ID: 1176263715

View in Genome Browser
Species Human (GRCh38)
Location 20:64197629-64197651
Sequence CCTTCCCGGGGAGCCACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176263715_1176263720 -5 Left 1176263715 20:64197629-64197651 CCTGGTGTGGCTCCCCGGGAAGG No data
Right 1176263720 20:64197647-64197669 GAAGGATGTTTTGCATAGCATGG No data
1176263715_1176263721 5 Left 1176263715 20:64197629-64197651 CCTGGTGTGGCTCCCCGGGAAGG No data
Right 1176263721 20:64197657-64197679 TTGCATAGCATGGAGTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176263715 Original CRISPR CCTTCCCGGGGAGCCACACC AGG (reversed) Intronic