ID: 1176257824

View in Genome Browser
Species Human (GRCh38)
Location 20:64161596-64161618
Sequence CTTTGTGTGAGTGGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 437}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176257824_1176257830 3 Left 1176257824 20:64161596-64161618 CCTGCTCCCCCACTCACACAAAG 0: 1
1: 0
2: 1
3: 29
4: 437
Right 1176257830 20:64161622-64161644 TTTCTCAGCGAGTGCGGCTGCGG 0: 1
1: 0
2: 0
3: 3
4: 58
1176257824_1176257831 14 Left 1176257824 20:64161596-64161618 CCTGCTCCCCCACTCACACAAAG 0: 1
1: 0
2: 1
3: 29
4: 437
Right 1176257831 20:64161633-64161655 GTGCGGCTGCGGCGTAAGTTTGG 0: 1
1: 0
2: 0
3: 2
4: 14
1176257824_1176257829 -3 Left 1176257824 20:64161596-64161618 CCTGCTCCCCCACTCACACAAAG 0: 1
1: 0
2: 1
3: 29
4: 437
Right 1176257829 20:64161616-64161638 AAGCGCTTTCTCAGCGAGTGCGG 0: 1
1: 0
2: 0
3: 6
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176257824 Original CRISPR CTTTGTGTGAGTGGGGGAGC AGG (reversed) Intronic
900529228 1:3144531-3144553 CTTGGGGTGGGTGGGGGAGGGGG + Intronic
900589956 1:3455038-3455060 CCTGGTGTGTGTGGGGGGGCGGG - Intronic
902257723 1:15200936-15200958 CTTCGTGGGAGTGGGGGGCCCGG + Intronic
902645464 1:17794849-17794871 CCTTGTGGGAGTGGGAGAGGGGG + Intronic
902885033 1:19398512-19398534 ACGTGTCTGAGTGGGGGAGCGGG + Intronic
902994711 1:20215054-20215076 CTGTCTGTGTGTGGTGGAGCTGG + Intergenic
904011407 1:27392485-27392507 CTTTTTATGAATGGGGGAGCGGG + Intergenic
904043667 1:27598288-27598310 GTTTGTGTGTGTGGTGGAGGGGG + Intronic
904047759 1:27618923-27618945 CTCTGTGTGAGGGTGGGAGGCGG - Intronic
904562560 1:31408592-31408614 GTTTGTGTGTGTTGGGGAGGGGG - Intergenic
904802799 1:33107277-33107299 CTTTGTGTGTGTGTGTGAGATGG - Intronic
905160768 1:36031886-36031908 ATATGTGTGTGTGGGGGGGCGGG + Intronic
906038116 1:42766012-42766034 CTGTGTGTGTGTGGGGGCGGGGG - Intronic
906150436 1:43584312-43584334 CTCTGTGAGGGTGAGGGAGCCGG + Intronic
909802732 1:79832894-79832916 CTTTGTGTGTGTGTGGGGGGGGG - Intergenic
910566293 1:88646825-88646847 CTTTGTGTAGGTTGGGGAGCTGG - Intergenic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
911027223 1:93448300-93448322 CTGTGGGTGAGTCGGGGAGAGGG + Exonic
911088283 1:93997911-93997933 CCTTGTGGGAGAGGAGGAGCTGG + Exonic
911381377 1:97119424-97119446 GTGTGTGTGTGTGGTGGAGCAGG + Intronic
913097679 1:115534859-115534881 CTCTCAGTGAGAGGGGGAGCTGG - Intergenic
913984364 1:143551721-143551743 CTTTGTTTGGCTGGGGGAGGGGG + Intergenic
914821081 1:151103647-151103669 CTCTGTGTGAGTTGGAGAGGGGG - Exonic
915310679 1:155004478-155004500 GTTGGTGTGTGTGGGGCAGCAGG - Intronic
915356237 1:155256513-155256535 CTGTGTGTGAGTGTGTGTGCTGG - Intronic
915461918 1:156075580-156075602 CTTTGGAGGAGTGGGGGAGAGGG + Exonic
915655236 1:157353850-157353872 ATTTGTGGGAGTAGGGAAGCGGG - Intergenic
915731617 1:158058194-158058216 CTTTGAGTCAGTGGTGGTGCAGG - Intronic
915912139 1:159922088-159922110 GTGTGTGGGAGAGGGGGAGCTGG - Intronic
916398499 1:164418949-164418971 CTTTGTGTGAGTGGTTGACATGG - Intergenic
917644316 1:177015027-177015049 ATTTATGTGAGTGGTGGAGAGGG - Intronic
918149106 1:181782859-181782881 CTTGGTGGGAGAAGGGGAGCGGG + Intronic
918239985 1:182612486-182612508 CTTTTTGTAACTGTGGGAGCTGG - Intergenic
918508574 1:185284958-185284980 CTGTGTGTGAGTGTGGCTGCAGG - Intronic
922138379 1:222855241-222855263 GTTTGTGTGAGAGGGGCAGAGGG - Intergenic
922434803 1:225593389-225593411 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
922572905 1:226644341-226644363 CGTCCTGTGAGTGGGCGAGCAGG - Intronic
924677141 1:246190702-246190724 TTGTGTGTGAGTTGGGGAGGGGG - Intronic
1062768861 10:84442-84464 CTTTGTGTGTGTGTGTGAGTAGG - Intergenic
1063548515 10:7005729-7005751 CTGTGTGTGAACGGTGGAGCAGG + Intergenic
1063654772 10:7977154-7977176 GTTTGTGAGAGTGGGAGAGTAGG + Intronic
1064143352 10:12808173-12808195 CTTTGTGGGAGTGGAGGAAGTGG - Intronic
1065092745 10:22252014-22252036 TTGTGTGTGGGTGGCGGAGCAGG - Intergenic
1068571652 10:58636443-58636465 CTTTTTGTGTGTTGGGGAGGAGG - Intronic
1069744213 10:70704695-70704717 CTATGTGTGAGTGTGGGTGTAGG - Intronic
1071838635 10:89445353-89445375 CTTTGTCTGAGAGGGGCACCTGG - Intronic
1073780493 10:106833009-106833031 GTTTGTGTGGGTGGGTGAGTGGG + Intronic
1073996317 10:109318989-109319011 ATGTGTGTGAGTTGGGGAGAAGG + Intergenic
1074259958 10:111842512-111842534 CTCTGGGTGAGTGGGTGAGTGGG + Intergenic
1074685713 10:115960752-115960774 CTGTGTGTGTGTGAGGGAGGAGG - Intergenic
1075425302 10:122337366-122337388 CTTTGTGGGGGTGAGGGAGAGGG + Intronic
1075496334 10:122922564-122922586 CTTTGTTTGAGTAGAGGAGAGGG + Intergenic
1075518896 10:123132288-123132310 CTTTGTGTGTGTGGTGGGCCTGG + Intergenic
1075675146 10:124291077-124291099 TTTTCTGGGACTGGGGGAGCTGG - Intergenic
1075788984 10:125069882-125069904 GTTTGTGTGGGGGGGGGAGGGGG - Intronic
1076729282 10:132430145-132430167 CTGTGTGTGTGAGGGAGAGCAGG + Intergenic
1077036852 11:499497-499519 CTCAGTGTGTGTGGGGGACCCGG - Intronic
1077477181 11:2795961-2795983 CCCTGTGTGAGTGGGGCAGGGGG - Intronic
1078142498 11:8702395-8702417 CCCTGTGTGGGTGAGGGAGCAGG - Intronic
1078621692 11:12914562-12914584 CTTGGGGTGGGTGGGGAAGCTGG - Intronic
1079084056 11:17432763-17432785 CTGTGTGCGGGTGGGGTAGCTGG + Intronic
1079420043 11:20277279-20277301 TTTTGTGTGTGTGGTGGGGCTGG - Intergenic
1080953891 11:37069675-37069697 CTTCTTTTGAGTGGGTGAGCTGG + Intergenic
1081025285 11:38005071-38005093 CTTTGTGGGGTGGGGGGAGCGGG + Intergenic
1082311472 11:50654453-50654475 CGTTGTGGGATTGGGGGAGGGGG + Intergenic
1082983457 11:59145078-59145100 CCTTGTGTGCTGGGGGGAGCGGG + Exonic
1083173629 11:60936605-60936627 CCCTGTGAGAGTGGGGGAGGAGG + Exonic
1083741603 11:64714221-64714243 CTTTGAGAGGGTGAGGGAGCGGG - Intronic
1084011078 11:66348666-66348688 GATTGTGTGTGTTGGGGAGCAGG - Intronic
1084343732 11:68528422-68528444 ATTTGTGTGTGTGGGGGGGGGGG + Intronic
1085196289 11:74673896-74673918 CTTTGTGTGTGTTGGGTAGGGGG - Intergenic
1085227875 11:74938826-74938848 CTTTGTGTGATTGTGGGGGATGG - Intronic
1086905973 11:92418425-92418447 CTGTGTGTGTGTGGGGGGGTGGG - Intronic
1088378257 11:109165522-109165544 ATTTGAGTGAGTGCTGGAGCAGG - Intergenic
1088869341 11:113877913-113877935 CTTTGTGTGTGTGTGTGTGCGGG - Intergenic
1089671432 11:120059778-120059800 CCTTGTGTGAGTGGCTTAGCTGG + Intergenic
1089689981 11:120181111-120181133 CTTGATGTGTCTGGGGGAGCAGG + Intronic
1090868091 11:130719742-130719764 CTTTGTGTGCTTGGAGGGGCTGG + Intergenic
1091077421 11:132633523-132633545 CTTCCTGTGACTGGGGGAGTGGG - Intronic
1091395612 12:152692-152714 CTGTGTGTGTGTGGGGTGGCAGG - Intronic
1091670613 12:2449648-2449670 CTGTGTGGGAGTGGTGGAGAGGG - Intronic
1092126724 12:6079897-6079919 CAGTGTGTGAGGTGGGGAGCAGG - Intronic
1093698127 12:22186049-22186071 CTTTGTGTGTGTGGGTGGGCGGG - Intronic
1093704014 12:22254803-22254825 CTTTGAGTGAGTGGGAAAACGGG - Intronic
1093728352 12:22541612-22541634 ATTTGTGTGTGTAGGGGAGTGGG - Intronic
1095683246 12:45003089-45003111 CTGTGAGTGAGAGGGAGAGCAGG - Intergenic
1097661341 12:62434921-62434943 CTGTGTCTGAGTGGGGAAGCAGG + Intergenic
1098699501 12:73606470-73606492 CTTTGTGTCAGAGGGGCACCAGG - Intergenic
1100406279 12:94275338-94275360 TTTGGTGGGAGTGTGGGAGCCGG + Intronic
1100771587 12:97928735-97928757 CTTTGTGTGTGTGGAGCAGGGGG + Intergenic
1100984999 12:100195291-100195313 CTCTGTGTGTGTAGGGGGGCTGG - Intergenic
1101339640 12:103831522-103831544 TTTTCTGTGTGTGGGGGGGCAGG - Intronic
1102196837 12:111032571-111032593 CTTTTTTTGAGTGGGGAAGAGGG + Intergenic
1102561084 12:113762766-113762788 GGTGGTGTGAGTGAGGGAGCGGG - Intergenic
1102606978 12:114075359-114075381 CCTTGTGGGTGTGAGGGAGCTGG + Intergenic
1103313308 12:120030139-120030161 CTTTGTGTGAGTGAGTGATGAGG + Intronic
1104606960 12:130196927-130196949 CTGGGTGAGAGTGGGGGAGATGG + Intergenic
1106080619 13:26497544-26497566 CCAAGTGTGAGTCGGGGAGCAGG - Intergenic
1106291543 13:28367698-28367720 TTTTGTGTGTGGGGGGGAACAGG - Intronic
1106325166 13:28682154-28682176 CTTTGGGTCAGTGGAGGATCAGG + Intergenic
1107385065 13:39899214-39899236 CACTGAGTGAATGGGGGAGCTGG + Intergenic
1108950404 13:56085956-56085978 CTTTGTTTGCCTGGGGGTGCTGG + Intergenic
1109854025 13:68105713-68105735 TTGTGTATGTGTGGGGGAGCAGG - Intergenic
1110595313 13:77314844-77314866 CTATGCGTGAGTGGGGGAAAGGG + Intronic
1111649728 13:91074013-91074035 GTGTGTGTGATTTGGGGAGCGGG + Intergenic
1112439355 13:99414664-99414686 CATTGTGTGAGTGGGTGTGTAGG - Intergenic
1112582885 13:100691513-100691535 TTTTTTGTGGGTGGGGGAGAAGG + Intergenic
1112726494 13:102310685-102310707 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1113245861 13:108394619-108394641 CTATGTGTGTGTGGGGGGGGAGG - Intergenic
1113636464 13:111922269-111922291 CTCTGTGTCCCTGGGGGAGCTGG - Intergenic
1114579451 14:23744287-23744309 CTTTGTCTCAGTGGGGCACCCGG + Intergenic
1114684179 14:24512706-24512728 GTTGGTGTCAGTGGTGGAGCTGG + Intergenic
1115212740 14:30984134-30984156 CTTTGTGTGTGGGGGGGGGTTGG - Intronic
1117332854 14:54730720-54730742 ATTTGTGTAAGTGGGGTAGAAGG - Intronic
1117938192 14:60931303-60931325 CTTTGTGTGAGAGCTGCAGCAGG + Intronic
1118757244 14:68853934-68853956 CCTGGTGTGGGTGGAGGAGCCGG - Intergenic
1119009111 14:70965277-70965299 CTTAGTGTGGGTTGGGGAGTGGG + Intronic
1119064591 14:71512644-71512666 TTTTGTGTGTGGGGGGAAGCCGG + Intronic
1120384835 14:83831643-83831665 CTTTGTGTGTGTGTGTGTGCCGG + Intergenic
1121657159 14:95605470-95605492 CTCTGTGTGTGTGGAGGGGCAGG + Intergenic
1121817511 14:96939923-96939945 CCCTCTGTGAGTGGGGGAGTGGG - Intergenic
1122118206 14:99537997-99538019 CTCTGTCAGAGTGAGGGAGCCGG - Intronic
1122262508 14:100531360-100531382 CTGTCTGTGGGTGGGGAAGCTGG + Intergenic
1123633736 15:22281194-22281216 TTTTGTGTGTGGGGGGGAGAGGG - Intergenic
1124004381 15:25784573-25784595 GTTTGTGGGAGTGGGGGAAGGGG + Intronic
1124068998 15:26373736-26373758 CTTTGTGTGTGTGGTGGGGTGGG + Intergenic
1125460170 15:39898848-39898870 CACTGTGTGGGTGGGGGAGAAGG + Intronic
1127701933 15:61509632-61509654 GTTTGTGTGAGTGGGGAGGGGGG - Intergenic
1128028739 15:64461013-64461035 CGTTGCGTGGGTGGGGGAGGGGG + Intronic
1128055402 15:64695691-64695713 GTGTGTGTGAGTGGGGGTGGAGG + Intronic
1128765094 15:70246507-70246529 CTTTCTGTGGGTGTTGGAGCAGG + Intergenic
1128859634 15:71055842-71055864 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1130292776 15:82618925-82618947 CTTTGTGTATGTGGGGCAGGGGG + Intronic
1130303543 15:82698438-82698460 CTATGAGGGTGTGGGGGAGCGGG - Intronic
1130612030 15:85370011-85370033 CTTTTTGTGTGTGGGGGTGGGGG - Intergenic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1132107103 15:99070968-99070990 CATTGTGTGAGGGGGGGAAAGGG + Intergenic
1132767337 16:1541195-1541217 CCTGCTGTGAGTGGGGAAGCAGG + Intronic
1132801776 16:1758190-1758212 CTCTGTGTGACGGGGGGAGTGGG + Intronic
1134391686 16:13825697-13825719 CTTTGTGTGGGCCTGGGAGCCGG - Intergenic
1135188901 16:20338390-20338412 ATCTGGGTGAGTGTGGGAGCTGG - Intronic
1136498618 16:30658907-30658929 CTTCTTGTGTGTGGGGGAGGAGG - Exonic
1138349992 16:56341352-56341374 CTGCTTGTGAGTGGCGGAGCTGG - Intronic
1138576724 16:57912114-57912136 GTGTGTGTGTGTGGAGGAGCAGG + Intronic
1139060136 16:63240661-63240683 GTTTGTGTGTGTGGGGGGGGGGG - Intergenic
1139119519 16:63998455-63998477 CTGTGGGTGAGTGGGGGTGGGGG + Intergenic
1139212971 16:65098841-65098863 TTTGGTGTGTGTGGGGGAGGTGG + Intronic
1139628300 16:68209828-68209850 CTGTGTGTGTGTTGGGGGGCAGG - Intronic
1139780607 16:69348450-69348472 CTTTGTGTGTGCGGGGGGGAGGG + Intronic
1140294573 16:73695842-73695864 CTGGGTGTGAGTGGGAGAGAAGG - Intergenic
1140744350 16:77968149-77968171 GTTTCTGTGAGTGGGGAATCTGG + Intronic
1140836985 16:78803911-78803933 GTGTGTGTGGGTGGGGGAGGTGG + Intronic
1142921092 17:3187229-3187251 CTTTGTGGGGTGGGGGGAGCGGG - Intergenic
1143087470 17:4426838-4426860 GTGTGTGTGAGTGGGGGTGTGGG + Intergenic
1143387807 17:6542448-6542470 CTTTGTGTGTGAGGGAGAGAGGG - Intronic
1143448201 17:7020927-7020949 CTTTCTGTGATTGGGGGTCCTGG - Intergenic
1143712893 17:8746006-8746028 CTCTGTCTGGGAGGGGGAGCGGG + Intergenic
1144426263 17:15145106-15145128 CTCTGTGTGTGTGGGGGAGGGGG - Intergenic
1144840719 17:18184107-18184129 CCATGCGTGAGTGGGGGACCCGG - Intronic
1145020891 17:19429818-19429840 CTTTGTGTGTGTGAGAAAGCTGG - Intergenic
1145316606 17:21738897-21738919 CTTGGTGGTGGTGGGGGAGCGGG - Intergenic
1145948624 17:28798046-28798068 TTTTGTGTGGCTGGGGGACCGGG - Intronic
1146131294 17:30278666-30278688 CTTTTTTTGTGGGGGGGAGCGGG + Intronic
1149539099 17:57455286-57455308 CTGTGTGTGAGTTGGGGGGCAGG - Intronic
1149611702 17:57962261-57962283 CTGTGTGGGACTTGGGGAGCAGG + Intergenic
1150064738 17:62099584-62099606 CTTTGTGTGTGTGTGGGTGTGGG + Intergenic
1150198296 17:63325053-63325075 CTTTGTGTGGGGTGGGGGGCGGG + Intronic
1150246728 17:63681605-63681627 CTTTGTTTGCCTGAGGGAGCTGG + Intronic
1150426392 17:65080584-65080606 CCTTCTGTGAGTGTGGGAGGGGG + Intergenic
1151373490 17:73666057-73666079 CTTTTTATCAGTGGGGAAGCAGG - Intergenic
1152027713 17:77822512-77822534 GTGAGTGTGAGTGGAGGAGCGGG - Intergenic
1152369923 17:79880429-79880451 ATTTGTGTGTGTCGGGGAACGGG - Intergenic
1152616066 17:81338450-81338472 CTGTGTGTGGGTTGGGGAGGGGG + Intergenic
1152993673 18:386091-386113 CCTTTTGTGGGTGGGGGAGAAGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1155549290 18:26948241-26948263 CTTTCAGGGAGTGGGGGACCAGG + Intronic
1155951644 18:31920007-31920029 CTTTGACTGAGTTGGGGAGAAGG - Intronic
1156586791 18:38439895-38439917 CATTGTGAGAGAGGAGGAGCTGG + Intergenic
1156744341 18:40370860-40370882 CTGTGTGTGAGTGAGTGAGAGGG - Intergenic
1156894717 18:42232610-42232632 TTTTTTGTGAGTGTGGGAGGGGG + Intergenic
1157206975 18:45709096-45709118 CTTTTAGTCAGTGGGGGAGATGG - Intergenic
1158413547 18:57229846-57229868 CTGTTGGGGAGTGGGGGAGCTGG + Intergenic
1159953361 18:74501847-74501869 CACTGTGTGTGAGGGGGAGCCGG - Intronic
1161557825 19:4954516-4954538 CGTCTTGTGTGTGGGGGAGCAGG + Intronic
1162465632 19:10838036-10838058 CTTTGGGAGGGTGAGGGAGCAGG - Intronic
1163767109 19:19169939-19169961 TTTGGTGTGAGTTGGGGAGTTGG - Intronic
1163829683 19:19541709-19541731 CTGTGTGGGCGTGGGGGACCGGG - Intronic
1164500949 19:28819754-28819776 TTTTGTGTGAGTGATGCAGCAGG + Intergenic
1164906001 19:31968573-31968595 TATTGTGTGAGTGGAGGAGTGGG + Intergenic
1165824910 19:38700208-38700230 GTTTGTGTGACTGAGTGAGCCGG + Intronic
1166257244 19:41615297-41615319 CTGTGTCTGGGAGGGGGAGCTGG + Intronic
1166445685 19:42855955-42855977 CTGTGTGTGTGTGGGGGGGGGGG - Intronic
925338100 2:3113386-3113408 CGTGGTCTGAGTGGAGGAGCTGG - Intergenic
926238878 2:11069750-11069772 CTCTGTGTGGGTGGGGGTGCAGG + Intergenic
927229120 2:20802585-20802607 CTTTGAGTGAGTGGAAGAGAGGG - Intronic
927322886 2:21768938-21768960 GTGTGTGTGTTTGGGGGAGCCGG + Intergenic
927463543 2:23320445-23320467 CTGTGTGTGTGTGGGGGGGCGGG - Intergenic
928074102 2:28247282-28247304 CTGTGAGTTAGTGAGGGAGCAGG - Intronic
928282195 2:29957695-29957717 GTTTGTGTGTCTGGGGGAGGGGG - Intergenic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929942946 2:46348636-46348658 CTTTGTGTGGGTGGAGGAATTGG - Intronic
930091503 2:47534522-47534544 CTTTCTGTGTGTGGGGGCGGGGG - Intronic
930245545 2:48979817-48979839 GTGTGTGTGTGTGTGGGAGCGGG + Intronic
930430463 2:51269022-51269044 TTTTGTGTGATTGTGGGAGAAGG - Intergenic
930676645 2:54208416-54208438 TGTTGTGTGGGTGTGGGAGCCGG + Intronic
933495351 2:83043653-83043675 CTTTTTGGGAGTGGGGGACAAGG + Intergenic
935697468 2:105782673-105782695 GTTTCTGAGAGTGGGGGATCCGG + Intronic
935789953 2:106581917-106581939 CGTTGTGTGTGTGGGGGGGCGGG - Intergenic
935791003 2:106590131-106590153 CTTTGTGAGATTGCAGGAGCAGG - Intergenic
936657680 2:114506689-114506711 TTTTGTGGGAGGGGGAGAGCAGG - Intronic
937246140 2:120495202-120495224 CTTTGTGTGTGTGTGGGGGGGGG - Intergenic
938965639 2:136386055-136386077 CTTTGAGTGAGCTGGGGAGAAGG + Intergenic
939420208 2:141957372-141957394 GTTTGTGTGTGTGGGGGGGGGGG + Intronic
939646977 2:144712160-144712182 CTTTGTTTGATTGTGGGAGAGGG - Intergenic
939863589 2:147446905-147446927 CTTGGTGTGTGTGTGGGAGGGGG + Intergenic
940359245 2:152779825-152779847 ATTTGTGTGTATTGGGGAGCAGG + Intergenic
940754933 2:157671327-157671349 TGTTGTGGGATTGGGGGAGCGGG - Intergenic
940755561 2:157677759-157677781 TGTTGTGGGATTGGGGGAGCAGG + Intergenic
941200159 2:162498480-162498502 CTCTGTGTGTGTGGGGGGGAGGG + Intronic
941291298 2:163678918-163678940 ATGTGTGTGAGTGGGGTAGTAGG - Intronic
941658685 2:168171857-168171879 TTTTGTGTGTGGGGGGGAGGGGG - Intronic
942719908 2:178939744-178939766 TTTTGTGTGTGTGGTGGAGGGGG + Intronic
945948001 2:216013135-216013157 GCTTGTGTGAGTTGGGGAGGTGG - Intronic
945958059 2:216104882-216104904 CTTTGTGTGAGTGGGGAGAGAGG + Intergenic
946072894 2:217049585-217049607 CATTGTGTGCTTGGGGGAACTGG + Intergenic
947012875 2:225585039-225585061 CTTTGTGTCTGTGTGGGATCAGG - Intronic
947160327 2:227208015-227208037 TTTCGTGTGTGTGGGGGGGCGGG - Intronic
947411722 2:229848324-229848346 ATTTGTGTGTGTGGGGGGGGCGG - Intronic
948084838 2:235238809-235238831 CTGTGTGTGGGTGGGGCTGCTGG + Intergenic
948437295 2:237962225-237962247 CTGTGTGTGTGTGTGGGAGTGGG - Intergenic
948787056 2:240358299-240358321 CTTTGTGAGCCTGTGGGAGCTGG - Intergenic
1169020889 20:2330041-2330063 CGTTGTGGGGGTGGGGGAGGGGG + Intronic
1171221980 20:23406463-23406485 TTTTGTGTGTGTTGGGGAGGAGG - Intronic
1171356741 20:24552244-24552266 CTTTCTGTGTGTGGAGCAGCAGG - Intronic
1171426028 20:25049275-25049297 CTCTGTGTGTGTTGGGGAGCTGG + Intronic
1172283742 20:33726305-33726327 ATTTGTGTGTGTGGGGGTGGTGG + Intergenic
1172420974 20:34817244-34817266 CTTTGTGTGTGTGACGGAGGGGG + Intronic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1173684117 20:44910578-44910600 CTTTGTGGGGGTGGGGGTGGGGG + Intronic
1174080552 20:47968385-47968407 CTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1174659859 20:52202734-52202756 CTTTGTGTGAGTGAGGCTGTAGG - Intronic
1175001764 20:55636796-55636818 CTTTGTGTGTGGGAGGGAGCAGG - Intergenic
1175133257 20:56805401-56805423 CTGTGTGTGAGTGTGGGGGGAGG - Intergenic
1175256662 20:57652118-57652140 CGATGTGTGTGTGGTGGAGCCGG + Exonic
1175348718 20:58302481-58302503 CTGTGTGTGAGGGAGGGAGTGGG - Intergenic
1175417832 20:58813210-58813232 CTGGGTTTGAGTGGGGGTGCAGG - Intergenic
1176257824 20:64161596-64161618 CTTTGTGTGAGTGGGGGAGCAGG - Intronic
1178494478 21:33075422-33075444 TTTTGTGTGTGTGGGGGGGTGGG + Intergenic
1179255320 21:39710843-39710865 CTGTGTGGGAGGGAGGGAGCAGG + Intergenic
1179642065 21:42754275-42754297 GATTCTGTGAGTGGGGGAGACGG + Intronic
1180071316 21:45437100-45437122 CTGTGTGTGAGTGTGTGTGCAGG - Intronic
1180599693 22:17007924-17007946 CTCTTTGTGAGTGGGGCAGTGGG - Exonic
1181100587 22:20536332-20536354 CTGTGTGTGAGTGTGGGAGGTGG + Intronic
1181164616 22:20976688-20976710 CTCTGTGTCTGTGGTGGAGCTGG + Exonic
1181843505 22:25686397-25686419 CTTTGTGTGAGTGGGGCTTGGGG + Intronic
1181988924 22:26821927-26821949 TTGTGTGTGGGTGGGGGAGGCGG - Intergenic
1182779037 22:32852739-32852761 GTGTGTGTGTGTGAGGGAGCAGG + Intronic
1183519009 22:38285495-38285517 CTGTGTGTGTATGGGGGAGCGGG + Intergenic
1184093886 22:42306190-42306212 CTTTCTGCGAGGCGGGGAGCTGG - Intronic
1185106178 22:48871249-48871271 CTTAGTGTGAGGGGGCGAGCTGG + Intergenic
1185134335 22:49060679-49060701 TTTTGTGTGTGGGGGGGTGCGGG + Intergenic
950040795 3:9917904-9917926 CTGTCTGTGTGTGGAGGAGCGGG - Exonic
950312413 3:11970118-11970140 CTTTGTGTGTGGGGGAGAGGAGG - Intergenic
951614208 3:24523162-24523184 CTTTGTGTGTGGGGGGGGGAGGG + Intergenic
952217245 3:31289863-31289885 CTCGGTGTCAGTGGGGGAGGTGG - Intergenic
952886976 3:38018003-38018025 CTCTGTGTGGGTGAGGGCGCTGG - Intronic
953203463 3:40798899-40798921 CAGAGTGGGAGTGGGGGAGCAGG - Intergenic
953507055 3:43496615-43496637 TTTTTTGGGGGTGGGGGAGCAGG + Intronic
954443558 3:50534672-50534694 GATTGTGTGAGAGGGGGAGTGGG - Intergenic
955297957 3:57750495-57750517 CTTTGAGGGAGTGGGGGTGCAGG + Intergenic
955370116 3:58344003-58344025 CTGTGTGTGACTGGGGGAGGGGG - Intronic
956214277 3:66832242-66832264 CTTTGTGTGGGGGGGGGAGTGGG + Intergenic
957681945 3:83448509-83448531 CTTTATGTGAGGGAAGGAGCTGG + Intergenic
957701160 3:83715127-83715149 CTTTGTGTGTGTGTGGGTGCGGG + Intergenic
958581587 3:96032466-96032488 CTTTGTGTGTGGGGGAGAGTAGG + Intergenic
958858166 3:99412068-99412090 GTGTGTGTGTGTGTGGGAGCAGG - Intergenic
959024837 3:101229317-101229339 TGGTGTGTGTGTGGGGGAGCAGG - Intronic
960845755 3:122003148-122003170 TTTACTGTGGGTGGGGGAGCTGG - Intronic
961211704 3:125130779-125130801 CCTGGTGTGAGTGGGGGAAGGGG - Intronic
962183911 3:133238108-133238130 ATGTGTGTGAGTGAGGGAGGAGG - Intronic
963579563 3:147108479-147108501 CTTGTTGTGGGTGGGGGAGGGGG - Intergenic
964029551 3:152120773-152120795 CTGTGTGTGAATGGAGGAGGGGG + Intergenic
964878061 3:161392377-161392399 GTGAGTGTGAGTGGGGAAGCTGG + Intergenic
964909067 3:161755886-161755908 ATTTCTGTGAGTCGGGGATCTGG + Intergenic
965725569 3:171711660-171711682 TTTGGTGTGAGTGTGGGAGGTGG + Intronic
966534037 3:181011095-181011117 CTTTGTGTGAGAGAGGAAGGAGG - Intergenic
966965111 3:184983783-184983805 CTTTGTATGTGTGTGGGAGGGGG - Intronic
967553793 3:190831399-190831421 CTTGGTGGGAGTGGTGGAGGAGG - Intergenic
968957651 4:3727317-3727339 CTTTGTATGAGTCTGGGAGTCGG + Intergenic
969186400 4:5477911-5477933 CTTGGTGTGGGTGGGGGCACTGG - Intronic
969528297 4:7715306-7715328 CCTTGGGTGAGTGTGGGTGCGGG + Exonic
969772415 4:9329459-9329481 GTTTGTGTGTGTGGGGGGGGGGG - Intronic
969773032 4:9334206-9334228 GTTTGTGTGTGTGGGGGGGGGGG - Intronic
971167694 4:24201344-24201366 GTTTGTGTTAGTGGGGGTGAGGG - Intergenic
971434088 4:26601186-26601208 GTTGGTGGGAGTGGGGGAGAAGG - Intronic
971586143 4:28407561-28407583 CTTTGTGTCAGAGGGGTACCCGG - Intergenic
971733096 4:30411005-30411027 GTTTGTGTGAGAGAGGGAGATGG + Intergenic
972365610 4:38371603-38371625 CTTTGGGCCAGTGGGGGAGAGGG - Intergenic
972557695 4:40197048-40197070 GTTAGTGTGTGTGGGGCAGCAGG - Exonic
972945849 4:44254522-44254544 CTTTGTGAGGGTGGGGGTGGTGG - Intronic
973134582 4:46690199-46690221 CTTTGTGTGTGTGGCGGGGGGGG - Intergenic
973583308 4:52366161-52366183 CTTTGTGTGTGTGGGGGTCGGGG - Intergenic
974287371 4:59886306-59886328 CTTTGTGGGGGTGGGGGTGGGGG - Intergenic
974558492 4:63485631-63485653 GTTTGTGTTGGTGTGGGAGCTGG - Intergenic
975799503 4:78045121-78045143 GTGTGTGTGTGTGGGGGAGGGGG + Intergenic
976665249 4:87583655-87583677 CCTTCTGTGAGTGGGTGTGCTGG + Intergenic
977393171 4:96439306-96439328 TTTTGTGTGTGCGGGGGAGTGGG + Intergenic
978387958 4:108194828-108194850 ATTTGTGGGAGTGGGAGGGCAGG - Intergenic
978419287 4:108512957-108512979 GTGTGTGTGAGTGGGGGTGGAGG - Intergenic
980270206 4:130574507-130574529 CTTTTTTTGAGTGGGGGTGGGGG - Intergenic
981132947 4:141178630-141178652 CTTAGGGTTAGTGGGGGAGCGGG + Intronic
981768781 4:148282649-148282671 GTGTGTGGGAGTGGGGGAGTTGG + Intronic
982589277 4:157284183-157284205 AGTTGTGTGAGAGGGGGAACTGG + Intronic
984417484 4:179479705-179479727 GGTTGTGTGTGTGGGGAAGCGGG - Intergenic
984555636 4:181211193-181211215 CTTTGTGGGAATGGGGAAGCAGG + Intergenic
984885104 4:184442878-184442900 CTTTGTGGGGGTGGGGGTGGGGG + Intronic
985445336 4:190018587-190018609 CTGTGTGTGTGTGGGGGGGGTGG + Intergenic
985617388 5:931801-931823 CTTTTTCTGAGGGCGGGAGCAGG - Intergenic
985754027 5:1702482-1702504 CTCTGTGTGGGGGTGGGAGCAGG + Intergenic
986858835 5:11903800-11903822 CTTTGGGTGAGTTGCGGGGCTGG - Exonic
987856764 5:23429090-23429112 ATTTGTGTGAGTGTAGCAGCTGG - Intergenic
989085410 5:37671395-37671417 CTTTTTGTGAGTGGGGGAGAAGG + Intronic
990825370 5:59893131-59893153 CTTTGCCTGAATGGGGGAGGGGG + Intronic
990872144 5:60443952-60443974 CTTTGGGTGAGTGGGTGGGTAGG - Intronic
991210025 5:64093164-64093186 CTTTGTGGGGTGGGGGGAGCGGG + Intergenic
992406577 5:76463341-76463363 GCTTGTGTAAGTGGTGGAGCTGG - Intronic
992664764 5:78996375-78996397 CTGGGTATGAGTGGGGGTGCTGG + Intergenic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
994639517 5:102389447-102389469 CTCTGTGTGTGTGGGGGTGGGGG - Intronic
994839844 5:104909247-104909269 CTTTGTGTGGGTTGGGGAGGGGG - Intergenic
995416568 5:111919975-111919997 CTTTGTGTGTGTGGGGGGGGGGG - Intronic
995835979 5:116399909-116399931 CCTTTTGGGGGTGGGGGAGCAGG - Intronic
996009717 5:118468565-118468587 TTTTTTGTGAGTGGTGGAGGTGG - Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997430398 5:133835095-133835117 CTTTGTGTGTGTGTAGGAGGAGG - Intergenic
997525565 5:134550936-134550958 CTTTGTGTGTGTTGGGGAAGGGG - Intronic
997597139 5:135114629-135114651 CTGTGTGTGGGGGGGGGAACAGG - Intronic
997668922 5:135654452-135654474 ACTTATGTAAGTGGGGGAGCTGG + Intergenic
997877575 5:137563142-137563164 CCTTGTATGAGTGTGAGAGCAGG - Intronic
998005101 5:138651529-138651551 CTCTGTGTGTGTGGGGGTGGGGG - Intronic
998298700 5:140997106-140997128 CATTGTGTATGTGGGAGAGCAGG - Intronic
999217785 5:149950086-149950108 CTTTGGGTGGGTGGGGCAGGTGG + Intergenic
999361076 5:150987269-150987291 CTTGGTGTGTGTGGAGGAGGAGG + Intergenic
1000311266 5:160047247-160047269 TTTTGTGTGTGTGTGGGGGCTGG - Intronic
1002051702 5:176575204-176575226 GCCTGTGTGAGTGGGGGTGCCGG + Exonic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1002212691 5:177608167-177608189 GTGTGTGTGAGAGGGGTAGCAGG - Intronic
1002480093 5:179495161-179495183 CTGTTTGTGTGTGGGGGAGGTGG + Intergenic
1003333023 6:5145278-5145300 GTTTCGGTGAGTGGAGGAGCCGG + Intronic
1004418216 6:15444664-15444686 CTTTGTGCCGGTGTGGGAGCTGG - Intronic
1006642192 6:35495275-35495297 CTTTGGGTGAGGATGGGAGCAGG + Intronic
1007285780 6:40746547-40746569 CAATGTGTGGGTGGGGGAGGAGG - Intergenic
1008009300 6:46446296-46446318 GTGTGTGTGGGTGGGGGTGCTGG + Intronic
1010545705 6:77152529-77152551 ATCTGTGTGAGTGGGGCAGAAGG - Intergenic
1010840068 6:80638581-80638603 CTTTGTGTGTGTGGGGGCGGGGG + Intergenic
1011237761 6:85236527-85236549 GGTGGTGTGAGTGGGGGTGCAGG - Intergenic
1011832989 6:91395806-91395828 CTGTGTGTGACTGGGGAGGCAGG + Intergenic
1012895380 6:104940961-104940983 CTGGGTGTGAGAGGGGGAGAGGG - Intergenic
1013070065 6:106721026-106721048 CATTAAGTGAGTGGTGGAGCTGG + Intergenic
1013070301 6:106723289-106723311 CATTAAGTGAGTGGTGGAGCTGG - Intergenic
1013609969 6:111785481-111785503 GTTTGTGTGTGTTGGGAAGCGGG - Intronic
1015892501 6:137982826-137982848 CCATCTGTGATTGGGGGAGCAGG + Intergenic
1017416513 6:154226851-154226873 CTTTGGCTGAATGGGGGAGGGGG - Intronic
1019170944 6:170132884-170132906 CCTTGTGTGTGTCGGGGTGCCGG - Intergenic
1019618618 7:1978611-1978633 CTGTGTGTGAGTGTGGGTGTGGG - Intronic
1020035323 7:4960070-4960092 CTTGGAGGGAGTGGGGGACCTGG + Intergenic
1022807238 7:33834605-33834627 CATTGTGGAAGTGGGAGAGCTGG + Intergenic
1024270012 7:47635181-47635203 CTCTCTGGGAGTGGAGGAGCAGG - Intergenic
1027455861 7:78390949-78390971 CTTTGGGTGAGGGTGGGAGATGG + Intronic
1027629148 7:80580626-80580648 CTGTGAGTTAGTGGGGGACCAGG + Intronic
1029205834 7:98869180-98869202 GTGTGTGTGGGTGGGGGAGTGGG - Intronic
1029797470 7:102910397-102910419 CTTTGTGTGTTGGGGGGAGGGGG + Intronic
1030007200 7:105131257-105131279 CTGAGTGGGAGTCGGGGAGCAGG - Intronic
1030060720 7:105618763-105618785 CTTTGTAGGAGTGGGGGATGGGG + Intronic
1030416139 7:109245859-109245881 CTGTGTGTGAATGGGGGAGAGGG - Intergenic
1031127799 7:117793997-117794019 CTTGGGGTGAGGGGGGGTGCAGG - Intronic
1031898278 7:127379850-127379872 CTGTGTGTGTGTGGGGGGGGTGG - Intronic
1031961376 7:127993345-127993367 CTTTGTGGGGTTGGGGGAGTAGG - Intronic
1032570790 7:132994159-132994181 CTTACAGTGAGTGGGGGAGGGGG - Intronic
1032918462 7:136518428-136518450 TTTTTGGTGAGTGGGGGAGAGGG + Intergenic
1033187518 7:139241991-139242013 CTTTTTTTGGGGGGGGGAGCTGG - Intronic
1034376523 7:150649619-150649641 CTGTGTGTGAGTGGGGGTCATGG + Intergenic
1034636846 7:152574491-152574513 TTTTGTGTGTGTGTGGGAGAGGG + Intergenic
1034674716 7:152884155-152884177 CAATTGGTGAGTGGGGGAGCGGG - Intergenic
1034725336 7:153330598-153330620 TTGTGTGTGTGTTGGGGAGCTGG + Intergenic
1034910481 7:154993697-154993719 TTTTTTTTGAGTGGGGGAGGAGG - Intronic
1035540872 8:436865-436887 CTTGGTGTGAGTGAGAGAGTAGG + Intronic
1035716582 8:1759790-1759812 AGTTCTGTGAGTGGGAGAGCAGG - Intronic
1035774975 8:2181272-2181294 TTATGTGTGAGTTTGGGAGCTGG + Intergenic
1035986435 8:4437630-4437652 CTTTGTGTGACTCTGGGATCTGG - Intronic
1036086533 8:5618645-5618667 GGGTGTGTGTGTGGGGGAGCGGG + Intergenic
1036086548 8:5618699-5618721 GGGTGTGTGTGTGGGGGAGCGGG + Intergenic
1036411044 8:8501792-8501814 GTTTGTGTGTGTGTGGGGGCAGG - Intergenic
1036516187 8:9446670-9446692 CTTTGTCTCAGTGGGGTACCTGG + Intergenic
1037275861 8:17177774-17177796 GTTTGTGTGTGTGGGGGTGGGGG + Intronic
1037737473 8:21579041-21579063 GTTTGTGTGAGTGGTGGGGGTGG - Intergenic
1039843836 8:41311737-41311759 CTAGGGGTGAGTGGGGGAGGTGG - Intergenic
1039940415 8:42085402-42085424 CTTTGTGTGTGTGACTGAGCTGG + Intergenic
1040552831 8:48451652-48451674 CCTTGTGTGTGTGTGGGAGGTGG + Intergenic
1041200133 8:55445739-55445761 CTTTTTGTGTGTGGCGGAGGAGG - Intronic
1041276005 8:56157880-56157902 CTTTGTGTGGGTGGGGGCTGGGG + Intergenic
1041808027 8:61875030-61875052 CTTTTTATGAGTGAGGGAGGGGG + Intergenic
1044727928 8:95208172-95208194 GTGTGTGTGTGTGGGGGAGGGGG + Intergenic
1046102718 8:109633284-109633306 CTTTTTGTGTGTGGGTGACCAGG - Intronic
1048570025 8:135644637-135644659 CACTGTGGGAGTGGGGGAGGAGG - Intronic
1048965715 8:139613199-139613221 CTGAGTGAGAGTTGGGGAGCAGG + Intronic
1049290379 8:141798485-141798507 CTCTGAGTGTGTGGGGGAGTGGG + Intergenic
1049457516 8:142701002-142701024 CTTTGAGGGAGTCGGGGGGCAGG + Intronic
1049494966 8:142925647-142925669 CTCTGTGAACGTGGGGGAGCGGG + Intergenic
1049773370 8:144393864-144393886 TTTGGTGAGTGTGGGGGAGCAGG - Exonic
1051096029 9:13466050-13466072 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1051553780 9:18359824-18359846 TTTTGTGTGGGCGGGGGGGCGGG - Intergenic
1052042171 9:23751366-23751388 GTTTGTGTGTATGGGGGAGGGGG - Intronic
1052454517 9:28678236-28678258 CCTGGTGAGAGTGGGAGAGCAGG - Intergenic
1053149071 9:35731750-35731772 CTTTGGGTGAGTTGGGGATTAGG - Intronic
1054942887 9:70763173-70763195 CTTTGTAGGAGTGGGGGAAGGGG - Intronic
1056138652 9:83653509-83653531 GTTTTTTTGGGTGGGGGAGCGGG + Intergenic
1056671960 9:88638140-88638162 CCTTGTGTGAGAGAAGGAGCTGG + Intergenic
1057303439 9:93899474-93899496 CTCTGTATGAGGAGGGGAGCTGG - Intergenic
1057725310 9:97564194-97564216 CTGTGTGTGGCTGGGGGAGGGGG + Intronic
1057995971 9:99821977-99821999 GTGTGTGCGAGTGAGGGAGCGGG - Exonic
1058099732 9:100905684-100905706 CTCTGTGTGTGTGGGGGGGGGGG + Intergenic
1058641335 9:107088626-107088648 CTTTGTGTGTGTGGTGGGGTGGG - Intergenic
1059635167 9:116163278-116163300 CTGTGTGGGAGTGGGGATGCAGG + Intronic
1060233579 9:121843496-121843518 CTTTTTGTGAGTGGGGCTCCAGG + Intronic
1060268894 9:122127641-122127663 CTATGTGTGTGTGTGGGGGCGGG + Intergenic
1060504401 9:124187352-124187374 CTTGGTGGGAATGGGGGAGGAGG + Intergenic
1060634124 9:125186746-125186768 CTTTTTTTTGGTGGGGGAGCGGG - Intronic
1060700821 9:125747678-125747700 TTTTGTGTGTGTGCGGGAGCCGG + Intronic
1060720692 9:125974934-125974956 GTGTGTGTGACGGGGGGAGCAGG - Intergenic
1061418195 9:130459430-130459452 GTGTGTGTGTGTGGGGGAGAGGG + Intronic
1061715723 9:132517752-132517774 CTTTGTGTGTGCGGGGGATGAGG - Intronic
1062629222 9:137456196-137456218 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1186167246 X:6839897-6839919 TTTTGTGTGTATGGGGGAGGGGG - Intergenic
1186434174 X:9528876-9528898 CTTTGGGTGAGGGTGGCAGCTGG + Intronic
1186914481 X:14205568-14205590 CTTTGTCTGAGAGGGGCACCCGG - Intergenic
1187133999 X:16529433-16529455 CTGTGTGGGAGGTGGGGAGCTGG - Intergenic
1187225901 X:17375350-17375372 CTGTGTGTGTGTGGGTGAGTGGG - Intergenic
1187623476 X:21085262-21085284 CTGTGTATTAGTGGGTGAGCTGG - Intergenic
1188057270 X:25555741-25555763 CTTCTTGTGACTGTGGGAGCAGG - Intergenic
1188108969 X:26175223-26175245 CTTTGTGTCAGAGGGGCACCCGG - Intergenic
1188922206 X:35990456-35990478 CTTTGTGTGAGATGAGGAGGGGG + Intergenic
1190567266 X:51743590-51743612 CTGTGTGGCAGTGAGGGAGCGGG - Exonic
1192178071 X:68898359-68898381 GTATGTGTGTGTGGGGGAGTTGG + Intergenic
1192362550 X:70448820-70448842 CTCTGTGGGAGTAGGGGAGGAGG + Intronic
1192420068 X:71021743-71021765 CCTAGTGGGAGTGGGGGAGATGG - Intergenic
1192638748 X:72844463-72844485 CTATGTGTGAGTGGGGCTTCTGG + Intronic
1192639254 X:72847016-72847038 CTTGGTGGGGGTGGGGGAGGAGG + Intronic
1192642457 X:72873789-72873811 CTTGGTGGGGGTGGGGGAGGAGG - Intronic
1192642964 X:72876345-72876367 CTATGTGTGAGTGGGGCTTCTGG - Intronic
1192677040 X:73208898-73208920 ATGTGTGTGAGTGAGAGAGCCGG + Intergenic
1193421438 X:81287646-81287668 CTGTCTGTGGGTGGGGGAGTAGG + Intronic
1193675501 X:84447581-84447603 CTTGGTGTGTGGGGGGGACCTGG - Intronic
1194096315 X:89643547-89643569 CTTTGTCTGAGTGGGGTATCAGG - Intergenic
1194235677 X:91380816-91380838 CTGTGTGTGCGTGGGGGGGGGGG - Intergenic
1194518340 X:94887646-94887668 CTTTGTGTGTGTGTGGGTGCTGG + Intergenic
1194600424 X:95913816-95913838 GTGTGTGTGGGTGGGGGGGCGGG - Intergenic
1194910954 X:99644061-99644083 CTGTCTGGGAGTGGGGGACCAGG - Intergenic
1195212147 X:102660407-102660429 CTATGTGTGGGTGGGAGAGGTGG + Intergenic
1195218189 X:102721180-102721202 GTATGTGTGGGTGGGGGAGGTGG + Intronic
1197128352 X:122973898-122973920 CTGTGTATGTGTGTGGGAGCTGG - Intergenic
1197567859 X:128110994-128111016 GTTTGTGGGGGTGGGGGAGGGGG - Intergenic
1197707670 X:129646308-129646330 CTTTGTGTGTGTGGGGACGGGGG - Exonic
1197885509 X:131213615-131213637 CTGTGTGTGAGTGTGGAGGCGGG - Intergenic
1198157241 X:133973279-133973301 GGTTGTGTAAGTGGCGGAGCCGG - Intronic
1198808634 X:140512307-140512329 TTTTGTCTGAGTGGGGAAGTGGG - Intergenic
1199686658 X:150271172-150271194 GTTTGTGTCAGAGGGGGAGGAGG + Intergenic
1200449322 Y:3304920-3304942 CTTTGTCTGAGTGGGGTATCAGG - Intergenic