 5:163182415-163182437 CAGCAGACTCATAGGGTGGAGGG - Intergenic
1001217075 5:169866018-169866040 CTGAAGAGTCAGAGGGGCGAGGG + Intronic
1001217087 5:169866079-169866101 CTGAAGAGTCAGAGGGGCGAGGG + Intronic
1001410405 5:171507424-171507446 CTGCACACTCATAGGGTTCAGGG + Intergenic
1001420260 5:171581112-171581134 CTGGAGACTCCCAGGGTCCCGGG - Intergenic
1001555098 5:172631735-172631757 CTGCAGCCTCAGCTGGTCCTGGG + Intergenic
1001889805 5:175329397-175329419 CTGAAAACTCAGAGGCCCCAGGG + Intergenic
1001962092 5:175885648-175885670 CATCTGACTCAGAGAGTCCAGGG - Intergenic
1002434032 5:179220461-179220483 CCTCACACTCAGAAGGTCCAGGG + Intronic
1002441842 5:179268406-179268428 CTGCAAACTCAGAGCCTGCAGGG - Intronic
1005466526 6:26121404-26121426 CAGAAAACTCAAAGGGTCCAGGG + Intronic
1005810400 6:29510969-29510991 CTGCACACTCAGATTGTGCAGGG - Intergenic
1006612491 6:35302741-35302763 CTACTGACTCAGAGTTTCCAGGG - Intronic
1007595637 6:43049698-43049720 CTGCCGACCCAGAGGCCCCAGGG + Intronic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1011723294 6:90181887-90181909 CTGCAGAGTCAGAGAGACCTAGG - Intronic
1012445203 6:99300264-99300286 CTGGACACTCAGAGAATCCATGG + Intronic
1013485546 6:110592929-110592951 CTGCCTCCTCAGAGGCTCCAAGG + Intergenic
1014163384 6:118196031-118196053 CAGCAGATTCAGAGACTCCAGGG + Intronic
1017908764 6:158774934-158774956 ATGCAGACTCTAAGGCTCCATGG - Intronic
1017940896 6:159051954-159051976 CTGCCGAATCAGACGCTCCAAGG - Intergenic
1017965342 6:159259548-159259570 ATGCATACTCAGGGGCTCCATGG - Intronic
1018986398 6:168640403-168640425 CTGCAGACGCTGAGGGGCCCAGG + Intronic
1019714253 7:2531032-2531054 CCACAGGCTCAGAGGGGCCAGGG + Intergenic
1021982968 7:26072687-26072709 CTGAAAACTCAGAGAGCCCAGGG + Intergenic
1022471362 7:30683468-30683490 CTGCACCCTCAGAGTGCCCAGGG + Intronic
1022631866 7:32093011-32093033 CTGGGGACTAAGAGGGTTCATGG + Intronic
1023490053 7:40730024-40730046 CTGCTAATACAGAGGGTCCAGGG + Intronic
1025248771 7:57337823-57337845 GGTCAGACTCAGAGGCTCCAAGG + Intergenic
1027249383 7:76389589-76389611 CTGCAGCCCCTGAGGGCCCAAGG + Exonic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1028637341 7:93004448-93004470 CAGCAGATTCAGAGACTCCAGGG - Intergenic
1031198401 7:118646104-118646126 CAGCAGACTCAGAGACACCAGGG + Intergenic
1034883836 7:154782728-154782750 TTTCAGATTCAGAGGGTCTAGGG + Intronic
1037178679 8:15976489-15976511 CTTCAGCCACAGAGTGTCCATGG - Intergenic
1037922098 8:22814679-22814701 CTGCAGACAGAGAGGGACCATGG - Intronic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1038820037 8:30943663-30943685 CTGCAGACCCAGACGGTTCAAGG + Intergenic
1039757678 8:40540670-40540692 CTGCAAGCTCTGAGGGTCCCAGG - Intronic
1039838591 8:41277568-41277590 CTGCTGACTCAGAAGCTCCAGGG - Intronic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1040459253 8:47631191-47631213 CTTCAGAGTCAGAGGATCCATGG - Intronic
1041181076 8:55248808-55248830 CTGGAGTCTCAGAGTGTCCCAGG + Intronic
1041467707 8:58173717-58173739 CTGCAGATGCTGCGGGTCCAGGG - Intronic
1045615244 8:103901283-103901305 CCTCAGATTCAGAGGGTTCAGGG + Intronic
1046195600 8:110859982-110860004 CTGCAGGCTCAGTGGAGCCAGGG + Intergenic
1047860294 8:128958400-128958422 ATGTTGACTCAGAGGTTCCATGG - Intergenic
1048375548 8:133819493-133819515 ATGAAGACTCACAAGGTCCAGGG - Intergenic
1048379190 8:133849319-133849341 CTGCAGTCCCAAAGGGCCCAAGG - Intergenic
1048509935 8:135053171-135053193 CTGCAGATACAGAGGGCCAATGG - Intergenic
1054997044 9:71403809-71403831 CAGCAGTCTCTGAGGTTCCATGG - Intronic
1055067288 9:72131576-72131598 GTGCAGGCTCAGAGGGTTCAGGG - Intronic
1056361273 9:85860265-85860287 ATGCAGAAACACAGGGTCCAGGG - Intergenic
1056464484 9:86840214-86840236 TTTCTGACTCAGTGGGTCCAGGG + Intergenic
1059430581 9:114247793-114247815 CTGCAGGATCAGAGGATCCCTGG + Intronic
1060894410 9:127208447-127208469 CTGCAGAGTCAGACAGTCCTGGG + Intronic
1061055663 9:128221539-128221561 CTTTAAACCCAGAGGGTCCAAGG + Intronic
1061289896 9:129644736-129644758 CTGCAGACTACGAGGGCCCACGG + Intergenic
1062082229 9:134630169-134630191 CTGCACCCCCAGAGGCTCCAGGG + Intergenic
1062197173 9:135280775-135280797 ACCAAGACTCAGAGGGTCCAAGG + Intergenic
1062430415 9:136524458-136524480 CTGCAGACCCGGAGGCTCTACGG - Intronic
1203516432 Un_GL000213v1:6043-6065 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1187577719 X:20576089-20576111 CTGTAGACCCAGAGAGTTCAGGG - Intergenic
1190499200 X:51058373-51058395 CTGCATGCTCAGAGGGCCCAAGG + Intergenic
1190506737 X:51134074-51134096 CTGCATGCTCAGAGGGTCCAGGG - Intergenic
1193477106 X:81980051-81980073 CAGCAGATTCAGAGACTCCAGGG - Intergenic
1196186763 X:112752366-112752388 CAGCAGATTCAGAGACTCCAAGG + Intergenic
1197561268 X:128024853-128024875 CTGCACACACAGAGGGACCCTGG + Intergenic
1199155017 X:144536784-144536806 CTGCAGAGGCAGAGGCCCCATGG - Intergenic
1200054191 X:153450190-153450212 TTGCAGCCTCTGAGGGTCCATGG - Intronic
1201702445 Y:16899237-16899259 CAGCAGATTCAGAGACTCCAGGG + Intergenic