ID: 1176264185

View in Genome Browser
Species Human (GRCh38)
Location 20:64200126-64200148
Sequence ATGCTGGTGCGCCACATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264185_1176264194 26 Left 1176264185 20:64200126-64200148 CCCATCATGTGGCGCACCAGCAT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1176264194 20:64200175-64200197 ACCTGGTCACCACGAGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1176264185_1176264192 20 Left 1176264185 20:64200126-64200148 CCCATCATGTGGCGCACCAGCAT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1176264192 20:64200169-64200191 GCCTACACCTGGTCACCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 79
1176264185_1176264190 -7 Left 1176264185 20:64200126-64200148 CCCATCATGTGGCGCACCAGCAT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249
1176264185_1176264191 9 Left 1176264185 20:64200126-64200148 CCCATCATGTGGCGCACCAGCAT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264185 Original CRISPR ATGCTGGTGCGCCACATGAT GGG (reversed) Intronic
902153680 1:14465476-14465498 ATGCAGGTGCTCCAAGTGATAGG - Intergenic
912505637 1:110153862-110153884 ATCCTGGTGCTCCAGATGTTTGG - Intronic
921754268 1:218835319-218835341 GTACTGGTACGCTACATGATTGG - Intergenic
1062877510 10:954705-954727 CTGCTGGTGCGACACATGCATGG + Intergenic
1072542859 10:96411678-96411700 ATGCTGGATCTCCACATGTTAGG - Intronic
1081155045 11:39680034-39680056 AGGCAGCTGCCCCACATGATGGG - Intergenic
1088071741 11:105795109-105795131 ATGCTGGTGCGCTGCATAACTGG + Intronic
1088765227 11:112969048-112969070 ATGCTGTTGGGCCACAAGAAAGG + Intronic
1090584692 11:128198701-128198723 TTGCTGGTGCCACAAATGATGGG + Intergenic
1104400045 12:128467868-128467890 ATCCTGGTGTAACACATGATGGG - Intronic
1111537475 13:89622650-89622672 ATTCTGATGCGCCACGTGTTAGG + Intergenic
1115769103 14:36652648-36652670 ATGCTGGAGCACCACCTGACTGG - Intergenic
1116635080 14:47384281-47384303 TTGCTGCTGAGCCACATGAGGGG + Intronic
1120099910 14:80433214-80433236 ATCCTGGTTAGCCACAAGATTGG + Intergenic
1131119197 15:89812656-89812678 ATCCTGGTGAGACACATGGTAGG + Intronic
1132242970 15:100275279-100275301 AGGCTGGAGGGCCACATGAAAGG + Intronic
1132809035 16:1788863-1788885 CTGCTGGTGCGACACATCCTGGG - Exonic
1138613624 16:58146944-58146966 AAGCAGGTGCGCCACATGGCAGG - Intergenic
1139638628 16:68274883-68274905 CTGGTGGTGGGCAACATGATCGG + Exonic
1140255133 16:73329251-73329273 GTGGTGGTGCTCCACATGGTGGG + Intergenic
1142907760 17:3056876-3056898 ATGATGGTGAGCCCCATAATGGG + Intergenic
1142926805 17:3247383-3247405 ATGATGGTGAGCCCCATAATGGG - Intergenic
1150256352 17:63748695-63748717 AGGCTGGTGGGCCACTTGAGAGG + Intronic
1162486734 19:10965149-10965171 ATGCTTGTTCGCCACATAAATGG - Intronic
1166863062 19:45820835-45820857 CTGCTGGTCCGCCACTTGGTGGG - Intronic
930118979 2:47744335-47744357 AGGCAGCTGCCCCACATGATGGG + Intronic
931737413 2:65209069-65209091 ATGCTGGAGCTGGACATGATAGG + Intergenic
934752563 2:96802936-96802958 ATGCTGGTGCTGCTCCTGATGGG - Intronic
941223760 2:162818869-162818891 ATGCTGGTTTGCCCCATAATTGG - Intronic
948916102 2:241035777-241035799 ATGCAGGTGCGCCACAGGGTTGG + Intronic
1172748433 20:37231862-37231884 ATGCTGCTGCCCCACTTAATTGG - Intronic
1173548683 20:43917078-43917100 ATGCAGCTGAGCCACTTGATAGG + Intronic
1176264185 20:64200126-64200148 ATGCTGGTGCGCCACATGATGGG - Intronic
1183387958 22:37525887-37525909 ATGCTGGTACGTCATATGTTGGG - Intergenic
957656797 3:83089788-83089810 AAGCTGGTGTATCACATGATGGG + Intergenic
962835126 3:139183129-139183151 ATTCTGGGGCTCCACATGAGGGG + Intronic
967361072 3:188632430-188632452 GTGCTGGTGCTGCACATGGTGGG + Intronic
969312151 4:6359978-6360000 ATACTGGTTCACCTCATGATGGG + Intronic
971848741 4:31955634-31955656 TTGCTGGTGTGCCAAAAGATAGG + Intergenic
971994794 4:33951741-33951763 AAACTGGTGCTCCACATGACAGG + Intergenic
972124884 4:35751583-35751605 ATGCTGCTGCTCCAAATGTTTGG + Intergenic
974227112 4:59060516-59060538 AGGCGGTTGCCCCACATGATGGG - Intergenic
984015840 4:174426018-174426040 ATGCTGGTCTGTCCCATGATTGG + Intergenic
984373335 4:178894630-178894652 GTGCGGCTGCCCCACATGATGGG - Intergenic
1017822876 6:158061538-158061560 AGGCTGGTGCGCGGCAGGATGGG + Intronic
1032671108 7:134083231-134083253 CTGCTGGTGCATCACTTGATGGG - Intergenic
1048856387 8:138689892-138689914 ATGTTGTTGAGCCACGTGATGGG - Intronic
1056108074 9:83367285-83367307 ATGCAGGTGGGCTTCATGATTGG - Intronic
1059239017 9:112787063-112787085 AGGCTGGAGCGCCACCTGACTGG - Intronic