ID: 1176264181

View in Genome Browser
Species Human (GRCh38)
Location 20:64200113-64200135
Sequence ACATGATGGGGCCAGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264181_1176264188 0 Left 1176264181 20:64200113-64200135 CCTCTGTCCTGGCCCCATCATGT 0: 1
1: 0
2: 0
3: 37
4: 319
Right 1176264188 20:64200136-64200158 GGCGCACCAGCATCATGGCAAGG 0: 1
1: 0
2: 1
3: 7
4: 95
1176264181_1176264187 -5 Left 1176264181 20:64200113-64200135 CCTCTGTCCTGGCCCCATCATGT 0: 1
1: 0
2: 0
3: 37
4: 319
Right 1176264187 20:64200131-64200153 CATGTGGCGCACCAGCATCATGG 0: 1
1: 0
2: 1
3: 4
4: 81
1176264181_1176264191 22 Left 1176264181 20:64200113-64200135 CCTCTGTCCTGGCCCCATCATGT 0: 1
1: 0
2: 0
3: 37
4: 319
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1176264181_1176264190 6 Left 1176264181 20:64200113-64200135 CCTCTGTCCTGGCCCCATCATGT 0: 1
1: 0
2: 0
3: 37
4: 319
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264181 Original CRISPR ACATGATGGGGCCAGGACAG AGG (reversed) Intronic
900131514 1:1089232-1089254 CCATGGAGGGGCCAGGCCAGCGG - Intronic
900147765 1:1165882-1165904 ACAGGCTGGGGCCAGGGCAGGGG + Intergenic
900419781 1:2550920-2550942 GGATGATGGGGCCAGGGCTGGGG - Intergenic
900515967 1:3082395-3082417 ACAGGATGGGGACAGGAGAGTGG + Intronic
900638624 1:3677528-3677550 ACTTGATGGTGCCAGGGCTGGGG + Intronic
901597153 1:10394802-10394824 CCATGATAGGCCCAGTACAGTGG + Intergenic
902147433 1:14415428-14415450 ACAGAATAGGGACAGGACAGTGG - Intergenic
902636461 1:17737969-17737991 ACATGATGAGTCAGGGACAGAGG - Intergenic
903182422 1:21611631-21611653 CCTCCATGGGGCCAGGACAGGGG + Intronic
904585035 1:31575652-31575674 ACAGGTTGGGCCCAGGCCAGAGG - Intergenic
905252783 1:36660219-36660241 AGATGATGAGGCCGGGACTGGGG - Intergenic
905275498 1:36815298-36815320 ACATGGTGGGGGCTGGGCAGCGG + Intronic
905976248 1:42175971-42175993 ACAAGATGGGGCAAGGGCAGGGG + Intergenic
906692078 1:47799212-47799234 CCATGATGTGGCCAGGAGGGCGG - Intronic
906703501 1:47877081-47877103 TAATGATGGGGACAGGAAAGAGG + Intronic
907421932 1:54353508-54353530 ACTTGGTGGGGCCAGCATAGAGG - Intronic
907633531 1:56108807-56108829 ACAGAATGGGCCCAGCACAGTGG + Intergenic
907941816 1:59095603-59095625 ACATGATGGGGTTAGGACATGGG - Intergenic
909045055 1:70699773-70699795 ATGTAATGGGGCAAGGACAGGGG - Intergenic
911748171 1:101464233-101464255 ACTAGATGGGGGAAGGACAGTGG + Intergenic
912681502 1:111732079-111732101 ACCTGGGAGGGCCAGGACAGTGG + Intronic
913330648 1:117664324-117664346 ACATGATGAGGTCATGACTGCGG - Intergenic
915565869 1:156712432-156712454 GAACGATGGGGCCAGGACTGGGG - Intergenic
915933913 1:160078805-160078827 ACAGGGTGGTGCCAGAACAGAGG + Intergenic
916087017 1:161278312-161278334 AGATGATGGGGCCTGGACTAGGG - Intronic
916729095 1:167550510-167550532 AGAGGAAGGGGCAAGGACAGAGG + Intronic
917110914 1:171546937-171546959 ACATAATAGGCCCAGGGCAGTGG + Intronic
917177511 1:172253229-172253251 ACATGAGGGGGAAAGGACGGAGG + Intronic
918297033 1:183166803-183166825 TCATTATGGGGGCAGGGCAGGGG - Intergenic
919236177 1:194845362-194845384 ATATGTTGGGGCCAGAAAAGTGG - Intergenic
920440820 1:205979374-205979396 CCTGGATGTGGCCAGGACAGAGG - Intronic
920839894 1:209545460-209545482 CCATGATGGGGGAAGGGCAGGGG - Intergenic
921081419 1:211741311-211741333 ACTTGATGGCGCCATGACAGAGG + Intergenic
921181780 1:212637158-212637180 CCATGATGGGGCCAGGAGTGTGG - Intergenic
922021938 1:221714491-221714513 ACAAGATGGCGCCAGGCAAGGGG + Intronic
922721545 1:227902572-227902594 ACATGTACAGGCCAGGACAGTGG + Intergenic
923278494 1:232418931-232418953 ACGTGATGGGGGCACAACAGTGG + Intronic
923760186 1:236835252-236835274 AGAAGATGGGGCCAGCTCAGAGG + Intronic
924375447 1:243403231-243403253 ACATGGTGGAGCCAGGGCTGAGG + Intronic
1063542847 10:6951711-6951733 TCATGTTGGGGCCAGGACAATGG + Intergenic
1064417981 10:15167818-15167840 ACAGGATACGGCCAGGTCAGCGG + Intronic
1064710395 10:18118003-18118025 TCATGGTGGGGCCAGGGTAGGGG + Intergenic
1066446945 10:35492090-35492112 ACATGATGGAGGCAGGAGACTGG - Intronic
1068618651 10:59152138-59152160 AAATGATAGTGCCAGGATAGAGG + Intergenic
1071789499 10:88939328-88939350 ACATAATGAGGCCAGGAAAAAGG - Intronic
1072246850 10:93551252-93551274 ATCTGATGAGGCCAGGCCAGGGG + Intergenic
1072407418 10:95168467-95168489 CCCTGAGGAGGCCAGGACAGAGG + Intergenic
1073736689 10:106355589-106355611 GCATGTAGGGGCCATGACAGGGG - Intergenic
1074882092 10:117667328-117667350 GCAGGATGGGGGCAGGCCAGGGG + Intergenic
1076820913 10:132939133-132939155 ACAAGAATGGGCAAGGACAGAGG + Intronic
1077085259 11:747061-747083 CCATGGTGGGGCCAGGACTGGGG - Intergenic
1077170833 11:1165079-1165101 GCCTCAGGGGGCCAGGACAGGGG - Intronic
1077916649 11:6615916-6615938 ACATGGTGGGGTCAAGACAAAGG + Intronic
1078017142 11:7624561-7624583 ACATGATTGGGCCAACACATGGG + Intronic
1078413056 11:11143383-11143405 GCATGCTGGGGCCAGGTCAAAGG - Intergenic
1078671059 11:13365847-13365869 ACAATATGTGGCAAGGACAGAGG + Intronic
1079150145 11:17891409-17891431 ATATGATGTGACCAGCACAGAGG - Intronic
1079710981 11:23681052-23681074 ACAACATGAGGCCAGGGCAGAGG + Intergenic
1080079833 11:28203555-28203577 ACATGATGTGGAAAGGACATAGG + Intronic
1080932678 11:36829175-36829197 GCATGATGGGGCTGGGACTGAGG - Intergenic
1083155167 11:60818361-60818383 ACCTGTTTGGGCCATGACAGTGG - Intergenic
1083694005 11:64430445-64430467 AAAAGAGGGGGCCAGAACAGTGG - Intergenic
1083997034 11:66277868-66277890 ACACAATGACGCCAGGACAGGGG - Intergenic
1084012701 11:66361561-66361583 AGGTGATGGGGCCTAGACAGTGG - Intronic
1084453165 11:69251966-69251988 ACATGAAGAGGCCGGGACCGTGG - Intergenic
1085846636 11:80073430-80073452 ACATTCTGGGGCCATGACAAAGG - Intergenic
1087841699 11:102927423-102927445 AGATGCTTTGGCCAGGACAGTGG + Intergenic
1089296411 11:117471615-117471637 AGATGCTGGGGCCAGGGGAGTGG + Intronic
1089750747 11:120649421-120649443 GCATGATGGAGCCAGGCCAAGGG + Intronic
1091256289 11:134188935-134188957 AGATCATGGTGCCAGGAGAGTGG - Intronic
1091287834 11:134418171-134418193 ACATGATGGAGCTAGGCCACTGG + Intergenic
1091335210 11:134761458-134761480 ACTCCATGGGGCCAGGCCAGAGG - Intergenic
1091996432 12:4997654-4997676 ACATGCTGGGGCCAGGAGCCTGG - Intergenic
1093054858 12:14546000-14546022 AGAGCATGAGGCCAGGACAGAGG - Intronic
1093488033 12:19673796-19673818 TCAAGATGGGCCCAGCACAGTGG - Intronic
1094701529 12:32875034-32875056 ATATGATGAGGCCAGCACAGTGG - Intronic
1097877211 12:64654451-64654473 AGATTATGGGGCCGGGGCAGTGG - Intronic
1100200641 12:92294449-92294471 ACATGATCAGGAGAGGACAGAGG - Intergenic
1100480743 12:94975991-94976013 CCATGATCGTGCCTGGACAGCGG + Intronic
1100904151 12:99278353-99278375 AAATGATGGGACCTGGACACAGG - Intronic
1101416849 12:104515803-104515825 ACATGATGGGGCTGGGGCAGCGG + Intronic
1102012423 12:109626732-109626754 ACATGGTGGAGGCAGGAAAGCGG + Intergenic
1103939536 12:124494429-124494451 GCATGGTGTGGCCAGGACAACGG - Intronic
1103986707 12:124772265-124772287 ACAGGATGGCTCCAGGGCAGGGG + Intergenic
1104886295 12:132110891-132110913 GCTTGCTGGGGCCAGGCCAGAGG - Intronic
1105840455 13:24249512-24249534 ACAGGATGAGGAAAGGACAGAGG + Exonic
1108040265 13:46333345-46333367 ACACCATGGGGGCAGGAGAGTGG - Intergenic
1111262732 13:85763040-85763062 ACATGATGTGGCTGGCACAGTGG + Intergenic
1113715968 13:112508110-112508132 ACCTGGTGGGGCCAGGGCTGCGG - Intronic
1114538842 14:23440025-23440047 TCAAGATGGGGACATGACAGTGG + Intergenic
1115887839 14:37993734-37993756 ACATGAGCGGGGCAGGAGAGAGG + Intronic
1117986905 14:61395736-61395758 ACAAGATGGTCCCAGGGCAGGGG - Intronic
1118819273 14:69334536-69334558 ACATGGTGCGGGCAGGATAGAGG + Intronic
1119545672 14:75469737-75469759 ACTTGAAGGAGGCAGGACAGAGG + Exonic
1119568354 14:75647783-75647805 ATATGCTGAGGCCAGGGCAGTGG - Exonic
1120964289 14:90153921-90153943 ACCTGGTGACGCCAGGACAGAGG - Intronic
1121825670 14:97007943-97007965 ACAAGATGTGGCCATCACAGAGG + Intergenic
1122411055 14:101526412-101526434 ACATGGTGGGACCAGGACCCCGG - Intergenic
1202930916 14_KI270725v1_random:31375-31397 ACAATACAGGGCCAGGACAGAGG - Intergenic
1124033503 15:26032518-26032540 AGATGATGGGGTTAGGACATGGG - Intergenic
1124561140 15:30774448-30774470 ACATAATAGGGCCTGAACAGAGG + Intergenic
1124669390 15:31624611-31624633 ACATAATAGGGCCTGAACAGAGG - Intronic
1125204803 15:37141607-37141629 ACATGATGCAGGCAGGACAATGG + Intergenic
1126439619 15:48673411-48673433 ATATGATGGTGACAAGACAGGGG - Intergenic
1127764515 15:62172142-62172164 AAACGGTGGGGCCAGGACGGGGG - Intergenic
1128672617 15:69585950-69585972 ACATGGAGGGGCAAGGACACAGG - Intergenic
1129199487 15:73990410-73990432 AACTGATGAGGCCATGACAGAGG + Exonic
1130808078 15:87348047-87348069 CCAAGAAGGGGCCAGGACATAGG - Intergenic
1132051201 15:98609253-98609275 AGATGATGAGGCCATGACGGTGG + Intergenic
1132220234 15:100099875-100099897 ACAGGATGGGCCGTGGACAGTGG + Intronic
1132487916 16:205874-205896 ACATTTTGGGCCCAGCACAGTGG - Intronic
1132717784 16:1300864-1300886 ACACGCTTTGGCCAGGACAGTGG - Intergenic
1133088988 16:3389179-3389201 ACATGATGAAGCCAGGAAACTGG + Intronic
1133323626 16:4930346-4930368 ACTGGATGGGGACAGGGCAGGGG + Intronic
1133398125 16:5464649-5464671 ACATGATGGGGCACAAACAGAGG - Intergenic
1133748150 16:8702908-8702930 AAATGATGGAGGCAGGAAAGTGG + Intronic
1134075770 16:11290391-11290413 ACATGATGGGGTGGGGACAAGGG + Intronic
1134167315 16:11941264-11941286 CCCTGAGGCGGCCAGGACAGAGG + Intronic
1134493382 16:14712419-14712441 CCCTGAGGCGGCCAGGACAGAGG - Intronic
1134498763 16:14751543-14751565 CCCTGAGGCGGCCAGGACAGAGG - Intronic
1134791854 16:16996276-16996298 ACATAATGGGGCCAGGTCTAGGG + Intergenic
1135221774 16:20620792-20620814 CCCTGAGGTGGCCAGGACAGAGG + Intronic
1135312739 16:21418904-21418926 CCCTGAGGCGGCCAGGACAGAGG + Intronic
1135365656 16:21851174-21851196 CCCTGAGGCGGCCAGGACAGAGG + Intronic
1135446152 16:22519978-22520000 CCCTGAGGCGGCCAGGACAGAGG - Intronic
1135643912 16:24144867-24144889 AGATGTTGGGGACATGACAGTGG + Intronic
1135946051 16:26865940-26865962 ACATCAGGGGGGCAGGAGAGAGG - Intergenic
1136000169 16:27286460-27286482 AAATGATGGTGCCAGGAAAGAGG + Intronic
1136151882 16:28356622-28356644 CCCTGAGGCGGCCAGGACAGAGG + Intronic
1136168117 16:28470459-28470481 CCCTGAGGCGGCCAGGACAGAGG + Intronic
1136211197 16:28758661-28758683 CCCTGAGGCGGCCAGGACAGAGG - Intronic
1136255917 16:29038612-29038634 CCCTGAGGCGGCCAGGACAGAGG - Exonic
1136322857 16:29499419-29499441 CCCTGAGGCGGCCAGGACAGAGG + Intronic
1136437541 16:30239387-30239409 CCCTGAGGCGGCCAGGACAGAGG + Intronic
1136913499 16:34162161-34162183 ACATGTAGGGGCCACGGCAGGGG - Intergenic
1139551104 16:67673540-67673562 ACATGATGGAGCCAGGAGCCTGG - Intergenic
1140365606 16:74377931-74377953 CCCTGAGGCGGCCAGGACAGAGG - Exonic
1140652665 16:77105748-77105770 ACAGGATGGGGCTGGGACAAGGG + Intergenic
1141008048 16:80371597-80371619 GCATGATGGAGCCAGGCCTGAGG - Intergenic
1141077566 16:81021449-81021471 ACATGATGCAGCCAGGATGGTGG - Intronic
1141359381 16:83381311-83381333 ACATGAAGGGGCAGGGAAAGGGG - Intronic
1141489557 16:84362951-84362973 GCAGGATGGGGCCTGGAGAGTGG - Intergenic
1142148454 16:88502414-88502436 ACATGGAGGGGCAAGCACAGAGG - Intronic
1142154766 16:88527939-88527961 AGAGGATGGGGTCAGGAGAGCGG - Intronic
1142298752 16:89243980-89244002 CCATCAGGGGGACAGGACAGAGG - Intergenic
1144174545 17:12692563-12692585 ACAGGATGGGGCAAGGACATTGG - Intronic
1144277762 17:13690622-13690644 ACATGCTGGGGCCTGTCCAGGGG + Intergenic
1145037911 17:19554009-19554031 GGCTGATGGGGCCAGGACAATGG - Intronic
1145101425 17:20080861-20080883 ACATGATGGGATCAGTGCAGGGG + Intronic
1145901350 17:28492302-28492324 ATATGGTGGGGTCACGACAGAGG + Intronic
1146007556 17:29170256-29170278 AGATTATGGTGGCAGGACAGGGG - Intronic
1148724716 17:49780418-49780440 ACATGCTGGGGTAAGGGCAGTGG + Intronic
1150888068 17:69110593-69110615 AGATAATGGGGACAGGAGAGAGG - Intronic
1150970285 17:70019536-70019558 ACTTGATGGGGCCAGTGCAACGG + Intergenic
1151096304 17:71503149-71503171 AAATGAAGGGGGCAGGAAAGGGG - Intergenic
1152155005 17:78627187-78627209 ACCTGATGGGGGCTGGAGAGCGG + Intergenic
1153619448 18:6963312-6963334 TCATGCTGGGACCAGGACTGGGG - Intronic
1153761628 18:8337529-8337551 ACCCACTGGGGCCAGGACAGTGG + Intronic
1154118591 18:11633371-11633393 CCCTGAGGCGGCCAGGACAGAGG + Intergenic
1157147011 18:45174110-45174132 AAATGATGAGCCCAGGTCAGGGG - Intergenic
1157296410 18:46448165-46448187 ATATAAGGGGGCCAGGACACAGG - Intronic
1158022484 18:52859516-52859538 ACATGAGGGGACCAGGGAAGAGG + Intronic
1161087705 19:2342877-2342899 AGATGGTGGGGCCAGGACGGTGG - Intronic
1161327853 19:3672036-3672058 CTGTGATGGGGCCAGGAGAGAGG - Intronic
1162273657 19:9636388-9636410 TCATGATGCGGCCAGCTCAGAGG + Intronic
1162319465 19:9962610-9962632 GAATGATGGTGCCAGGATAGGGG - Intronic
1162402587 19:10454780-10454802 AAATGATGGGGGAAGCACAGTGG - Intronic
1162856637 19:13473696-13473718 ACATGGTGGGGACATGACAGTGG - Intronic
1163220290 19:15913948-15913970 GCATGATGGGGCCGGGATGGGGG - Intronic
1163366319 19:16877915-16877937 AGCTGGTGGGGCCAGGCCAGAGG + Intronic
1164255457 19:23524381-23524403 AGATGATGGGTCCAGGAATGTGG + Intergenic
1164974754 19:32564008-32564030 GCATGCTGGTGCCAGGACTGAGG - Intergenic
1166441940 19:42823094-42823116 ACATAAAGGGGCAAGGAAAGTGG + Intronic
1166461365 19:42991376-42991398 ACATAAAGGGGCAAGGAAAGTGG + Intronic
1168547573 19:57266304-57266326 AAATGATGGGGCCGGGGCAGTGG - Intergenic
925600956 2:5608309-5608331 ACATGATATGGCCAGGAGATGGG + Intergenic
926803719 2:16685296-16685318 ACGGGATGGGGCCTTGACAGAGG - Intergenic
927156139 2:20222890-20222912 ACATGATGGGGCCTCAGCAGGGG - Intronic
927852729 2:26510398-26510420 ACAGGATGGGGGCTGAACAGTGG + Intronic
928276224 2:29902565-29902587 GCAGGATGGGGCCAGGACCTTGG - Intronic
930292149 2:49508620-49508642 ACCAGATGGGAGCAGGACAGGGG - Intergenic
930929439 2:56862523-56862545 AGTTGATAGGGACAGGACAGTGG - Intergenic
931103109 2:59024881-59024903 GCTTGGTGGGGCCAGGAAAGAGG - Intergenic
931823073 2:65972010-65972032 ACATGATGGATTCAAGACAGAGG + Intergenic
932753245 2:74386128-74386150 GCATGGAGGGGGCAGGACAGTGG - Intronic
932757316 2:74417640-74417662 ACCTGCTGCTGCCAGGACAGTGG + Exonic
932878413 2:75476556-75476578 AAATGTTAGGGTCAGGACAGAGG - Intronic
934032498 2:88061004-88061026 ACATGATGAGGCCAGGAGTAGGG - Intergenic
934461845 2:94217015-94217037 ACAATACAGGGCCAGGACAGAGG - Intergenic
935544931 2:104390898-104390920 ACATGGTGGTGCCAGGATAGAGG - Intergenic
938536698 2:132253964-132253986 GCAGGATGGGGCTGGGACAGTGG + Intronic
938946893 2:136220586-136220608 GGAGGATGGGGCCAGGAAAGAGG + Intergenic
941733749 2:168949062-168949084 AGGTGATGGGGCCAGGACTAGGG - Intronic
942268131 2:174248333-174248355 CCAAGATGGGGCCAGGGCAGCGG - Intronic
942616181 2:177794150-177794172 GCATGTTGGGGGCAGGAAAGGGG + Intronic
942800554 2:179870339-179870361 AAATGATGGAGCCAGGCAAGAGG - Intergenic
943249298 2:185496303-185496325 GCATGAGCGGGCCAGGAGAGGGG - Intergenic
944649033 2:201810410-201810432 ACATGATAGGGCTATGACAGAGG + Intronic
945884978 2:215365612-215365634 ACAGGATGGTGCCATGACAATGG - Exonic
948511217 2:238466508-238466530 CCATGCTGGGGCCAGGAGACAGG - Intergenic
948792104 2:240384442-240384464 CCATGCTGGGGCCAGAACACAGG - Intergenic
1169609091 20:7359156-7359178 ACATTATGGGGCAAAGAGAGAGG + Intergenic
1169745319 20:8936957-8936979 ACATGCTGTGGCCCAGACAGTGG - Intronic
1171056224 20:21909494-21909516 CCTTGATGGGTGCAGGACAGAGG - Intergenic
1171310489 20:24141126-24141148 ACATGGTGGTGCCAAGTCAGGGG + Intergenic
1171865592 20:30485739-30485761 GCAGGATGGGGCCGAGACAGTGG + Intergenic
1172030349 20:31977644-31977666 ACAAGATGGGGTTAGGACAGGGG + Intronic
1172438513 20:34948109-34948131 AGATGCTGAGGCCAGGGCAGTGG - Intronic
1173827805 20:46058514-46058536 GCAAGTTGGGGCCAGGATAGGGG + Intronic
1174498350 20:50965617-50965639 AGATTATGGTGCAAGGACAGAGG + Intergenic
1174991626 20:55517028-55517050 ACTAGAGGGGGCCAGGAGAGAGG - Intergenic
1175486617 20:59351462-59351484 ACATGGTGGGGCAGGGACAGGGG - Intergenic
1176117276 20:63438569-63438591 ACAAGGTGGGACCAGGACAAGGG + Intronic
1176264181 20:64200113-64200135 ACATGATGGGGCCAGGACAGAGG - Intronic
1178426459 21:32482800-32482822 CCCTGAAGGGGGCAGGACAGTGG - Intronic
1178664907 21:34538042-34538064 AAATGATTGGGCCATGTCAGAGG + Intronic
1179268873 21:39832523-39832545 CTATGATGGGGCCAGGGAAGAGG + Intergenic
1179822696 21:43945913-43945935 ACCTGGTGGGGGCTGGACAGGGG + Intronic
1181354403 22:22289739-22289761 ACAATACAGGGCCAGGACAGAGG + Intergenic
1182404251 22:30110868-30110890 ACAGGACGGGGCCAGGGCAGTGG + Intronic
1182418434 22:30236315-30236337 ACATGATTGGGGCAGGAAATTGG - Intergenic
1183195272 22:36349440-36349462 ACAAGTTGGGCCCAGGACAGTGG + Intronic
1183715591 22:39531648-39531670 ACATGCTGTGGCCTGGGCAGTGG - Intronic
1185119038 22:48954877-48954899 ACCTGATGGGGCCAGCATGGTGG - Intergenic
1185124631 22:49001730-49001752 CCATTATGGGGCCTGGGCAGTGG + Intergenic
950080634 3:10219692-10219714 ACACGCTGGGGCCAGGGGAGGGG - Exonic
951441951 3:22733538-22733560 ACATGATGGGTCTAGGAATGTGG - Intergenic
951477283 3:23120493-23120515 ATTTGATGGAACCAGGACAGGGG + Intergenic
952747324 3:36793574-36793596 ACAGGATGGGGCCAAGGCAAAGG - Intergenic
953068834 3:39499774-39499796 ACATAATAGAGCCAGGACACAGG - Intronic
954144688 3:48628750-48628772 ACAGGATGCAGCCAGGAGAGAGG - Intronic
954296884 3:49679246-49679268 AGCTGATGGGGACAGGACTGAGG + Intronic
954406620 3:50348812-50348834 ACAGGATGAGGCCAGGGCTGTGG + Intronic
955254928 3:57321410-57321432 ACATGTTGGGGTGAGGGCAGGGG + Intronic
958815322 3:98907881-98907903 AGGAGATGGGGCCAGGTCAGAGG + Intergenic
962160057 3:132989614-132989636 ACGGGATGGGGCTAGGAGAGAGG - Intergenic
962388017 3:134948665-134948687 ACATGGTGGGGCCTGGGCACAGG + Intronic
962757014 3:138472707-138472729 ACTTGATGGGCCCTGGAGAGTGG - Exonic
962907143 3:139814316-139814338 ACATGGTGGGGCCTGTCCAGTGG + Intergenic
963046647 3:141107448-141107470 ACATAGTGGGGACAGGACAGAGG - Intronic
963737438 3:149035846-149035868 AAATGATGGGTCCGGCACAGTGG + Intronic
965836548 3:172859850-172859872 AGATGATGGGGCCAGGGCTTTGG - Intergenic
967222824 3:187262615-187262637 ACATGAAGGAGCCAGGGGAGAGG + Exonic
967956014 3:194877810-194877832 GCTTGATGTGGCCAGGGCAGAGG - Intergenic
968869447 4:3234242-3234264 ACATGCTGGAGCAGGGACAGCGG + Intronic
969541020 4:7788920-7788942 AAAGGATGGGGTCAGAACAGAGG + Intronic
971660970 4:29415262-29415284 ACATCAAGGTGCAAGGACAGTGG + Intergenic
974065584 4:57073971-57073993 GCTTGCTGGTGCCAGGACAGTGG - Intronic
978771063 4:112456924-112456946 AATGGATGGGGACAGGACAGGGG - Intergenic
980069507 4:128228623-128228645 ACATGCTGGGGCCAAAACAGGGG - Intergenic
985059266 4:186059539-186059561 ACATGATCGGCCCAGCACGGTGG - Intergenic
985915789 5:2918141-2918163 ACATGAGCAGGGCAGGACAGGGG - Intergenic
985936965 5:3104818-3104840 ACAGGAAGGGGCCAGGAGCGGGG - Intergenic
989402348 5:41022191-41022213 GGATGGTGGGGGCAGGACAGTGG + Intronic
989761144 5:45018417-45018439 ACATGATGAAGCCATGACAATGG - Intergenic
991181807 5:63760720-63760742 AATTGATGGGGCCAGGAGTGAGG - Intergenic
992459519 5:76947190-76947212 ACATGGGGGGGCCAGGACGTGGG - Intergenic
992802755 5:80308720-80308742 ACAAGATGGCGCCAGCCCAGTGG - Intergenic
993974987 5:94468430-94468452 ATATGATGCTGCCAGGAGAGGGG + Intronic
995629600 5:114118887-114118909 ACAAGATGGAGGCAGGATAGGGG + Intergenic
996125993 5:119726415-119726437 AGATGATGGGGCCTGGAGGGAGG + Intergenic
999637306 5:153635946-153635968 ACATGTTGGCACAAGGACAGAGG - Intronic
1000139022 5:158383204-158383226 ACATAATTGGGGCAGGAAAGAGG - Intergenic
1001546307 5:172572671-172572693 CAAGAATGGGGCCAGGACAGGGG + Intergenic
1001596478 5:172902100-172902122 AAATGCTGGGGCCAGGGAAGTGG - Intronic
1002025132 5:176391682-176391704 ACCTGATGGGGGCAGGATTGGGG + Intronic
1002653670 5:180724196-180724218 AGACGATGGGGACAGGAGAGGGG - Intergenic
1002994273 6:2268327-2268349 AACTGAGGGGGCCAGGACACTGG + Intergenic
1004741077 6:18461813-18461835 AGATCATGGGGCCAGGAGAGGGG + Intronic
1005012526 6:21349392-21349414 AAATGATAGGGCCAGGGGAGGGG + Intergenic
1006900410 6:37496894-37496916 ACAGTTTGGGCCCAGGACAGTGG + Intronic
1007174291 6:39885616-39885638 AGGTGAGGGGGACAGGACAGGGG - Intronic
1007518505 6:42432552-42432574 ACATGATGGGCCAGGCACAGTGG + Intronic
1008384885 6:50877430-50877452 ACATTATGGGACCAGAAAAGTGG - Intergenic
1008399329 6:51046520-51046542 ACAGGATGGGGGCAGAACAAAGG + Intergenic
1008890737 6:56486645-56486667 AAATGCTGGGGCCAGATCAGTGG + Intronic
1012640900 6:101612075-101612097 AAAAGATGGGGCCTGGACTGAGG + Intronic
1013606119 6:111750347-111750369 ACATGGTGGGAGCAGGAGAGAGG - Intronic
1017222821 6:151986162-151986184 TCATAACGGGGCCAGGACTGGGG + Intronic
1017642120 6:156504610-156504632 AGATGATGGGGTTAGAACAGAGG - Intergenic
1018972867 6:168540639-168540661 ACATGAGGGTGACAGGAAAGAGG - Intronic
1018994715 6:168702054-168702076 ACAAGATTCGGGCAGGACAGAGG + Intergenic
1019295156 7:269969-269991 ACAGGAGAGGGCCAGGAGAGTGG - Intergenic
1020726431 7:11820587-11820609 AGAGGAAGAGGCCAGGACAGAGG - Intronic
1023912341 7:44564991-44565013 GTATGATGGGGGCAGGACAGTGG - Intergenic
1024412038 7:49054824-49054846 ACATTAGGGAGCCAGGACAGGGG - Intergenic
1024528709 7:50372533-50372555 AAATAATGGGGAAAGGACAGAGG - Intronic
1024531122 7:50393429-50393451 ACATGAAGGGGGAAGGACAGAGG + Intronic
1026522555 7:71130156-71130178 TCAGGATGAGGCCATGACAGTGG + Intergenic
1026739397 7:72969386-72969408 GCATGATGGGGCACGGACATGGG - Exonic
1026827939 7:73595756-73595778 ACAGGCTGGGGGCAGGGCAGGGG + Exonic
1026898712 7:74025697-74025719 ACAGGCTGGGGGCAGGACACAGG + Intergenic
1026985939 7:74555307-74555329 CCAGGATGGGAGCAGGACAGAGG - Intronic
1027104334 7:75395687-75395709 GCATGATGGGGCACGGACATGGG + Exonic
1028783985 7:94771403-94771425 ACATGATGGGGGCATGTCAAAGG + Intergenic
1029187965 7:98753115-98753137 ACAGGATGGGGTTAGGCCAGCGG - Intergenic
1031959047 7:127972499-127972521 ACTTCATGAGGCCAAGACAGGGG - Intronic
1032400239 7:131619581-131619603 GCTTGTTGGGGACAGGACAGGGG + Intergenic
1033157039 7:138966006-138966028 AAATGATGTGGCCAGTGCAGAGG - Intronic
1033666586 7:143446438-143446460 AGATGATGGGGACATCACAGGGG - Intergenic
1034222050 7:149454361-149454383 ACTCTTTGGGGCCAGGACAGTGG - Intronic
1034406040 7:150903041-150903063 ACATGCTGGGGCCAGGCACGAGG + Intergenic
1034886696 7:154803807-154803829 CCATGCTGGGGCCGGGACACCGG + Intronic
1034994519 7:155569744-155569766 CCAAGAGGGGGACAGGACAGGGG - Intergenic
1036765733 8:11548243-11548265 AAATGCTGGGGCCAGGGCTGGGG - Intronic
1037071431 8:14654951-14654973 TAATGATGGGGCCAGTGCAGTGG - Intronic
1037080948 8:14785577-14785599 ACATGCTGGGGTCAGGACATGGG - Intronic
1039827661 8:41188812-41188834 ACATGATGGGCCGGGCACAGTGG - Intergenic
1039902790 8:41765532-41765554 AAATGATTAGGCCAGCACAGTGG - Intronic
1042247179 8:66719604-66719626 ACAGGATGGGCACAGCACAGTGG - Intronic
1042747699 8:72125440-72125462 ACATGAGGAGGGCAGGAGAGAGG + Intergenic
1047871824 8:129091481-129091503 ACATGAGCAGGGCAGGACAGGGG - Intergenic
1049163476 8:141112233-141112255 AGATGCAGGGGCCAGGGCAGAGG + Intergenic
1049276960 8:141724805-141724827 ACAGCATGGGGCCACGAGAGTGG - Intergenic
1049465189 8:142748042-142748064 ATGTAATGGGGCCAGGGCAGAGG + Intergenic
1050180193 9:2914175-2914197 ACATGATGGGGGAAGGGGAGGGG + Intergenic
1051142415 9:13991962-13991984 AGATGATGGGGACAGGGCTGAGG - Intergenic
1051300374 9:15644384-15644406 AGATGGTGGGTGCAGGACAGTGG + Intronic
1052712331 9:32071847-32071869 AGAAGATGGGGCCAGGAGAGTGG - Intergenic
1053520982 9:38779515-38779537 AGATAGTGGGGGCAGGACAGTGG + Intergenic
1053692316 9:40592667-40592689 ACAATATAGGGCCAGGACAGAGG - Intergenic
1054193139 9:62003508-62003530 AGATAGTGGGGGCAGGACAGTGG + Intergenic
1054272482 9:63044818-63044840 ACAATATAGGGCCAGGACAGAGG + Intergenic
1054303576 9:63393633-63393655 ACAATATAGGGCCAGGACAGAGG - Intergenic
1054402354 9:64720143-64720165 ACAATATAGGGCCAGGACAGAGG - Intergenic
1054435957 9:65204458-65204480 ACAATATAGGGCCAGGACAGAGG - Intergenic
1054494435 9:65817229-65817251 ACAATATAGGGCCAGGACAGAGG + Intergenic
1054645268 9:67585183-67585205 AGATAGTGGGGGCAGGACAGTGG - Intergenic
1054769051 9:69067483-69067505 ACATGCTGTGGCCCGGACAGTGG + Intronic
1055688063 9:78799212-78799234 TCAAGCTGGGGCCAGGACATAGG + Intergenic
1055791401 9:79926651-79926673 ACATGGAGGTGCAAGGACAGTGG + Intergenic
1057952699 9:99382606-99382628 ACATCATGAGGCCAGGCCACAGG + Intergenic
1059389712 9:113991288-113991310 CCATGAGGTGGCCGGGACAGGGG - Intronic
1060515241 9:124261505-124261527 ACATCAGGGGGCCAGAACACCGG - Intronic
1061095635 9:128455642-128455664 TCCTGTTGGGGCCAAGACAGAGG + Intronic
1061246505 9:129403576-129403598 TCAGGATGGGGCCGGGACTGAGG + Intergenic
1061817061 9:133203836-133203858 TCATGAGGTGGCCAGGACATTGG + Intergenic
1061927919 9:133815197-133815219 TCAAGATGGGGCCAGGGAAGAGG - Intronic
1062026621 9:134343638-134343660 GCAAGATGGGGACAGGGCAGGGG - Intronic
1062619287 9:137412122-137412144 CCAGGATGCGGCAAGGACAGGGG + Intronic
1203622983 Un_KI270749v1:138804-138826 ACAATACAGGGCCAGGACAGAGG - Intergenic
1186590914 X:10929097-10929119 ATATGATGTGGCCAAGAAAGGGG - Intergenic
1187404696 X:18992637-18992659 AGATGCTGGGGCAAGGACTGAGG + Intronic
1187443121 X:19337816-19337838 ACATGATGGGCCGAGTGCAGTGG + Intergenic
1188214815 X:27463302-27463324 ACCTGACGGGGCGAGGCCAGAGG - Intergenic
1189295083 X:39912226-39912248 ACAGGATGGGGTGGGGACAGAGG - Intergenic
1189357639 X:40323544-40323566 AGAAGAAGGGGCCAGGAAAGAGG - Intergenic
1192045243 X:67665115-67665137 AAATGGTGGGTGCAGGACAGTGG - Intronic
1192182645 X:68926008-68926030 ACATATTGGGGACAGGAGAGAGG + Intergenic
1195732603 X:107981587-107981609 ACATTCTGGGGACAGGGCAGGGG + Intronic
1196102893 X:111866050-111866072 AAATGGTGGAGCCAGGACTGGGG + Intronic
1198105222 X:133455303-133455325 AGATGGTGCAGCCAGGACAGTGG + Intergenic
1198654293 X:138896985-138897007 ACATGTTGGGGCCACTTCAGAGG + Intronic
1199985756 X:152948969-152948991 AAATGATGGGGCCTGGACTAGGG + Intronic
1201077601 Y:10199354-10199376 ACATGTGGGGGCCACGGCAGGGG - Intergenic
1202300141 Y:23404673-23404695 ACATGTTGGGGGTGGGACAGTGG + Intergenic
1202570669 Y:26265925-26265947 ACATGTTGGGGGTGGGACAGTGG - Intergenic