ID: 1176260715

View in Genome Browser
Species Human (GRCh38)
Location 20:64178057-64178079
Sequence GATCCTGAGGTGCCTCCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176260715_1176260724 26 Left 1176260715 20:64178057-64178079 CCCGGAGGAGGCACCTCAGGATC 0: 1
1: 0
2: 4
3: 30
4: 205
Right 1176260724 20:64178106-64178128 CAGAGGCCTCCACTGACCACTGG 0: 1
1: 0
2: 4
3: 29
4: 256
1176260715_1176260722 9 Left 1176260715 20:64178057-64178079 CCCGGAGGAGGCACCTCAGGATC 0: 1
1: 0
2: 4
3: 30
4: 205
Right 1176260722 20:64178089-64178111 CCCAGCTTCTCTCTTCACAGAGG 0: 1
1: 0
2: 4
3: 33
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176260715 Original CRISPR GATCCTGAGGTGCCTCCTCC GGG (reversed) Intronic
900971306 1:5993620-5993642 CATCCTGGTGTCCCTCCTCCTGG + Intronic
901462369 1:9399455-9399477 GGTCCTCAGCTGCCTCTTCCAGG - Intergenic
903023986 1:20413883-20413905 TAGCCTGAGCTGCCTTCTCCTGG - Intergenic
903299485 1:22368565-22368587 GGTCCTCATGTGCCTCGTCCAGG + Intergenic
903742865 1:25568437-25568459 CATCCTGAGGTGCCTCCCAGTGG + Exonic
905262927 1:36731904-36731926 GATCAGGTGGTGCCTGCTCCTGG + Intergenic
905453366 1:38071262-38071284 GTTCCTGAGGTCCAGCCTCCAGG + Intergenic
907520756 1:55021981-55022003 GATCCCGAGCTGCCACCTCCAGG + Intergenic
908511733 1:64854923-64854945 GTTCAAGAGCTGCCTCCTCCAGG + Intronic
910460278 1:87441772-87441794 GCTTCTCAGGGGCCTCCTCCTGG - Intergenic
912199416 1:107439719-107439741 GATCCTGAAGTGCCTTCCCCTGG + Intronic
914317503 1:146528039-146528061 GCTTCTCAGGGGCCTCCTCCTGG - Intergenic
914496853 1:148205321-148205343 GCTTCTCAGGGGCCTCCTCCTGG + Intergenic
914703110 1:150150902-150150924 CATCCTGAGGTCCCTGCCCCAGG - Exonic
915759101 1:158292786-158292808 GCTCCTCAGATGCCACCTCCAGG - Exonic
918078660 1:181189750-181189772 GAGTCTGAGGTTCCTGCTCCTGG - Intergenic
919147263 1:193651435-193651457 GGTCCTGAGGTCCCTATTCCAGG - Intergenic
921804689 1:219440502-219440524 CATCCTGAGGAGCCTCTTACTGG + Intergenic
922565652 1:226600025-226600047 GATGCTGATGTGCCCCATCCTGG - Intronic
924561098 1:245156644-245156666 GGCCCTGAGGTTGCTCCTCCCGG + Exonic
1065167388 10:22994143-22994165 GATCCAGAAGTGCCTCCTTGAGG + Intronic
1067429800 10:46235640-46235662 GCTCCAGAGTGGCCTCCTCCAGG + Intergenic
1067443843 10:46328179-46328201 GCTCCAGAGTGGCCTCCTCCAGG - Intronic
1067451404 10:46384264-46384286 GATCCTGGTGTGCCTCCTGCAGG + Intronic
1067585838 10:47475492-47475514 GATCCTGGTGTGCCTCCTGCAGG - Exonic
1068342456 10:55724242-55724264 GATCCTGCAGTTCCTTCTCCAGG + Intergenic
1069064140 10:63924928-63924950 CATCCTAAGGAACCTCCTCCAGG - Intergenic
1069792816 10:71034117-71034139 GAGCCTGAGGGGCCTGGTCCAGG - Intergenic
1070156306 10:73837696-73837718 GATCCTGAGGTGCCACCCTGAGG - Intronic
1072232413 10:93424872-93424894 GTTGCTGAGGTGGCTCCTCGGGG - Intronic
1073121849 10:101126773-101126795 GATCCAAAGGGGCCTCCCCCTGG + Intronic
1076579319 10:131496137-131496159 AGTCCTGAGATGCCTCCTCCGGG - Intergenic
1076839004 10:133036164-133036186 GATCCTGAGCGGCCTCCCCCAGG + Intergenic
1077075214 11:697806-697828 CATCCTGTGGTGCCTCTTCCAGG + Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077377021 11:2209853-2209875 GCTCCTGAGAAACCTCCTCCAGG - Intergenic
1077443325 11:2578733-2578755 CATCCTTAGGTGCCTCCTCACGG + Intronic
1077484153 11:2831232-2831254 TCTGCTGAGGTGCCTCCTCAGGG - Intronic
1079323704 11:19473692-19473714 GATGCTGTGGTGCCTCACCCAGG + Intronic
1080951689 11:37041108-37041130 AATCCTAAGTTGCCTTCTCCTGG + Intergenic
1081623160 11:44631010-44631032 GAGCGTAAGGTGCCACCTCCAGG - Intergenic
1083263243 11:61534326-61534348 GATCCTGATGTCTCCCCTCCAGG - Intronic
1084942467 11:72620323-72620345 GCTTCTGAGGGGCCTTCTCCTGG - Intronic
1084978081 11:72814247-72814269 GACCCGGAGGCGGCTCCTCCCGG + Intergenic
1085023466 11:73223186-73223208 GATTCTGAGATGGCCCCTCCAGG - Intronic
1085446455 11:76604127-76604149 CAGCCTCAGCTGCCTCCTCCCGG - Intergenic
1087157903 11:94922650-94922672 CATCTTGACCTGCCTCCTCCAGG + Intergenic
1088686198 11:112286379-112286401 CATCCTGAGGTCCCTGCACCAGG - Intergenic
1089522850 11:119077125-119077147 GAGCATGAGGTGGCTCCACCGGG + Intronic
1089823176 11:121246664-121246686 GGACCTGTGGTGCCTCTTCCAGG + Intergenic
1092055471 12:5505088-5505110 GGTCCTGGGGTGCCTCCTCTGGG + Intronic
1095409062 12:41902581-41902603 GATCCTTCCTTGCCTCCTCCAGG + Intergenic
1096758667 12:53821238-53821260 GCTCCTTATTTGCCTCCTCCAGG - Intergenic
1096804812 12:54134152-54134174 GATCCTGAGCTGGCACCTCTGGG - Intergenic
1096879141 12:54653442-54653464 AACCCTGAGGTTCCTCCTCCTGG - Intergenic
1101725709 12:107386555-107386577 GATCCTGAAATGCTTCCTCCAGG - Intronic
1102677526 12:114668738-114668760 GATCCAGAGCTGCCCCCTTCAGG + Intergenic
1105669174 13:22593193-22593215 GATCCAGAGGTGCCCCCTATGGG - Intergenic
1107527538 13:41248092-41248114 TATCCTGGGGTGTCTCCTCAAGG + Intronic
1108521319 13:51249213-51249235 GTTCATTTGGTGCCTCCTCCAGG + Intronic
1118005690 14:61562642-61562664 GGCCCTGTGGTGCCTCCACCTGG + Intronic
1119182328 14:72613591-72613613 GGTCCTGAGGTGACTCCCCAGGG - Intergenic
1119633031 14:76250608-76250630 ACTCCTGAGGTGCCTCTGCCTGG + Intronic
1119799338 14:77428903-77428925 GATCCTGAGGTGCTCCCACCAGG - Intronic
1122417902 14:101559189-101559211 GCTTCTGAGGTTGCTCCTCCTGG - Intergenic
1122474812 14:102000000-102000022 GAGCCTGAAGTGCCTCTTCTGGG - Exonic
1122770536 14:104095768-104095790 GCTCCTGAGGTGGCTGCTGCAGG + Intronic
1122822008 14:104352301-104352323 GTTCCTCAGGCGCCTTCTCCTGG + Intergenic
1125740074 15:41956316-41956338 GAATCTGAAGGGCCTCCTCCTGG - Intronic
1126188031 15:45849539-45849561 GATCCTGAGGGGACTGCTCTAGG + Intergenic
1126567582 15:50115869-50115891 GATCCTGTGGTTGCTCCTGCAGG + Intronic
1129785040 15:78304314-78304336 GAGCTTGTGGTGCCTCCTCCAGG + Intergenic
1133786170 16:8975169-8975191 GGCCCTGAGGTGCCTTCCCCAGG - Intergenic
1136004651 16:27320483-27320505 GAGCCTCAGGTTCCTCCTCAGGG - Intronic
1137584703 16:49657487-49657509 GAGCCTGAGGCCCCACCTCCAGG + Intronic
1138455964 16:57120932-57120954 GCTCCTGAACTGCCTCCTGCAGG - Intronic
1139589471 16:67925627-67925649 GACCCTGACTTTCCTCCTCCTGG + Intronic
1140202535 16:72906138-72906160 GATCCAAAGATGCCGCCTCCTGG + Intronic
1142173935 16:88636380-88636402 GATCTTGAGATGGCTCATCCTGG + Intergenic
1142229655 16:88893877-88893899 GAGCCTGAGGGGCGGCCTCCAGG + Intronic
1142496068 17:306957-306979 GCTCCTGAAGTGCCCTCTCCTGG + Intronic
1142760103 17:2037013-2037035 GAGCCTGAGGTTCATCATCCAGG + Intronic
1143130502 17:4674272-4674294 GCTGCTTGGGTGCCTCCTCCTGG + Intronic
1143404720 17:6669695-6669717 GATCCTGGGGTCACCCCTCCTGG - Intergenic
1143512753 17:7405244-7405266 GATCCTTAGGATCCTCCGCCTGG + Intronic
1143630811 17:8139237-8139259 GACCCTGAGATGCCTACTTCAGG + Intergenic
1144207961 17:12992697-12992719 TATCCTGAGCTGCCTCCTGGGGG + Exonic
1144648039 17:16988577-16988599 TATCCTGAGTCACCTCCTCCTGG - Intergenic
1148491254 17:48025249-48025271 GATCCTATGGTGCCACCTGCAGG - Intergenic
1148587285 17:48790164-48790186 GAGGCCGAGGTGCCACCTCCAGG + Intronic
1151322490 17:73360219-73360241 GCTCCTGGGCTGCCTCCTGCAGG + Intronic
1151685211 17:75642244-75642266 CATCCCGAGGTGCCTCCCCGGGG + Intronic
1151990308 17:77570358-77570380 GATTTTGAGAAGCCTCCTCCTGG + Intergenic
1152855596 17:82663401-82663423 GCTCCTGCGGTGCCTCATCCTGG - Intronic
1153746513 18:8185347-8185369 GATCATGCGGTGCCTCCTGGTGG - Intronic
1155491719 18:26406809-26406831 GAGCCTGAGGAGCCGCCTCCAGG + Intergenic
1159945424 18:74441277-74441299 GACACTGTGGGGCCTCCTCCGGG + Intronic
1160219039 18:76959158-76959180 GATTCTGAAGTGCGTTCTCCCGG - Intronic
1160387399 18:78504860-78504882 CATCCTCAGGTCCATCCTCCTGG - Intergenic
1160387440 18:78505061-78505083 CATCCTCAGGTCCATCCTCCTGG - Intergenic
1160387450 18:78505109-78505131 CATCCTCAGGTCCATCCTCCTGG - Intergenic
1160387460 18:78505157-78505179 CATCCTCAGGTCCATCCTCCTGG - Intergenic
1160987042 19:1843842-1843864 CGTCCTGTGCTGCCTCCTCCTGG - Intronic
1161381665 19:3968719-3968741 GATCCTGAGGTCCCTCCTTCAGG - Intronic
1161588444 19:5117966-5117988 GCTTCTGGGGCGCCTCCTCCAGG - Intronic
1162575663 19:11497452-11497474 GAGCCCCAGGTGCCTCCTCTAGG + Intronic
1163763280 19:19148502-19148524 TTTCCTGAGCTGCCTTCTCCTGG + Intronic
1163953590 19:20613501-20613523 GAAGCTGAGTTGCATCCTCCGGG - Intronic
1164743632 19:30594980-30595002 GATGCAGAAGAGCCTCCTCCTGG - Intronic
1165425597 19:35743796-35743818 GGTCCTGAGGTACCTGCGCCTGG + Exonic
1165577032 19:36828792-36828814 AATCCTGATATTCCTCCTCCTGG + Intronic
1165717459 19:38055669-38055691 GAGCCTGAGGTGCCTGGCCCTGG + Intronic
1166745827 19:45141460-45141482 GAGCCTGAGCTGCCTCTTCCTGG - Intronic
925730926 2:6918804-6918826 CATCCTGCGCTGCCTCCTGCAGG + Intronic
926112932 2:10194371-10194393 GGTCCTGCCGTGCCTCCTCCTGG + Intronic
927192356 2:20525301-20525323 GGATCTGAGGTGCCTGCTCCTGG + Intergenic
927206816 2:20616294-20616316 GAGCCTGAGAGGCCTCCTGCAGG - Intronic
927276730 2:21268312-21268334 GGTCCTGAGGTCCCTCCATCAGG + Intergenic
927680439 2:25135642-25135664 GAACTTGGGGTGTCTCCTCCAGG + Intronic
927812562 2:26188010-26188032 GAGTCCGAGATGCCTCCTCCTGG + Exonic
928328326 2:30337521-30337543 GCTGCTGAGGGACCTCCTCCCGG + Intergenic
929541939 2:42829324-42829346 GATCCCCAGTTCCCTCCTCCAGG - Intergenic
932666431 2:73702218-73702240 GACCCTGAGTTTCCCCCTCCAGG - Intergenic
938124129 2:128659583-128659605 GAACCTGAGCTGCCCCCTCCAGG - Intergenic
938772264 2:134510780-134510802 GAGCCTGAGAGGCCTCTTCCCGG + Intronic
948478964 2:238238928-238238950 CAGCCTCAGGGGCCTCCTCCAGG + Exonic
948933542 2:241148445-241148467 GCTCTGCAGGTGCCTCCTCCAGG - Intronic
1169197516 20:3691526-3691548 GAACCTCAGCTGCCGCCTCCTGG - Exonic
1172556829 20:35849445-35849467 CATCCTGCCCTGCCTCCTCCTGG - Intronic
1172629261 20:36367207-36367229 GCTCCTGAGCTGACTCCTGCTGG + Exonic
1173837369 20:46134775-46134797 GCTCCTGAGGGGGCTCCTCCTGG + Intergenic
1174203476 20:48823335-48823357 GCCCCTGAGGTGCCTCCCCTTGG + Intronic
1174376504 20:50129792-50129814 GATCCTAAGTTTCCTCCACCCGG + Intronic
1174486204 20:50862772-50862794 GGTGCTCAGATGCCTCCTCCAGG - Intronic
1174898582 20:54475613-54475635 GATCCAGCCCTGCCTCCTCCCGG - Exonic
1175121934 20:56722475-56722497 CTTCCTGTGGTGCCTCCTTCAGG + Intergenic
1175790107 20:61735566-61735588 GACCCTGAGGTTCTGCCTCCCGG + Intronic
1176056635 20:63152381-63152403 GATGCTGTGCTGCCTCCGCCTGG - Intergenic
1176260715 20:64178057-64178079 GATCCTGAGGTGCCTCCTCCGGG - Intronic
1179642038 21:42754094-42754116 GATCCTGAGCTGCCTCCCCCTGG - Intronic
1179923671 21:44521177-44521199 GCCCCTGAGCTGCCTCCTCCGGG + Intronic
1181469424 22:23128593-23128615 AGTCCTGGGGTGCCCCCTCCTGG + Intronic
1185042265 22:48511142-48511164 GATCCCCAGCGGCCTCCTCCAGG - Intronic
950495112 3:13329036-13329058 GTTCCTGAGGTGGATCCTGCTGG - Intronic
950698890 3:14726393-14726415 GATGCTGCGGTGCATCCCCCAGG - Intronic
951790718 3:26480950-26480972 GATCCTGAGCAACCTCCTCTGGG + Intergenic
954699406 3:52443517-52443539 GATCCTGAGGTAGGTCCTCCGGG + Intronic
958724795 3:97891710-97891732 GCTCCTGAGTTGCCTCCTTCTGG - Intronic
961330238 3:126134129-126134151 GCTCCTGAACTGCCCCCTCCGGG + Intronic
961360689 3:126365321-126365343 CATCCTGAGCTGGCTCCACCAGG - Intergenic
961871795 3:129993723-129993745 TTGCCTCAGGTGCCTCCTCCTGG + Intergenic
968486501 4:865585-865607 GAGCCCGAGGTGGCTCCACCTGG + Intronic
969161180 4:5260518-5260540 GATCAAATGGTGCCTCCTCCAGG - Intronic
969265665 4:6062661-6062683 GCTGAGGAGGTGCCTCCTCCTGG - Intronic
969403315 4:6971664-6971686 GATGCTGATGTGACTACTCCGGG - Intronic
969573532 4:8023899-8023921 GCTCCTGTGGAGCCTCCTCCAGG + Intronic
969710629 4:8841004-8841026 CGTCCTGAGGTCCCTCATCCAGG - Intergenic
970837416 4:20426949-20426971 GATCCTGGAGTGCCTCTACCTGG - Intronic
971918772 4:32909890-32909912 GCTGCTGTGGTGCCCCCTCCTGG - Intergenic
984955483 4:185041477-185041499 GAACTTCAGATGCCTCCTCCAGG - Intergenic
985771741 5:1816147-1816169 GAGCCTGAGCTGCCTCCTGCCGG + Exonic
985853366 5:2405566-2405588 GATCCTGGGGCCCCTGCTCCAGG - Intergenic
985889529 5:2705078-2705100 GATGCCAAGGTGGCTCCTCCTGG + Intergenic
985960504 5:3299556-3299578 CATCCTGAGACGGCTCCTCCAGG + Intergenic
986606385 5:9527322-9527344 GATCCTCTGGAGCCTCCTCCAGG - Intronic
988585839 5:32506922-32506944 GATGCTCAGGTCCCTCCCCCAGG + Intergenic
988934190 5:36066374-36066396 GTTCCTGGGCTGCCTTCTCCAGG - Intronic
989170433 5:38467210-38467232 AATCCTGAGGTGGGGCCTCCAGG - Intergenic
992675987 5:79106904-79106926 GACCCAGAGGTCCCTTCTCCTGG - Intronic
994285396 5:97958692-97958714 GCTTCTGAGATGCCTTCTCCTGG + Intergenic
996925615 5:128822995-128823017 GATCCTGGAGTTCCTCCTGCAGG + Intronic
998444384 5:142187274-142187296 GCTCCTCTGGTGCCTCCTCTGGG + Intergenic
998450957 5:142234317-142234339 CATCATGAGGTCACTCCTCCTGG - Intergenic
1001565707 5:172697857-172697879 CACCCTGACGTGCCTCCTCAAGG - Intergenic
1002448115 5:179302461-179302483 GAGGCAGAGCTGCCTCCTCCTGG + Intronic
1002636769 5:180612520-180612542 GATCCTGGGGGACCTGCTCCAGG - Exonic
1003241584 6:4350080-4350102 GATCCAGAGGTGCAGCTTCCCGG - Intergenic
1003756361 6:9125529-9125551 GACCCTGTGGTCCCTCCTCAAGG - Intergenic
1004503575 6:16229760-16229782 GAAGCTGAGTTGCATCCTCCGGG + Intergenic
1006305092 6:33213889-33213911 GATCCTGACTCCCCTCCTCCCGG + Intergenic
1006347963 6:33498283-33498305 GCACTTGTGGTGCCTCCTCCAGG + Intergenic
1006743321 6:36324388-36324410 GGCCCTGAGGGGCCTCCTCCTGG - Intronic
1013109005 6:107050060-107050082 GATCCTGAGCTGCCTGGACCCGG + Intronic
1015181313 6:130365533-130365555 GGTCCTGCGGTGCCTGCTCCGGG + Intergenic
1015862986 6:137699912-137699934 GATCCAGAGAGGCCTCCTGCTGG + Intergenic
1016339677 6:143049497-143049519 GGACTTGTGGTGCCTCCTCCAGG - Intergenic
1018148418 6:160915552-160915574 ATTCCTGAGGTGCCTTATCCAGG - Intergenic
1018706018 6:166463548-166463570 AATCCTGATGGGCCTGCTCCGGG - Intronic
1019522840 7:1468396-1468418 GCTCCTGGGGAACCTCCTCCAGG - Intergenic
1019601043 7:1883963-1883985 GGGCCTGCGGTTCCTCCTCCAGG - Intronic
1022410411 7:30135306-30135328 GCTCCGGCGGTCCCTCCTCCAGG - Intronic
1023699418 7:42877885-42877907 GAACTTGTGGTGCCTTCTCCAGG + Intergenic
1024677729 7:51652486-51652508 GAGCCTGAGAAGCCTCCTGCGGG - Intergenic
1025261004 7:57417283-57417305 GATCCTGAGCAGCCTCTGCCTGG - Intergenic
1026855009 7:73747650-73747672 ACTCCTGTGTTGCCTCCTCCTGG - Intergenic
1026948443 7:74331462-74331484 GATCAAGACCTGCCTCCTCCAGG - Intronic
1027333256 7:77121944-77121966 GAGACTGAGGTCCCTCCGCCTGG - Intergenic
1028523087 7:91753251-91753273 CATCCTCAGGTGACACCTCCAGG + Intronic
1029155079 7:98511438-98511460 TATCCTGAGCTGGCTTCTCCTGG - Intergenic
1029365179 7:100112061-100112083 GGCCCTGAGACGCCTCCTCCTGG - Intronic
1029782534 7:102749358-102749380 GAGACTGAGGTCCCTCCGCCTGG + Exonic
1032665160 7:134028962-134028984 GATCCTCAGGTGGCCCCTTCAGG + Intronic
1033286403 7:140044485-140044507 GATCCTTTCTTGCCTCCTCCAGG - Intronic
1034275739 7:149823087-149823109 CCTCCTCAGCTGCCTCCTCCAGG + Intergenic
1034338004 7:150335770-150335792 AATCTTGAGGTCCCTCCACCAGG + Intronic
1034345518 7:150383298-150383320 GAGCCTGAGGAGCCACCTCTTGG + Intronic
1035303695 7:157916412-157916434 GAGCTTGAGGTGGCTCCTCATGG + Intronic
1036508184 8:9375424-9375446 TATTCTCAGGTTCCTCCTCCAGG - Intergenic
1037880778 8:22572460-22572482 GGCCCTGAGATGCCCCCTCCCGG - Intronic
1039385738 8:37134174-37134196 GATACTGAGGTGCTTCCTCCAGG - Intergenic
1040291240 8:46126147-46126169 GAAGCTGAGTTGCATCCTCCGGG - Intergenic
1040723138 8:50350133-50350155 GGTCCTTAGCTGCCTCCTCAGGG + Intronic
1041008982 8:53523191-53523213 GAAGCTGAGTTGCATCCTCCGGG + Intergenic
1042702817 8:71635491-71635513 GATGCTGAGGTGCTCCCTCCAGG - Intergenic
1045056516 8:98372738-98372760 TATCCTGCTCTGCCTCCTCCTGG - Intergenic
1046091516 8:109508424-109508446 GATCCTGCAGTACCTCATCCAGG + Intronic
1048329966 8:133464683-133464705 GGTCCTGCTGTGCCTCCACCGGG - Intronic
1049394936 8:142395570-142395592 GATCCGGCGGTGCCGCCCCCTGG - Intronic
1049439010 8:142600785-142600807 GAGCCTGAGCTGCTTCCTCCAGG - Intergenic
1049672490 8:143876168-143876190 GCCCCTGTGGTGCCGCCTCCTGG - Intronic
1053526504 9:38835476-38835498 GATCCTGGGTTGCCACGTCCGGG - Intergenic
1054198730 9:62059901-62059923 GATCCTGGGTTGCCACGTCCGGG - Intergenic
1055463028 9:76537227-76537249 GAGCCTCAGGAGGCTCCTCCAGG + Intergenic
1055829258 9:80359922-80359944 GTCCCTGAGGACCCTCCTCCTGG - Intergenic
1056855822 9:90128740-90128762 GGCACTGAGGAGCCTCCTCCAGG - Intergenic
1058526825 9:105867367-105867389 GAGCCTGAGGTACCTCCTCCAGG - Intergenic
1060714826 9:125915705-125915727 GATCGGGAGGGTCCTCCTCCTGG - Exonic
1061327837 9:129874973-129874995 GATGGTGAGGTTCCTCCACCAGG - Intronic
1061828319 9:133275245-133275267 GAGCCCGAGGCGCCCCCTCCCGG + Intergenic
1061840492 9:133356282-133356304 GACCCTGAGGACGCTCCTCCAGG + Exonic
1061957440 9:133971054-133971076 GAGCCCGCGGTGCCTCCTGCGGG + Intronic
1062121135 9:134834680-134834702 GCACCTGTGCTGCCTCCTCCAGG - Intronic
1062194657 9:135266278-135266300 CCTCCTGGGCTGCCTCCTCCTGG + Intergenic
1062355167 9:136158439-136158461 GATGCTGAGCAGCCACCTCCAGG - Intergenic
1062702966 9:137917634-137917656 ACTCCTGAGGTGGGTCCTCCTGG + Intronic
1187353797 X:18546885-18546907 GATCCTGCAGTGCTTCCTGCAGG + Intronic
1190693775 X:52934716-52934738 GAGCCTGAGTTGCCACCTTCTGG - Intronic
1192784776 X:74325213-74325235 GATCATGAGCTGCCTCCTGGTGG + Intergenic
1197795985 X:130299353-130299375 GGTCTTGTGGTGCCTCTTCCAGG - Intergenic
1199612686 X:149631556-149631578 GAACCTGAGGGGCCTCTTCCAGG - Exonic