ID: 1176264184

View in Genome Browser
Species Human (GRCh38)
Location 20:64200125-64200147
Sequence TGCTGGTGCGCCACATGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264184_1176264190 -6 Left 1176264184 20:64200125-64200147 CCCCATCATGTGGCGCACCAGCA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249
1176264184_1176264192 21 Left 1176264184 20:64200125-64200147 CCCCATCATGTGGCGCACCAGCA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1176264192 20:64200169-64200191 GCCTACACCTGGTCACCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 79
1176264184_1176264194 27 Left 1176264184 20:64200125-64200147 CCCCATCATGTGGCGCACCAGCA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1176264194 20:64200175-64200197 ACCTGGTCACCACGAGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1176264184_1176264191 10 Left 1176264184 20:64200125-64200147 CCCCATCATGTGGCGCACCAGCA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264184 Original CRISPR TGCTGGTGCGCCACATGATG GGG (reversed) Intronic
902177914 1:14665152-14665174 TGGTGGTGTGACACAAGATGAGG - Intronic
915163177 1:153933665-153933687 GGCTGGTGGGCGACAGGATGAGG - Exonic
920565434 1:206969184-206969206 TGCTGATGCAGCACATGTTGGGG + Intronic
921754267 1:218835318-218835340 TACTGGTACGCTACATGATTGGG - Intergenic
1062999761 10:1905688-1905710 AGCTTGTGCGCCCCAGGATGGGG + Intergenic
1063810129 10:9695580-9695602 GACTGGTGAGCCAGATGATGAGG - Intergenic
1070130666 10:73653388-73653410 TCCGGGTGCCCCACCTGATGAGG - Exonic
1070740755 10:78901544-78901566 TGGTGGTGCGGGAGATGATGAGG - Intergenic
1072801121 10:98393056-98393078 TGCTGCTGCACCATGTGATGGGG - Exonic
1073258679 10:102172359-102172381 TGCTGTGGCCTCACATGATGGGG + Intergenic
1084264445 11:67997657-67997679 TGCTGGTGCGGCCCGGGATGGGG - Exonic
1088456738 11:110040736-110040758 TGCTGGTGAGCTAAAAGATGAGG - Intergenic
1092182867 12:6458011-6458033 TGCTGCTGCTCCTCAGGATGTGG - Intronic
1092202171 12:6592473-6592495 TGCTGGGGCCGCACATGTTGCGG - Exonic
1115956747 14:38789743-38789765 TGCTGGTGCACCAGAGGTTGGGG - Intergenic
1122781715 14:104146563-104146585 TGCTGCTGCCCCACGTGGTGGGG + Intronic
1130264556 15:82388595-82388617 TACTGATGGGACACATGATGGGG - Intergenic
1132809034 16:1788862-1788884 TGCTGGTGCGACACATCCTGGGG - Exonic
1132814420 16:1818965-1818987 TGCTGGGGAGCCTCATGGTGGGG - Intronic
1135116067 16:19724373-19724395 TGCTGGAGAGCCACATGAACAGG - Intronic
1140255134 16:73329252-73329274 TGGTGGTGCTCCACATGGTGGGG + Intergenic
1143313530 17:6013618-6013640 TGCTGGTGTGGCACAGGGTGAGG + Intronic
1143593577 17:7900629-7900651 TGCTGGGGCCACACATGCTGCGG + Exonic
1144512212 17:15886917-15886939 TGCTGGTGGGCCAGAGGAAGTGG + Intergenic
1151413811 17:73948422-73948444 TGCTGAAGCCACACATGATGTGG - Intergenic
1155839052 18:30625372-30625394 GGCAGGTGCCCCACACGATGAGG - Intergenic
1158403744 18:57143144-57143166 GGCTGGAGCAGCACATGATGGGG + Intergenic
1165062794 19:33212956-33212978 GGCTGGTGGGGTACATGATGAGG + Exonic
1168207856 19:54865460-54865482 TAATGCTGCCCCACATGATGGGG - Intronic
931250114 2:60522690-60522712 TGGTGATGGGCCACATGGTGGGG - Intronic
935602874 2:104940340-104940362 TGCAGGTGCCCCACTGGATGCGG - Intergenic
937245492 2:120489659-120489681 TTGGGGTGGGCCACATGATGGGG - Intergenic
939035608 2:137127549-137127571 TGCTGGTGGGCTACCTGATTTGG + Intronic
945797301 2:214380749-214380771 TGCTGCTGCCCGACATGCTGTGG - Intronic
948916103 2:241035778-241035800 TGCAGGTGCGCCACAGGGTTGGG + Intronic
949069526 2:242015833-242015855 TGCTGGAGCCCCACATGGAGAGG + Intergenic
1172861751 20:38059739-38059761 TGCTGGTGTGCCACAACCTGTGG + Intronic
1174891357 20:54398510-54398532 GGCAGCTGCCCCACATGATGAGG + Intergenic
1176264184 20:64200125-64200147 TGCTGGTGCGCCACATGATGGGG - Intronic
949482048 3:4503296-4503318 CCCTGGTGAGCCACAGGATGGGG + Intronic
950392481 3:12707561-12707583 TGCTGTTGCACAACAGGATGGGG - Intergenic
952232830 3:31448823-31448845 TCCTGGGCAGCCACATGATGTGG - Intergenic
967751689 3:193122683-193122705 TGCTTGTTAGCCACATGATTTGG + Intergenic
968107180 3:196009385-196009407 TGCTGGAGCCCCACATGGAGAGG - Intergenic
973022417 4:45220219-45220241 GGCAGCTGCCCCACATGATGAGG - Intergenic
975987682 4:80217973-80217995 TGGTGGGGCGTCACATGGTGAGG + Intergenic
985528262 5:418786-418808 TGGTGCTGCGCCAGATCATGAGG - Intronic
992072400 5:73159880-73159902 CGCTGGTGCACCACAGGAGGTGG - Intergenic
993378004 5:87172686-87172708 TCCTGTTGTGCCTCATGATGGGG + Intergenic
1017822877 6:158061539-158061561 GGCTGGTGCGCGGCAGGATGGGG + Intronic
1032671107 7:134083230-134083252 TGCTGGTGCATCACTTGATGGGG - Intergenic
1044076767 8:87831651-87831673 TGCTAGTTTGCCAGATGATGTGG + Intergenic
1054952880 9:70872742-70872764 TGATGTTGCCCCAGATGATGTGG + Intronic
1055135466 9:72824313-72824335 GGCAGCTGCCCCACATGATGAGG - Intronic
1061935245 9:133853805-133853827 GGCTGGTGCTCCTCATGGTGAGG - Intronic
1062179125 9:135181248-135181270 TGCTGGTGCACCAGAAGGTGGGG + Intergenic
1193206291 X:78751904-78751926 GTCTGGTGCTCAACATGATGGGG - Intronic