ID: 1176264190

View in Genome Browser
Species Human (GRCh38)
Location 20:64200142-64200164
Sequence CCAGCATCATGGCAAGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 249}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264183_1176264190 -1 Left 1176264183 20:64200120-64200142 CCTGGCCCCATCATGTGGCGCAC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249
1176264185_1176264190 -7 Left 1176264185 20:64200126-64200148 CCCATCATGTGGCGCACCAGCAT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249
1176264186_1176264190 -8 Left 1176264186 20:64200127-64200149 CCATCATGTGGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 15
4: 80
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249
1176264177_1176264190 27 Left 1176264177 20:64200092-64200114 CCCCATCTCTATCTGTTCTCACC 0: 1
1: 0
2: 5
3: 43
4: 661
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249
1176264179_1176264190 25 Left 1176264179 20:64200094-64200116 CCATCTCTATCTGTTCTCACCTC 0: 1
1: 0
2: 5
3: 60
4: 535
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249
1176264184_1176264190 -6 Left 1176264184 20:64200125-64200147 CCCCATCATGTGGCGCACCAGCA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249
1176264181_1176264190 6 Left 1176264181 20:64200113-64200135 CCTCTGTCCTGGCCCCATCATGT 0: 1
1: 0
2: 0
3: 37
4: 319
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249
1176264178_1176264190 26 Left 1176264178 20:64200093-64200115 CCCATCTCTATCTGTTCTCACCT 0: 1
1: 0
2: 1
3: 33
4: 416
Right 1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 1
3: 28
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264190 Original CRISPR CCAGCATCATGGCAAGGACA CGG Intronic
900020403 1:183807-183829 CCAACAGCATGTCCAGGACAGGG - Intergenic
900319691 1:2076386-2076408 CCAGCATCATGCCAACCCCAGGG - Intronic
900967950 1:5972375-5972397 AAAGCATCATGACAGGGACAGGG + Intronic
901265383 1:7906265-7906287 CCAGCATCTTTGCAGGAACATGG - Intergenic
902417226 1:16247344-16247366 CCAGGATCACCACAAGGACAAGG + Exonic
902884756 1:19396559-19396581 CCAGCATGAAGGCAAGCACGGGG + Intronic
903009176 1:20318293-20318315 CCAGCATCCTGCCAAGCAGATGG - Intronic
903232790 1:21931902-21931924 CTAGCAGCATGGCAGGGGCAGGG + Intronic
903337429 1:22634485-22634507 CCTGCATCATGGCAAGCAAGGGG + Intergenic
903536916 1:24073006-24073028 CTAGATTCATGGCAAGCACACGG + Intronic
903672889 1:25046884-25046906 GCAGCATCGTGTCAAGGTCATGG + Intergenic
905742655 1:40386136-40386158 AAAGCATCATGGTAAGAACAGGG - Intronic
905914730 1:41676748-41676770 CCACCATCCTGGCCAGGGCAGGG + Intronic
906749340 1:48245109-48245131 CCATCATCATTGCAAAGACTGGG + Intronic
908680571 1:66656483-66656505 CCAGCATCACCACAAGCACATGG + Intronic
908779291 1:67674727-67674749 CCAGCATCCTGGCAAGCAGAGGG + Intergenic
908882426 1:68747132-68747154 CCAACATTATGTCAAGCACATGG + Intergenic
910538209 1:88324051-88324073 CCACCATCATGGGAGGGACCTGG - Intergenic
910683045 1:89887469-89887491 CCAGGACAATGGCCAGGACAGGG - Intronic
913095899 1:115514958-115514980 ACAGAGTGATGGCAAGGACAGGG + Intergenic
915288007 1:154865041-154865063 CCAACATGATGGCAGGGTCAGGG + Intronic
916392226 1:164342935-164342957 CCAGAAGCATGGAAAAGACAAGG + Intergenic
916676660 1:167069519-167069541 CCAGCATCATGCCTGGTACATGG - Intronic
918007127 1:180552177-180552199 CCAGAGTAATGGGAAGGACATGG - Intergenic
918719568 1:187836323-187836345 TCAGCCTTATGACAAGGACAGGG + Intergenic
919977115 1:202619902-202619924 CCAGCATCATTTCAAAGGCAAGG + Intronic
920294802 1:204949388-204949410 CCAGCATCAGGGCAAAGCCATGG - Intronic
922730657 1:227947450-227947472 CCAGCCTTTTGGCAAGGACACGG + Intronic
1063108402 10:3013804-3013826 CCAACATCAGGTCAAGCACAGGG + Intergenic
1063301560 10:4853916-4853938 CCAGCGCCATGGCAATGTCAGGG + Intergenic
1063611867 10:7569626-7569648 GCAGCATCTGGGCAAGGACCAGG - Intronic
1064553741 10:16527723-16527745 CCAGCAACTTTGCAGGGACAAGG + Intergenic
1065131859 10:22630085-22630107 CCAGCATGTTGGGAAGGCCAAGG + Intronic
1065854978 10:29822793-29822815 CCAGCATACTGGCAGGGACGTGG + Intergenic
1066507402 10:36059781-36059803 ACAGAATCCAGGCAAGGACAAGG + Intergenic
1066759493 10:38739007-38739029 CCAGTGCCAGGGCAAGGACAAGG - Intergenic
1066962125 10:42233754-42233776 CCAGTGCCAGGGCAAGGACAAGG + Intergenic
1067143590 10:43677004-43677026 CCAGCTCCATGGCAAGAACCGGG - Intergenic
1068325297 10:55477382-55477404 ACAGCATAAGGGTAAGGACAAGG + Intronic
1071079876 10:81798360-81798382 GGAGCATCATGGAAAGGAAATGG - Intergenic
1074831936 10:117255393-117255415 CCAGCACGATGCCAAGGTCATGG - Intronic
1075095938 10:119471061-119471083 CCAACAGCATGGCCAGGAAATGG - Intergenic
1075509461 10:123059001-123059023 CTAGAATCATGGCTAGCACATGG - Intergenic
1076502207 10:130946162-130946184 ACAGAAGCATGGCAAGGACCAGG - Intergenic
1076723071 10:132401168-132401190 GCAGTGTCCTGGCAAGGACACGG - Intronic
1077099576 11:816144-816166 CCAGAATCCTGGCAAGGGCTGGG - Intergenic
1077439666 11:2562059-2562081 CCAGCAGTAAGGCCAGGACAGGG + Intronic
1079307913 11:19340458-19340480 CCATCAGAATAGCAAGGACAGGG - Intergenic
1080633460 11:34103003-34103025 CCAGCATCATGCCAAGCACTAGG + Intergenic
1081961824 11:47143524-47143546 CAAGCATCATGGCCAGGCCCTGG + Intronic
1083173836 11:60937438-60937460 CCAGCCCCAGGGCTAGGACACGG - Intronic
1083263162 11:61533977-61533999 CCAGCATCCTGGGAACGGCATGG - Intronic
1083826375 11:65206356-65206378 CCAGCCCCTTGGCCAGGACAAGG + Intronic
1084103570 11:66965993-66966015 ACAGCATGGTGGCAAGGACAGGG - Intergenic
1084612232 11:70210688-70210710 CCAGGCACATGGCAAGTACAAGG + Intergenic
1084877799 11:72146395-72146417 TCAGCATCCTGGCAACGACATGG + Intergenic
1085203354 11:74715128-74715150 TCAGCATCGTGGAAAGTACACGG - Intronic
1085453502 11:76653136-76653158 CTAGCATCATGGAAAACACATGG - Intergenic
1086518329 11:87640645-87640667 CCACCATGGTGGAAAGGACATGG - Intergenic
1087827504 11:102782516-102782538 CCAGCATCATCACAAACACATGG - Intergenic
1089606385 11:119643882-119643904 CCAGGATCATTGCAAGGACAGGG - Intronic
1090609403 11:128456741-128456763 ACGGCATCATGGAAAGAACAGGG + Intergenic
1091334754 11:134758092-134758114 CCATCAGCATGGCAAGGGGAGGG + Intergenic
1091722187 12:2821450-2821472 GCAGCAGCAGGGGAAGGACAGGG - Intronic
1092049026 12:5454916-5454938 GCAGCCTCATGGCAGGGCCAGGG - Intronic
1092269515 12:7012141-7012163 CCACCATCATGGCCAAGACTAGG + Intronic
1092526479 12:9312942-9312964 CCGGCAGCTTGGCCAGGACAGGG - Intergenic
1092540797 12:9418840-9418862 CCGGCAGCTTGGCCAGGACAGGG + Intergenic
1094512251 12:31103644-31103666 CCGGCAGCTTGGCCAGGACAGGG - Exonic
1095886102 12:47190232-47190254 CCAGCACCATGGGAAGAACGGGG - Intronic
1098507522 12:71271313-71271335 CCAGCATCATCACAAACACATGG + Intronic
1099171160 12:79366443-79366465 CCTGCCTCTTGGCAAGGTCAGGG - Intronic
1103738917 12:123078363-123078385 CCACCACCATGCCAAGGAAAAGG + Intronic
1104954955 12:132459825-132459847 CCGGCATGGTGGCAAGGCCAGGG - Intergenic
1106229774 13:27812902-27812924 CCAAAATGATGGGAAGGACAGGG + Intergenic
1111267350 13:85834482-85834504 CTTGCATCATGTCAAGGAAAAGG - Intergenic
1113642408 13:111967215-111967237 CCACCATCCTGGGAAGGCCATGG + Intergenic
1113931135 13:113969572-113969594 CCAGCACCATGGCAAGGCACGGG - Intergenic
1116823541 14:49648925-49648947 CCAGCATCATGCCAAAAATAAGG + Intronic
1118014303 14:61642824-61642846 ATGGCATCATGGCAAGGAAAGGG + Intronic
1118129094 14:62942181-62942203 CCAGCTCCATGCCATGGACAGGG + Intronic
1121775808 14:96589909-96589931 CCAGCGACATGGCAAGAATATGG - Intergenic
1122133403 14:99619110-99619132 CCAGCACCAGGGCCAGTACACGG - Intergenic
1122214627 14:100194654-100194676 CCAGCATCAGGCCAAGGGCTGGG + Intergenic
1122311882 14:100802634-100802656 CCATCACCATGGTCAGGACAGGG - Intergenic
1202930225 14_KI270725v1_random:28594-28616 CCAGTGCCATGGCAAGGGCAAGG - Intergenic
1123721356 15:23064455-23064477 GCAGCAGCATGGCAGGGACAGGG - Intergenic
1124492777 15:30168286-30168308 CCAGCATCATTTCAAAGACAAGG + Intergenic
1124750757 15:32370039-32370061 CCAGCATCATTTCAAAGACAAGG - Intergenic
1125259537 15:37807330-37807352 CAAGCAACATGGTAAGGAGACGG - Intergenic
1125760839 15:42094486-42094508 CCAGCATCTTGGCAAGGGCTGGG - Exonic
1127295824 15:57607846-57607868 CCAGGAACCTGGCCAGGACATGG - Intronic
1127957096 15:63863048-63863070 CCAGCATCTTGGCAAGGAGCTGG + Intergenic
1128560949 15:68667355-68667377 CCTCAAACATGGCAAGGACATGG - Intronic
1128587798 15:68866215-68866237 CCAGCCTCAAGGCAAGTACTAGG - Intronic
1130108446 15:80946136-80946158 CGAGCATCATGGTAACGACATGG + Intronic
1130150947 15:81311088-81311110 CCAGCATCATGGAACGCAAATGG - Exonic
1130943309 15:88530061-88530083 CCAGCATGTGGGCAAGGTCAGGG + Intronic
1131139124 15:89963024-89963046 CCAGCATGTTGGGAAGGCCAAGG + Intergenic
1132035913 15:98484527-98484549 CCAGCCTGATGTCAAGGAGATGG - Intronic
1132665893 16:1081175-1081197 CCAGCCTCAGAGCAAGGCCAAGG - Intergenic
1133360580 16:5170710-5170732 TCACAATCATGGCAAAGACAAGG - Intergenic
1135178987 16:20256755-20256777 CCAGCATCATTGAAAGGGCCTGG + Intergenic
1136413448 16:30090428-30090450 CCAGCATCCAGACAAGGACAGGG - Intronic
1136723290 16:32340156-32340178 CCAGTGCCAGGGCAAGGACAAGG + Intergenic
1137614992 16:49841132-49841154 CCAATAACATGGCAAGGACGTGG + Intronic
1137730671 16:50687328-50687350 CCAGCAACAAGGAAGGGACAAGG + Intergenic
1137786007 16:51138488-51138510 TCAGGATCATGGCAGGGACAAGG - Intronic
1137893594 16:52187328-52187350 CCAGAATTACGGCAAGGATAGGG - Intergenic
1138081320 16:54093815-54093837 CCAGGCACGTGGCAAGGACATGG + Intronic
1139229229 16:65266680-65266702 CCAGCATTTTGGGAAGGGCAAGG + Intergenic
1139285686 16:65811648-65811670 CCAGTATCATAGAAAGAACATGG + Intergenic
1141681124 16:85544581-85544603 CCAGCATGAGGGGAAAGACAGGG + Intergenic
1203003142 16_KI270728v1_random:177609-177631 CCAGTGCCAGGGCAAGGACAAGG - Intergenic
1203134747 16_KI270728v1_random:1714015-1714037 CCAGTGCCAGGGCAAGGACAAGG - Intergenic
1142975718 17:3642882-3642904 GCAGCCTCATGGCAAGAACCTGG + Intronic
1144117502 17:12112640-12112662 CCAGGATAGTGACAAGGACATGG + Intronic
1144619456 17:16807767-16807789 CCAGCAACATGGGCAGGACCTGG - Intergenic
1145138988 17:20436354-20436376 CCAGCAACATGGGCAGGACCTGG - Intergenic
1147055736 17:37833467-37833489 CCAGCAACATGGGCAGGACCTGG + Intergenic
1148350502 17:46938616-46938638 CCAGCATGTTGGCAATGTCAAGG - Exonic
1150850908 17:68702902-68702924 CCAGCATCAAGACAATGAAATGG - Intergenic
1151081145 17:71330263-71330285 TCATAATAATGGCAAGGACATGG + Intergenic
1151342930 17:73483190-73483212 CCTGCATCAAGGCAAGGCCTGGG - Intronic
1151421674 17:74002328-74002350 CCAGCATCATGGGGCGGAAAAGG - Intergenic
1151478811 17:74358065-74358087 CCAGACTCATGGCAAGGAGAAGG - Intronic
1152460673 17:80440685-80440707 CCGCCATCGTGGGAAGGACATGG - Intergenic
1152544483 17:80993854-80993876 CCAGCCACACGGCCAGGACAGGG - Intronic
1153820537 18:8827838-8827860 CCAGCATTATGGCATGAAAACGG + Intronic
1154065720 18:11105143-11105165 CCTCCATCATGGCAAGGCCTGGG - Intronic
1155494213 18:26426836-26426858 CCAGCTGCATGGCATGGTCATGG + Intergenic
1156022634 18:32617353-32617375 CCATCAGCAAGCCAAGGACAGGG - Intergenic
1157177497 18:45464940-45464962 ACAGCATCATGGCAGTGAGAAGG + Intronic
1159762826 18:72449748-72449770 ACAGCACCACAGCAAGGACATGG + Intergenic
1160030755 18:75257409-75257431 TCAGAATCTTGGCTAGGACAAGG + Intronic
1160128779 18:76205308-76205330 ACAGCAACATATCAAGGACAGGG + Intergenic
1160886100 19:1349054-1349076 CCAGCATTTTGGGAAGGGCAAGG - Intergenic
1161349214 19:3783201-3783223 GCAGCATTACAGCAAGGACAAGG - Exonic
1161514138 19:4687297-4687319 CCACCAACATGGCAGAGACAGGG + Intronic
1161739635 19:6012862-6012884 CCAGCATCCTGGGAAAGCCAAGG - Intronic
1161860247 19:6792534-6792556 ACAGCATAATGGCTAGCACATGG + Intronic
1162319101 19:9960247-9960269 CCAGCACCCTGGAAAGGAGAAGG + Exonic
1163211823 19:15846488-15846510 CCAGCAGCATGGGAAGTTCACGG + Intergenic
1164708231 19:30335987-30336009 GCAGCATCTTGGCAAAGACTGGG + Intronic
1164947423 19:32308277-32308299 TCAGCATCATGGCAACACCAAGG - Intergenic
1165466341 19:35977242-35977264 CCGGCATCACGGGAAGTACAAGG - Intergenic
1165762388 19:38329300-38329322 CCAGCACCTTGGGAAGGCCAAGG + Intergenic
1166118495 19:40670343-40670365 CCACGTGCATGGCAAGGACATGG + Intronic
1166815707 19:45544172-45544194 GAAGCATCATGGGAAGGGCATGG - Intronic
1167648240 19:50717152-50717174 CCAGAAGCATGTCAGGGACAGGG - Intronic
1167791569 19:51686418-51686440 ACAGGATCAGGGCCAGGACAAGG + Intergenic
925901582 2:8512981-8513003 GCAGCAGCAGGGCAAGGGCAGGG - Intergenic
927729946 2:25462366-25462388 CCAGCCTCAGGACAAGGTCAGGG - Intronic
927863946 2:26576957-26576979 CTAGCCTGATTGCAAGGACAAGG + Intronic
928801526 2:35099616-35099638 GAAGGATCATGGCAAGGTCATGG + Intergenic
928859468 2:35839462-35839484 CCTGCACCATTGCAAGGACAAGG - Intergenic
929855570 2:45636021-45636043 CTACCATCATGGCAAAGGCAAGG - Intergenic
930741849 2:54839734-54839756 CCAGGTTCCTGGCAAGGAGAGGG - Intronic
930754742 2:54962790-54962812 CCAGCGTCATGGCAGAGACGGGG + Intronic
931756146 2:65376277-65376299 AAAGCATCATGGGAAGAACAGGG + Intronic
934322812 2:91983358-91983380 CCAGTGCCAGGGCAAGGACAAGG - Intergenic
934601954 2:95664423-95664445 CCACCAGAGTGGCAAGGACATGG - Intergenic
934779440 2:96960433-96960455 CCAGCATCCTGGCAAGGCAAGGG + Exonic
935540351 2:104340843-104340865 CCACCATCCTGGACAGGACACGG + Intergenic
936535313 2:113306578-113306600 CCACCAGAGTGGCAAGGACATGG - Intergenic
936724177 2:115292601-115292623 ACAGCAGCATGGCAAGGATTTGG - Intronic
936863919 2:117055834-117055856 TCTGCCTTATGGCAAGGACAGGG + Intergenic
938954949 2:136288710-136288732 CCACAATGATGGCAAGGACAGGG - Intergenic
943401769 2:187421389-187421411 CCAGCATCCTGGAAAGTTCAAGG + Intronic
945554472 2:211262230-211262252 ACAGAATGAGGGCAAGGACAGGG - Intergenic
946426793 2:219602865-219602887 CCACCCTCATGGCAAGAGCAAGG - Intronic
946826687 2:223686354-223686376 TCAGCACCGTGGCAAGGGCAAGG - Intergenic
948731792 2:239968894-239968916 CCAGTATCAAGGCATGGCCATGG - Intronic
1169564394 20:6837806-6837828 CCAGCATCACTGCAAGAAAATGG + Intergenic
1170870127 20:20198155-20198177 GCAGCACCATGGCAATGAAATGG + Intronic
1171258841 20:23713115-23713137 CTCACATCATGGCAATGACATGG - Intergenic
1173416587 20:42862308-42862330 CCAGCATCATGCCTGGCACATGG + Intronic
1174578815 20:51556519-51556541 CCAGCATCTTGGAAAGTACCCGG + Intronic
1176264190 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG + Intronic
1176592238 21:8657176-8657198 CCAGTGCCATGGCAAGGGCAAGG - Intergenic
1180068065 21:45422654-45422676 CCAGCACCCTGCCAAGGAAAGGG + Intronic
1180275089 22:10634305-10634327 CCAGTGCCATGGCAAGGGCAAGG - Intergenic
1180549572 22:16529256-16529278 CCAGTGCCAGGGCAAGGACAAGG - Intergenic
1180879361 22:19192928-19192950 TCAGCAGCAGGGCCAGGACATGG + Intronic
1181170821 22:21008895-21008917 CCCTCACCATGGCAAGTACATGG - Intergenic
1181862351 22:25828845-25828867 CCGGCACCAGGGCAAGGACCGGG + Exonic
1182168745 22:28204924-28204946 CCAGCTTTAAGACAAGGACAGGG - Intronic
1182301630 22:29340343-29340365 CCAGGATCAGGGCAAGGGCTAGG + Intronic
1182519776 22:30878790-30878812 ACATCCTGATGGCAAGGACATGG + Intronic
1182651035 22:31851470-31851492 CCAGGATGCTGGCAAGCACAGGG - Intronic
1183395241 22:37567726-37567748 CCAGCGTCATGGCAGGGAGCCGG + Intronic
1184808927 22:46815766-46815788 CCAGCTTTATGGCAAGGTGAAGG + Intronic
1184855650 22:47145092-47145114 ACAGCAGCCTGGCAAGGGCAGGG + Intronic
1185410391 22:50678614-50678636 CCAGCTGCATAGCACGGACAAGG + Intergenic
950905049 3:16530474-16530496 CCAGCAGCATGCCTAGCACAGGG - Intergenic
950938201 3:16865221-16865243 CCATCATCATGAAAAGGTCAAGG + Intronic
952866512 3:37859041-37859063 TCAGCATATAGGCAAGGACAGGG + Intergenic
953320087 3:41963580-41963602 CCAGCATCAGGGAAAAGACCTGG - Intergenic
954077941 3:48194937-48194959 CCAGCACTTTGGGAAGGACAGGG - Intergenic
954829591 3:53408641-53408663 CCATCAACATGCCAGGGACAGGG + Intergenic
954885092 3:53866143-53866165 CCAGCACTTTGGCAAGGCCAAGG + Intergenic
955524398 3:59805810-59805832 CCAGCATCATGCTCAGTACATGG - Intronic
957345220 3:78951651-78951673 CCAGCATCAGGGAAAGCGCAGGG + Intronic
958082156 3:88760502-88760524 TCACAATCATGGCAAAGACAAGG - Intergenic
959856265 3:111162314-111162336 CCCACATCATGGGAAGGACCTGG + Intronic
961019147 3:123489513-123489535 ACAGCTTCATCCCAAGGACACGG - Intergenic
961625327 3:128258323-128258345 CCAGCACCGTGGGAAGGACAGGG + Intronic
961650394 3:128414127-128414149 CAAGCCTCAGGGCATGGACAGGG - Intergenic
966345501 3:178974542-178974564 ATAGCATAATGGAAAGGACAGGG + Intergenic
966470487 3:180283401-180283423 CCAGGATCAGGGCAAGGAGGAGG + Intergenic
966670009 3:182516324-182516346 TTAGGTTCATGGCAAGGACAGGG - Intergenic
967948420 3:194822365-194822387 CCAGCAGCAGGGCCAGGACACGG + Intergenic
970567473 4:17346865-17346887 ATAGAACCATGGCAAGGACATGG - Intergenic
971784546 4:31083860-31083882 CCAGCATCATTGAATGGACTGGG - Intronic
973705552 4:53576474-53576496 CCTGCCTCATGGGAAGGGCAGGG - Intronic
975971922 4:80049951-80049973 CAAGCATCATGTCAGGAACAGGG - Intronic
977351497 4:95894334-95894356 CCAGTGTCATGGAAGGGACAAGG + Intergenic
979785835 4:124713380-124713402 CCAGCCTCATGAAAAGGACGTGG + Intergenic
981292091 4:143088229-143088251 CCAGCATCATGACAAACTCAGGG + Intergenic
982008178 4:151082823-151082845 TCCTGATCATGGCAAGGACAAGG - Intergenic
982219557 4:153112877-153112899 CCAAAATCAAGGCATGGACAGGG + Intergenic
982550332 4:156790020-156790042 ATAGTATCATGGCAAGAACATGG + Intronic
984860091 4:184230245-184230267 CCAGCACCGTGGCTAGGACCAGG + Intergenic
985070143 4:186159493-186159515 GCAGCATAGTGGCAAGAACAGGG + Intronic
985322783 4:188733492-188733514 CCAGCTGCACGGCAAGAACACGG - Intergenic
985494950 5:199151-199173 CCACCATCCTGGCAAGGAGTGGG + Exonic
985706063 5:1401994-1402016 CCAGCAGCCTGGCCAGGCCAAGG - Intronic
986352467 5:6893339-6893361 CCAACATCATGGGGAGGGCAGGG + Intergenic
986886678 5:12246313-12246335 CCAGCATAATGGCAAGGGAACGG + Intergenic
987735232 5:21831690-21831712 CGAGAATCAGGGCAAGTACATGG - Intronic
996098631 5:119425201-119425223 CATGGAGCATGGCAAGGACAAGG - Intergenic
997693672 5:135844887-135844909 CTAGCATCTCGGCAAGGAAAAGG + Intronic
1003411022 6:5863074-5863096 CTATCAACATGGCAAGGACATGG - Intergenic
1003715436 6:8640940-8640962 CCATTAAAATGGCAAGGACAAGG - Intergenic
1005328957 6:24730864-24730886 TCAGAATCATGGCAAAGGCAAGG - Intergenic
1005356478 6:24988732-24988754 ACATAAACATGGCAAGGACAAGG - Intronic
1006845149 6:37056537-37056559 CCAGCATCTTGCCAAGGCCTAGG + Intergenic
1006944944 6:37778805-37778827 CCAGCCACATGGCAGGGACTTGG + Intergenic
1010133509 6:72523240-72523262 CCAGCATCCCAGCAAGGGCATGG + Intergenic
1013727792 6:113121178-113121200 CCAGCATCCTGCCACAGACAGGG - Intergenic
1017907354 6:158765880-158765902 CCAGCAGCCTGCCAAGGCCATGG + Exonic
1018486804 6:164248974-164248996 CCAGCCTCATGGCACAGCCAGGG - Intergenic
1018883857 6:167915195-167915217 GCAGCGTCGTAGCAAGGACATGG - Exonic
1019256879 7:58019-58041 CCAGCATCATGGCAGGAAAACGG + Intergenic
1021436827 7:20627802-20627824 CCGGCATCATGGCAATGTCATGG - Intronic
1022441457 7:30436607-30436629 CCAGCATCATCCTGAGGACAAGG + Intronic
1022477774 7:30723031-30723053 TCAGCCTCCTGGGAAGGACAAGG + Intronic
1023736221 7:43238262-43238284 CCAGCATCATGGCCATGAGCTGG - Intronic
1026422948 7:70259451-70259473 TCATCATCATGTCAAGGACCTGG + Intronic
1028291961 7:89076077-89076099 CCAACATCATATCAAAGACAAGG - Intronic
1034454067 7:151155642-151155664 CCAGCTTCATGACAAGTTCAGGG + Intronic
1035025660 7:155823719-155823741 ACAGCATCATGGCGAGGACTAGG - Intergenic
1036215539 8:6877173-6877195 CCACCATCATGTCAGGGTCATGG + Intronic
1038414999 8:27388663-27388685 CCAGCATGATGGCACTGAAAGGG - Intronic
1039610988 8:38919195-38919217 ACTGGATCTTGGCAAGGACATGG + Intronic
1040306464 8:46214515-46214537 CCTGCATCTTGGCCATGACAAGG - Intergenic
1043925757 8:86034905-86034927 CCAATATCTTGGCAAGGGCATGG + Intronic
1048820473 8:138375851-138375873 CCAGTAACAGGGCAAGGAGATGG + Intronic
1048978503 8:139689572-139689594 ACAGCATCATGGCAGTGTCATGG + Intronic
1049854039 8:144850555-144850577 CCTGCCTCATGGGAAGGGCAGGG + Exonic
1054297101 9:63340484-63340506 ACCGTATCATGGAAAGGACACGG + Intergenic
1054789496 9:69242360-69242382 CCAGCATCAGGACTAGCACATGG + Intronic
1055104736 9:72500618-72500640 CCATCATCAAGCCAAGGAGATGG + Intergenic
1058147617 9:101429683-101429705 CAAGCACACTGGCAAGGACAGGG - Intronic
1058755639 9:108080553-108080575 CCAACATCAAGACAAGGACCAGG - Intergenic
1058976428 9:110129025-110129047 CCATCATAATGACATGGACATGG + Intronic
1059424512 9:114212235-114212257 CCAGCTTCAGGGCAAGGACCTGG + Intronic
1060413524 9:123415319-123415341 CCAGCATCATAACAAGCCCAGGG - Intronic
1060803885 9:126562993-126563015 CCAGGCTCATGGCAATGAAAAGG + Intergenic
1062042183 9:134409226-134409248 ACAGAAGCATGGCAAGGCCAAGG + Intronic
1062634956 9:137485844-137485866 CCAGCACAGTGGCAAGGACATGG + Intronic
1203622291 Un_KI270749v1:136023-136045 CCAGTGCCATGGCAAGGGCAAGG - Intergenic
1186188714 X:7047204-7047226 CCAGCACCATGGAAAACACAAGG - Intergenic
1186342369 X:8658155-8658177 CAAGCACCATGGAAGGGACATGG + Intronic
1186858277 X:13646637-13646659 CTAGCACCATGGTAAGGTCAGGG + Intergenic
1187189450 X:17019683-17019705 CCAGCATGGTGGCAAGCACCTGG + Intronic
1193318249 X:80090157-80090179 CTAGCATCATTGCAAACACATGG - Intergenic
1200738593 Y:6828672-6828694 CCAGCATCATGTCTAGCACAGGG - Intergenic
1202583315 Y:26403381-26403403 CCAGTGCCAGGGCAAGGACAAGG + Intergenic