ID: 1176264191

View in Genome Browser
Species Human (GRCh38)
Location 20:64200158-64200180
Sequence GACACGGATGTGCCTACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264183_1176264191 15 Left 1176264183 20:64200120-64200142 CCTGGCCCCATCATGTGGCGCAC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1176264189_1176264191 -7 Left 1176264189 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1176264185_1176264191 9 Left 1176264185 20:64200126-64200148 CCCATCATGTGGCGCACCAGCAT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1176264181_1176264191 22 Left 1176264181 20:64200113-64200135 CCTCTGTCCTGGCCCCATCATGT 0: 1
1: 0
2: 0
3: 37
4: 319
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1176264184_1176264191 10 Left 1176264184 20:64200125-64200147 CCCCATCATGTGGCGCACCAGCA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1176264186_1176264191 8 Left 1176264186 20:64200127-64200149 CCATCATGTGGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 15
4: 80
Right 1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264191 Original CRISPR GACACGGATGTGCCTACACC TGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
906483331 1:46215755-46215777 TACAGGCATGTACCTACACCTGG - Intronic
908185406 1:61648080-61648102 GGCACGGAGGAGACTACACCAGG + Intergenic
918928321 1:190816913-190816935 GATACTGATGTACCTACAGCTGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1070139401 10:73726973-73726995 GGCAAGGATGTGCATGCACCTGG + Intergenic
1072546156 10:96441134-96441156 GACATGGCTGTGCCTTCAGCTGG - Intronic
1075773861 10:124966192-124966214 GACAGGGATGTGCTTCCAGCTGG - Intronic
1077012651 11:385751-385773 GACCCGGCTGTGCCTTCAGCTGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1086436961 11:86791174-86791196 GACACAGATTTGCCTTCATCTGG + Intronic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1091801259 12:3326192-3326214 GACACGGATGGGCCTGCAGGGGG - Intergenic
1091928010 12:4371053-4371075 GACAAGGTGGTGCCTACTCCAGG - Intronic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1107959517 13:45545745-45545767 GACACAGGTGTCCCTACACAGGG - Intronic
1111337065 13:86838667-86838689 TACAAGGCTGTGGCTACACCAGG + Intergenic
1121731241 14:96188616-96188638 GACACGGATGCGCACACACAGGG + Intergenic
1125191965 15:37003875-37003897 GAGACGGCTGTCTCTACACCGGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1135112288 16:19699620-19699642 GGCACGGCTGTGCAGACACCAGG + Exonic
1137618841 16:49862669-49862691 GACAAGGAGGTTCCCACACCCGG - Intergenic
1139587420 16:67913042-67913064 TACAGGCATGTGCCCACACCTGG - Intronic
1141851073 16:86646475-86646497 GACTCGGATGTGACTGCCCCTGG + Intergenic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG + Intronic
1163014036 19:14442923-14442945 CATCCGGATGTGCCAACACCCGG + Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925186360 2:1849449-1849471 GACATTGATGTGGCTTCACCAGG - Intronic
925442505 2:3900590-3900612 AACATGGAGGTGCCTACACCAGG - Intergenic
927195306 2:20542582-20542604 GACACAGATGTGTCCAAACCTGG + Intergenic
948152785 2:235757502-235757524 GACATGGATCTGCCTAGACCAGG - Intronic
1175606829 20:60318049-60318071 GACACGGAAATGCATACACAGGG - Intergenic
1176081860 20:63277533-63277555 GACACGGCTGTGTGCACACCTGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1181004191 22:20002184-20002206 GTCACGGATGTGTCTACCTCTGG + Intronic
1182194328 22:28499035-28499057 CACAGGCGTGTGCCTACACCTGG - Intronic
1184859021 22:47162850-47162872 CACGAGGAAGTGCCTACACCGGG - Intronic
1184905657 22:47484168-47484190 GACACACATGTGCGTAGACCTGG - Intronic
950675983 3:14554686-14554708 GACTCTGAGGTGCCTACACAGGG - Intergenic
952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG + Intronic
958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG + Intergenic
961569188 3:127786004-127786026 CACACAGGTGTGCCTACTCCAGG + Intronic
963078457 3:141369201-141369223 GACACGTATTTGCCTAGAACAGG - Intronic
965066593 3:163857884-163857906 GACAAGGAGGTGCCTGAACCTGG - Intergenic
980846372 4:138330008-138330030 GACATGCATTTGCCTACAGCTGG + Intergenic
984256534 4:177396053-177396075 GAGACGGAAGTTCCTACTCCTGG + Intergenic
985826417 5:2195043-2195065 GACAGGGATGGTCCTACACATGG - Intergenic
990998648 5:61759290-61759312 GACAGGGGTGTGACTACAACAGG - Intergenic
998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG + Intronic
1000071883 5:157748063-157748085 GACACTGATGTGCCTTTGCCGGG + Intronic
1016820677 6:148343164-148343186 GCCTCGGATGTGCCAGCACCCGG - Exonic
1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG + Intergenic
1023247872 7:38225851-38225873 GACACGGATGTGTCTGCATGTGG + Intronic
1024454136 7:49583538-49583560 GACACGAATGTGCATGAACCTGG + Intergenic
1029283918 7:99453371-99453393 GGCACGGCTGCACCTACACCTGG - Intronic
1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG + Intergenic
1041719295 8:60961737-60961759 GACATGTGTGTGCCCACACCTGG + Intergenic
1044537204 8:93370883-93370905 GACACAGATGTGGCTACACAGGG + Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1049820726 8:144631666-144631688 GACCCAGAGGTGCTTACACCAGG - Intergenic
1061979160 9:134090230-134090252 TACAAGGTTGTGCATACACCAGG + Intergenic
1195704615 X:107729811-107729833 GACATGGATGTGTTTACACAGGG - Intronic
1198936423 X:141905411-141905433 GACAAGGATATGCCTACTGCTGG + Exonic