ID: 1176264189

View in Genome Browser
Species Human (GRCh38)
Location 20:64200142-64200164
Sequence CCGTGTCCTTGCCATGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264189_1176264191 -7 Left 1176264189 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1176264189_1176264194 10 Left 1176264189 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1176264194 20:64200175-64200197 ACCTGGTCACCACGAGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1176264189_1176264197 23 Left 1176264189 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1176264197 20:64200188-64200210 GAGGACCTGGACTGTCACTGCGG 0: 1
1: 0
2: 1
3: 15
4: 203
1176264189_1176264192 4 Left 1176264189 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1176264192 20:64200169-64200191 GCCTACACCTGGTCACCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264189 Original CRISPR CCGTGTCCTTGCCATGATGC TGG (reversed) Intronic
901429955 1:9207866-9207888 CTGTGTCTTTGCTAAGATGCTGG + Intergenic
902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG + Intronic
903337428 1:22634485-22634507 CCCCTTGCTTGCCATGATGCAGG - Intergenic
905236877 1:36556090-36556112 CTGACTCCTTCCCATGATGCTGG + Intergenic
908779290 1:67674727-67674749 CCCTCTGCTTGCCAGGATGCTGG - Intergenic
910343299 1:86212010-86212032 CTATGTGCCTGCCATGATGCTGG - Intergenic
912435131 1:109656382-109656404 CAGTGTCATGGACATGATGCTGG - Exonic
918043730 1:180928501-180928523 CCGGGTCCTGGCCTTCATGCGGG - Exonic
920294803 1:204949388-204949410 CCATGGCTTTGCCCTGATGCTGG + Intronic
921972556 1:221166119-221166141 CCGAGTCCTAGCCATGATCTGGG - Intergenic
922639618 1:227215385-227215407 CAGTGTCCTTGTCATGATCATGG + Intronic
922730656 1:227947450-227947472 CCGTGTCCTTGCCAAAAGGCTGG - Intronic
924314746 1:242784284-242784306 CTGTTTCCTGGCCAGGATGCTGG + Intergenic
1066280151 10:33909262-33909284 CGGTTTCCAGGCCATGATGCAGG - Intergenic
1067231866 10:44417789-44417811 CTGTCTCCTTCCCATGATCCAGG - Intergenic
1071032885 10:81205771-81205793 CACTGTCCTTTCCATGATGGAGG - Intergenic
1076515748 10:131043538-131043560 CCGTGTCTTTGTCAGGCTGCAGG + Intergenic
1077797686 11:5508865-5508887 ACGTAACCCTGCCATGATGCAGG - Exonic
1077889641 11:6409928-6409950 CTGTATCCTTGCAATGGTGCTGG + Intronic
1080633459 11:34103003-34103025 CCTAGTGCTTGGCATGATGCTGG - Intergenic
1083173837 11:60937438-60937460 CCGTGTCCTAGCCCTGGGGCTGG + Intronic
1084519536 11:69655077-69655099 CCGTGTCAGGGCCATGATCCGGG + Intronic
1089606386 11:119643882-119643904 CCCTGTCCTTGCAATGATCCTGG + Intronic
1091099935 11:132862609-132862631 CTGTGTCCTAGCTAGGATGCTGG - Intronic
1092526480 12:9312942-9312964 CCCTGTCCTGGCCAAGCTGCCGG + Intergenic
1092540796 12:9418840-9418862 CCCTGTCCTGGCCAAGCTGCCGG - Intergenic
1094266557 12:28566381-28566403 CCGGGTCCCTCCCATGATGTGGG + Intronic
1094512252 12:31103644-31103666 CCCTGTCCTGGCCAAGCTGCCGG + Exonic
1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG + Intronic
1101963274 12:109265550-109265572 TCGGGTCCTTGCCAGGAGGCTGG - Intronic
1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG + Intergenic
1107515627 13:41125978-41126000 CCGGGTCCCTCCCATGATGTGGG - Intergenic
1112814114 13:103252013-103252035 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1118031989 14:61826916-61826938 CCGTGTCCTTACCAGGGTGGAGG + Intergenic
1122133404 14:99619110-99619132 CCGTGTACTGGCCCTGGTGCTGG + Intergenic
1124492776 15:30168286-30168308 CCTTGTCTTTGAAATGATGCTGG - Intergenic
1124750758 15:32370039-32370061 CCTTGTCTTTGAAATGATGCTGG + Intergenic
1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG + Exonic
1126069547 15:44853832-44853854 ATGTTTCCTTGCCATGATGTTGG + Intergenic
1126089261 15:45036928-45036950 ATGTTTCCTTGCCATGATGTTGG - Intronic
1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG + Intergenic
1127957095 15:63863048-63863070 CCAGCTCCTTGCCAAGATGCTGG - Intergenic
1128560950 15:68667355-68667377 CCATGTCCTTGCCATGTTTGAGG + Intronic
1132932249 16:2464629-2464651 ACGTGTCCTTACCATCCTGCGGG + Exonic
1133022831 16:2974376-2974398 TTCTGTCCTTGTCATGATGCTGG - Exonic
1136413449 16:30090428-30090450 CCCTGTCCTTGTCTGGATGCTGG + Intronic
1147533118 17:41298723-41298745 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1148195329 17:45708934-45708956 CTGTGCCCTTGCCTTGAGGCTGG - Intergenic
1151342931 17:73483190-73483212 CCCAGGCCTTGCCTTGATGCAGG + Intronic
1151478812 17:74358065-74358087 CCTTCTCCTTGCCATGAGTCTGG + Intronic
1152460674 17:80440685-80440707 CCATGTCCTTCCCACGATGGCGG + Intergenic
1153089862 18:1331191-1331213 CTCTGTCCTTTCCATGATGGAGG - Intergenic
1153820536 18:8827838-8827860 CCGTTTTCATGCCATAATGCTGG - Intronic
1154065721 18:11105143-11105165 CCCAGGCCTTGCCATGATGGAGG + Intronic
1157843225 18:50978561-50978583 CCGGGTCCCTCCCATGATGTAGG + Intronic
1161017753 19:1991639-1991661 CTGGGTCCTTTCCAGGATGCCGG + Intronic
1161866673 19:6837399-6837421 CTGTGTCCTTGCCCTGCTCCTGG + Intronic
1163211822 19:15846488-15846510 CCGTGAACTTCCCATGCTGCTGG - Intergenic
1165466342 19:35977242-35977264 CCTTGTACTTCCCGTGATGCCGG + Intergenic
927975790 2:27337138-27337160 TCCTGTCCTTCCCCTGATGCTGG - Intronic
928859469 2:35839462-35839484 CCTTGTCCTTGCAATGGTGCAGG + Intergenic
934779439 2:96960433-96960455 CCCTTGCCTTGCCAGGATGCTGG - Exonic
935540350 2:104340843-104340865 CCGTGTCCTGTCCAGGATGGTGG - Intergenic
937820739 2:126307951-126307973 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
938030261 2:127986142-127986164 CTCTGTCCTTGCCATAAGGCAGG + Intronic
938954950 2:136288710-136288732 CCCTGTCCTTGCCATCATTGTGG + Intergenic
941469814 2:165870785-165870807 CTGTGTCCTTACCATGACGGGGG + Intronic
944445911 2:199788261-199788283 CTGTGCCCTTGGCATGAAGCAGG + Intronic
1174578814 20:51556519-51556541 CCGGGTACTTTCCAAGATGCTGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176382822 21:6121527-6121549 CAGTGTCCGTGCCAGGATGCAGG - Exonic
1176384130 21:6128664-6128686 CCGTGCCCTTGCCGTGTTCCCGG + Intergenic
1178014400 21:28326997-28327019 TCATGTCCTTGCCATGAGCCAGG - Intergenic
1179739344 21:43409580-43409602 CCGTGCCCTTGCCGTGTTCCCGG - Intergenic
1179740647 21:43416712-43416734 CAGTGTCCGTGCCAGGATGCAGG + Exonic
1181170822 22:21008895-21008917 CCATGTACTTGCCATGGTGAGGG + Intergenic
1181862350 22:25828845-25828867 CCCGGTCCTTGCCCTGGTGCCGG - Exonic
1183395240 22:37567726-37567748 CCGGCTCCCTGCCATGACGCTGG - Intronic
951549409 3:23861922-23861944 CTCTGTCCTTGCCATAAGGCAGG + Intronic
951904673 3:27692880-27692902 GTGTGTCCTTGCCATGTTGCAGG - Intergenic
952298760 3:32085509-32085531 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
959856264 3:111162314-111162336 CCAGGTCCTTCCCATGATGTGGG - Intronic
961625326 3:128258323-128258345 CCCTGTCCTTCCCACGGTGCTGG - Intronic
963295544 3:143542099-143542121 AGGTGTTCTTGCCATGATGTGGG + Intronic
967948419 3:194822365-194822387 CCGTGTCCTGGCCCTGCTGCTGG - Intergenic
971697227 4:29921961-29921983 CCGTCTTCTTGCCATCTTGCAGG - Intergenic
973705553 4:53576474-53576496 CCCTGCCCTTCCCATGAGGCAGG + Intronic
985322784 4:188733492-188733514 CCGTGTTCTTGCCGTGCAGCTGG + Intergenic
986886677 5:12246313-12246335 CCGTTCCCTTGCCATTATGCTGG - Intergenic
992360040 5:76028133-76028155 CAGTTTCCAAGCCATGATGCGGG - Intergenic
994162288 5:96570201-96570223 CTGTGTGTATGCCATGATGCTGG + Intronic
1002107738 5:176888525-176888547 CCGTGTCCATGCTATCCTGCAGG - Exonic
1003131243 6:3396926-3396948 CTGTGTCCTTGCAATAAGGCAGG + Intronic
1003637750 6:7848842-7848864 TTGTGTCCTTGTGATGATGCAGG + Intronic
1015729637 6:136334877-136334899 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1019256878 7:58019-58041 CCGTTTTCCTGCCATGATGCTGG - Intergenic
1020682722 7:11256778-11256800 CTGTGTTCTGGGCATGATGCTGG - Intergenic
1021436828 7:20627802-20627824 CCATGACATTGCCATGATGCCGG + Intronic
1022580923 7:31553304-31553326 CAGTGTTCCTGGCATGATGCCGG + Intronic
1029270398 7:99374167-99374189 CCGTGTCCTCGCCACGAAACAGG - Intronic
1033048175 7:137981028-137981050 CCGAGTCCTTGCAATAAAGCAGG + Intronic
1040306465 8:46214515-46214537 CCTTGTCATGGCCAAGATGCAGG + Intergenic
1046329053 8:112690458-112690480 TCGTGTCCTGGTCATGATTCAGG - Intronic
1049854038 8:144850555-144850577 CCCTGCCCTTCCCATGAGGCAGG - Exonic
1055914760 9:81389674-81389696 CTGGGTCCTTGCCATGCTGGAGG - Intergenic
1057713204 9:97465903-97465925 CAGTGTCCTTCCCATCATGAAGG - Intronic
1059424511 9:114212235-114212257 CCAGGTCCTTGCCCTGAAGCTGG - Intronic
1062634955 9:137485844-137485866 CCATGTCCTTGCCACTGTGCTGG - Intronic
1186030650 X:5365766-5365788 CTATGTCCTTTCCAAGATGCTGG + Intergenic
1192748475 X:73963661-73963683 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1200738594 Y:6828672-6828694 CCCTGTGCTAGACATGATGCTGG + Intergenic