ID: 1176264186

View in Genome Browser
Species Human (GRCh38)
Location 20:64200127-64200149
Sequence GATGCTGGTGCGCCACATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264186_1176264190 -8 Left 1176264186 20:64200127-64200149 CCATCATGTGGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 15
4: 80
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249
1176264186_1176264191 8 Left 1176264186 20:64200127-64200149 CCATCATGTGGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 15
4: 80
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1176264186_1176264192 19 Left 1176264186 20:64200127-64200149 CCATCATGTGGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 15
4: 80
Right 1176264192 20:64200169-64200191 GCCTACACCTGGTCACCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 79
1176264186_1176264194 25 Left 1176264186 20:64200127-64200149 CCATCATGTGGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 15
4: 80
Right 1176264194 20:64200175-64200197 ACCTGGTCACCACGAGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264186 Original CRISPR GATGCTGGTGCGCCACATGA TGG (reversed) Intronic
901218495 1:7568315-7568337 GATGCTGGTGATCCTGATGAGGG - Intronic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
912975748 1:114328731-114328753 GATGCAGGTGCCCTACAGGAAGG - Intergenic
916680935 1:167104462-167104484 GATGCTTGCTCGCCACAGGAAGG - Intronic
917526545 1:175793269-175793291 GGTGCTGTGGGGCCACATGAGGG + Intergenic
918605811 1:186424609-186424631 GGTGGTTTTGCGCCACATGATGG + Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920760807 1:208782096-208782118 GATGCTGGTGCTGGCCATGATGG + Intergenic
1067081575 10:43215477-43215499 GATCCTGGTGGGCCTCAGGAGGG + Intronic
1067221380 10:44346620-44346642 GATGCTGGAGCCCTTCATGAAGG + Intergenic
1073059707 10:100726140-100726162 GATCCTGATGGGCCACATGCAGG - Intergenic
1073150811 10:101310407-101310429 GAAGCTGGTGCCCCAAATGCAGG - Intergenic
1077601155 11:3575862-3575884 GATGCTGGTGACTCACATGACGG - Intergenic
1078533026 11:12151628-12151650 GAAGTTGGTGAGCCACAAGAAGG - Intronic
1079400875 11:20105478-20105500 GATGATGGTGATCCAAATGATGG - Intronic
1082773101 11:57224044-57224066 GATGTTGGTGGGTCACATTAGGG - Intergenic
1084257074 11:67950437-67950459 GATGCTGGTGACTCACATGACGG - Intergenic
1084815704 11:71644831-71644853 GATGCTGGTGACTCACATGACGG + Intergenic
1084935245 11:72583437-72583459 GATGATGATGTACCACATGAAGG - Exonic
1085259815 11:75198037-75198059 GATGCTGATGCCCAGCATGAGGG - Intronic
1091273660 11:134335037-134335059 GATGCTGGCTGCCCACATGAAGG - Intronic
1092427307 12:8385221-8385243 GATGCTGGTGACTCACATGACGG - Intergenic
1095108085 12:38259558-38259580 GATGTTGGTGGGCCAAATAAGGG + Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1097307332 12:58083977-58083999 GATGCAGGTTGGCCACATGAGGG + Intergenic
1101758809 12:107642593-107642615 GAAGTTGGTGAGCCACAGGAAGG + Intronic
1105943201 13:25169735-25169757 GTTGCTGGTGCACCACGGGATGG + Exonic
1116635079 14:47384280-47384302 GTTGCTGCTGAGCCACATGAGGG + Intronic
1123058609 14:105584256-105584278 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1123082940 14:105704490-105704512 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1127976448 15:64000732-64000754 GGTGCTGGAGAGCCACATGAGGG + Intronic
1132504809 16:302459-302481 GATGGTGGAGCTCCCCATGAAGG - Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133201486 16:4206970-4206992 GAAGGTGGAGCGCCACAGGAAGG - Intronic
1133370939 16:5245150-5245172 GATGCAGGCGAGTCACATGATGG + Intergenic
1135687923 16:24513271-24513293 CATTCTGGTGTGCCACAGGATGG + Intergenic
1142906155 17:3043596-3043618 GATGCATCTGTGCCACATGAAGG + Intergenic
1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG + Intronic
1151358264 17:73573008-73573030 AGTGCAGGTGTGCCACATGAAGG + Intronic
1157526999 18:48391170-48391192 GAGGCTGCTGCGTCACATGGCGG - Intronic
1159575878 18:70176737-70176759 GATGCTTGTGCACCACAGAATGG - Exonic
1159666256 18:71163821-71163843 GATGCTGGTGCTCCCCAGGTGGG - Intergenic
1162715945 19:12633647-12633669 GATGCTTGGGCCACACATGAAGG - Intronic
1163146234 19:15380516-15380538 GAAGCTGGAGCGCTACCTGAAGG - Exonic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
931214090 2:60225578-60225600 GAGGCTGGTGGGCCACATGCAGG - Intergenic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
932391892 2:71399309-71399331 AATGTTGGTCTGCCACATGAAGG + Intronic
933634019 2:84687396-84687418 AATGCTGGTTCAACACATGAAGG + Intronic
934752564 2:96802937-96802959 GATGCTGGTGCTGCTCCTGATGG - Intronic
938829512 2:135036515-135036537 GATGCTGGTGTCCCTCAGGAGGG + Intronic
941481512 2:166021109-166021131 GAGGCTGGTAAGCCACATCATGG + Intronic
948183018 2:235997919-235997941 GAGGCTGGTGTTACACATGAAGG + Intronic
948385325 2:237577289-237577311 GATGCTGGTGGGCAACAAGACGG - Exonic
948845993 2:240683057-240683079 GATCCGGGTGTGTCACATGACGG - Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1179943467 21:44654597-44654619 GTGGCTGGTGTGGCACATGATGG + Exonic
1180193993 21:46182738-46182760 GAAGCAGGTGCGCCTCCTGAAGG - Exonic
950750488 3:15124284-15124306 GATGCTGGTGACTCACATGACGG + Intergenic
950881416 3:16325754-16325776 GATCCTGGTGAGCCAGAGGAGGG + Intronic
954782788 3:53073276-53073298 GATGCTGGTGCGCAGTCTGACGG - Intronic
961282126 3:125772171-125772193 GATGCTGGTGACTCACATGACGG + Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
962251631 3:133839522-133839544 CATGCTGGTGGGCAACAAGACGG - Exonic
962775245 3:138652933-138652955 GATGCTGATGCTCCTCATCAGGG + Exonic
962835125 3:139183128-139183150 AATTCTGGGGCTCCACATGAGGG + Intronic
969797546 4:9537667-9537689 GATGCTGGTGACTCACGTGACGG + Intergenic
970882407 4:20947398-20947420 GAGGCAGGTGGACCACATGAGGG - Intronic
979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG + Exonic
985095398 4:186407905-186407927 GATACTGGGCGGCCACATGAAGG - Intergenic
988006752 5:25422508-25422530 GATACTGGTGCAGAACATGAAGG + Intergenic
991173799 5:63661084-63661106 GATGATTGTGTGCCACCTGAAGG + Intergenic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
994223321 5:97222072-97222094 CATGCTGGTGCTACATATGAGGG - Intergenic
996266003 5:121541119-121541141 GATGCTGGAGAGCCTCAGGAAGG + Intergenic
997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG + Intronic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG + Intronic
1017822875 6:158061537-158061559 GAGGCTGGTGCGCGGCAGGATGG + Intronic
1023291383 7:38672011-38672033 GGAGCTGGTGCCCCACCTGATGG - Intergenic
1029074272 7:97923871-97923893 GATGCTGGTGACTCACATGACGG - Intergenic
1036243435 8:7097417-7097439 GATGCTGGTGACTCACATGACGG + Intergenic
1036257378 8:7216650-7216672 GATGCTGGTGACTCACGTGACGG - Intergenic
1036309425 8:7675246-7675268 GATGCTGGTGACTCACGTGACGG - Intergenic
1036360114 8:8070873-8070895 GATGCTGGTGACTCACGTGACGG + Intergenic
1036654615 8:10670119-10670141 GAGGCTGGACAGCCACATGAAGG + Intronic
1036829290 8:12009774-12009796 GATGCTGGTGACTCACATGACGG - Intergenic
1036890851 8:12596095-12596117 GATGCTGGTGACTCACGTGACGG - Intergenic
1036898396 8:12654012-12654034 GATGCTGGTGACTCACGTGACGG - Intergenic
1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG + Intergenic
1047188431 8:122656496-122656518 GATGCTGGTACCCCACCTCATGG - Intergenic
1048035648 8:130674800-130674822 GATGCTGGTAGGACACAGGAAGG - Intergenic
1048138343 8:131768330-131768352 GAAGCTGGTGCTCCACCTGCAGG - Intergenic
1050134877 9:2452120-2452142 GATGCTCCTGTGCCCCATGAAGG + Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1189273596 X:39768960-39768982 GATTCAGGAGGGCCACATGAGGG + Intergenic