ID: 1176264183

View in Genome Browser
Species Human (GRCh38)
Location 20:64200120-64200142
Sequence GTGCGCCACATGATGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264183_1176264192 26 Left 1176264183 20:64200120-64200142 CCTGGCCCCATCATGTGGCGCAC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1176264192 20:64200169-64200191 GCCTACACCTGGTCACCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 79
1176264183_1176264191 15 Left 1176264183 20:64200120-64200142 CCTGGCCCCATCATGTGGCGCAC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1176264183_1176264190 -1 Left 1176264183 20:64200120-64200142 CCTGGCCCCATCATGTGGCGCAC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249
1176264183_1176264188 -7 Left 1176264183 20:64200120-64200142 CCTGGCCCCATCATGTGGCGCAC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1176264188 20:64200136-64200158 GGCGCACCAGCATCATGGCAAGG 0: 1
1: 0
2: 1
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264183 Original CRISPR GTGCGCCACATGATGGGGCC AGG (reversed) Intronic
901303688 1:8217370-8217392 GGGCGCCGCAGGAAGGGGCCGGG + Intergenic
902925016 1:19690294-19690316 CTGCCCCACGTGATGGGGTCAGG + Intronic
903878164 1:26490485-26490507 GTGCAGCACATGGTAGGGCCAGG + Intergenic
906776085 1:48530914-48530936 GTGCGCCCCCTGCTGGAGCCAGG + Intergenic
917240378 1:172941523-172941545 AGGGGCCACATGATGGGCCCTGG - Intergenic
922724277 1:227915241-227915263 GTGGGCCTCATCCTGGGGCCAGG - Intergenic
1067787120 10:49258551-49258573 GAGAGCTACATGAGGGGGCCAGG + Intergenic
1073216588 10:101840014-101840036 CTGCTTCACATGATGGGGCCAGG - Intronic
1077327708 11:1970898-1970920 CTGCGGCACCTGATGGAGCCTGG + Intronic
1077535744 11:3123111-3123133 GTCAGCCACATGCTGGGGTCAGG - Intronic
1084419064 11:69051211-69051233 TGGCCCCACCTGATGGGGCCGGG + Intronic
1202810690 11_KI270721v1_random:26078-26100 CTGCGGCACCTGATGGAGCCTGG + Intergenic
1091634907 12:2189548-2189570 CTGCGCGAGATGAGGGGGCCAGG + Intronic
1094844178 12:34354233-34354255 CTGCCACACATGCTGGGGCCAGG - Intergenic
1111608729 13:90576263-90576285 CTGCCCCACATGATGAGGCAAGG + Intergenic
1121334051 14:93066136-93066158 GTGCTACACAGGATGTGGCCAGG - Intronic
1122631650 14:103109959-103109981 GTTCGCCTCATGCTGGGGCTGGG + Intronic
1123058611 14:105584263-105584285 GTGGGCCACAGGTTGGCGCCGGG + Intergenic
1123082942 14:105704497-105704519 GTGGGCCACAGGTTGGCGCCGGG + Intergenic
1130287155 15:82565601-82565623 GTGTGCCCCATGATGGGGAGTGG - Intronic
1131722605 15:95187148-95187170 GTGCCTCACATGATGGGAGCAGG - Intergenic
1132809032 16:1788857-1788879 GTGCGACACATCCTGGGGCTGGG - Exonic
1138103878 16:54276533-54276555 GTGCTCCAGAAGATGGGCCCCGG - Intergenic
1141630846 16:85287227-85287249 GTGCACCACTTGGTGGGGCTTGG + Intergenic
1142253673 16:89003699-89003721 GTGCCCCTGATGGTGGGGCCTGG - Intergenic
1144140330 17:12341532-12341554 GTGCACCACAGGGTGGGGCTGGG + Intergenic
1151482559 17:74378988-74379010 GTGGGTGACATGATGGGGACGGG + Intergenic
1151517189 17:74604211-74604233 GAGCGCCACATGAGGGTCCCTGG - Intergenic
1155839050 18:30625367-30625389 GTGCCCCACACGATGAGGCAGGG - Intergenic
1161408376 19:4102832-4102854 GTGCGCCACGGGAGGCGGCCAGG + Intronic
1162799678 19:13103596-13103618 CTGCCCCCCATGAAGGGGCCGGG - Intergenic
1165945583 19:39439842-39439864 GTGGGCCAATTGATGGGGCGTGG + Intronic
1167740232 19:51320275-51320297 CAGCCCCACAGGATGGGGCCAGG - Intronic
928067766 2:28183533-28183555 GTGGGACAGATGATGGTGCCTGG + Intronic
930065285 2:47323263-47323285 TTGCTCCACAGGAAGGGGCCAGG - Intergenic
936239317 2:110773481-110773503 GTGGGCAACAGGGTGGGGCCTGG - Intronic
947533876 2:230928928-230928950 GGGAGCCATAGGATGGGGCCTGG - Intronic
948397927 2:237661307-237661329 GTGGGCCACATAATGGAGGCTGG + Intronic
948706648 2:239797909-239797931 GTCAGCCACATCATGGGGCTTGG - Intronic
1172675366 20:36666486-36666508 GTGCGGCTCATGATGGGAACTGG + Intronic
1172872925 20:38147052-38147074 GTGCGGCAGATGGTGGGGGCTGG + Intronic
1175979086 20:62728042-62728064 AAGAGCCAGATGATGGGGCCGGG - Intronic
1176233002 20:64041586-64041608 GTGCGGCACATGGAGGGGCCTGG - Intronic
1176264183 20:64200120-64200142 GTGCGCCACATGATGGGGCCAGG - Intronic
1178488420 21:33033121-33033143 GAGCGCCACCTAAGGGGGCCGGG - Intergenic
1180631410 22:17232654-17232676 GTGCGCCACATGCTGAGACAGGG - Intergenic
1183385518 22:37511970-37511992 GGGAGGCAAATGATGGGGCCAGG - Intronic
1184644237 22:45887774-45887796 GGGCACCACCTGATGGGGGCTGG + Intergenic
952963160 3:38605334-38605356 GTCCCCCACATGGTGGAGCCTGG - Intronic
958928837 3:100187747-100187769 CTGTGCCACATGGTGGAGCCTGG - Intronic
960640506 3:119818156-119818178 GTTTGCCACTTGATGGGGCCTGG + Exonic
961868979 3:129974790-129974812 GGGCTCCACAGGATGGGTCCGGG - Exonic
962388014 3:134948658-134948680 GTTGGCCACATGGTGGGGCCTGG + Intronic
964480099 3:157131156-157131178 GTCCCCAAGATGATGGGGCCAGG + Intergenic
965836550 3:172859857-172859879 GTCAGCAAGATGATGGGGCCAGG - Intergenic
966005116 3:175001333-175001355 GTGAGCCCCAAGATGGGGCAAGG - Intronic
968150929 3:196335955-196335977 GTGCTCTAGATCATGGGGCCAGG + Intronic
969341789 4:6546732-6546754 GTGGAGCACATGATGGGCCCGGG - Intronic
969839085 4:9867624-9867646 GTACTCCCCATGATGGGGCGAGG - Intronic
973022416 4:45220214-45220236 CTGCCCCACATGATGAGGCAAGG - Intergenic
982963583 4:161873188-161873210 GGGCCCCACCTGATTGGGCCAGG - Intronic
985542584 5:493776-493798 GTGGGGCACATGGTGGGGACGGG - Intronic
985763022 5:1761334-1761356 GTGAGCCACATGATATTGCCTGG - Intergenic
988498330 5:31763327-31763349 GTGTGCCGCATGCTGGGGACTGG - Intronic
989333224 5:40284762-40284784 GTGTGACACATCATGGGGCATGG - Intergenic
1003338363 6:5196195-5196217 CTGCGCCAGATGATGGGGACTGG - Intronic
1004706201 6:18126119-18126141 GTGCTCCACAGGGTGGGACCTGG + Intergenic
1008090870 6:47292396-47292418 GTGATCCAGATGATGGGGCTGGG - Intronic
1009948104 6:70363879-70363901 GTGAGTCCCATGAAGGGGCCAGG - Intergenic
1013653733 6:112224076-112224098 GAAGGCCAGATGATGGGGCCAGG - Intronic
1014189299 6:118474541-118474563 GTGCCCCACAAGCTGGGGCAAGG - Intronic
1016813543 6:148283185-148283207 GTGCGCCAAATGAAGAGGACAGG + Intronic
1019342994 7:517319-517341 GTGCGCCCCGAGCTGGGGCCGGG - Intronic
1019734756 7:2645158-2645180 CTGCGCCTCATCATGGGGCCAGG - Intronic
1026739399 7:72969393-72969415 GTGCGGGGCATGATGGGGCACGG - Exonic
1027104332 7:75395680-75395702 GTGCGGGGCATGATGGGGCACGG + Exonic
1033039454 7:137904897-137904919 GTGAGCCACATGTTCTGGCCTGG - Intronic
1035727559 8:1834173-1834195 CTGCGCCACATGCTGGGGAGGGG - Intronic
1039583169 8:38683355-38683377 GTGCTGCTCCTGATGGGGCCAGG - Intergenic
1040995296 8:53395084-53395106 ATGCCCCACATAATGGGGCATGG - Intergenic
1041248228 8:55909213-55909235 GTGTGCCACGTGATGGGCCAGGG + Intronic
1043612300 8:82080052-82080074 CTGCTCCACAAGATGGGGCTGGG + Intergenic
1045066534 8:98451810-98451832 TTGGGCAACATGATGGGACCTGG - Intronic
1046644182 8:116766780-116766802 GTGCACCACAAGGTGGGCCCGGG + Exonic
1050118682 9:2286661-2286683 GTGCTCCACAGGATGGGCCAAGG - Intergenic
1050974176 9:11915680-11915702 GTGGGGCACATGGTGGGGCAGGG + Intergenic
1050975504 9:11932667-11932689 GTGGGGCACATGATGGGGCAGGG + Intergenic
1055135465 9:72824308-72824330 CTGCCCCACATGATGAGGCAAGG - Intronic
1190480351 X:50870787-50870809 GCTGGCCACAGGATGGGGCCAGG - Intergenic
1195911350 X:109891170-109891192 GTGCTCCACACAATGGCGCCTGG + Intergenic