ID: 1176264192

View in Genome Browser
Species Human (GRCh38)
Location 20:64200169-64200191
Sequence GCCTACACCTGGTCACCACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264186_1176264192 19 Left 1176264186 20:64200127-64200149 CCATCATGTGGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 15
4: 80
Right 1176264192 20:64200169-64200191 GCCTACACCTGGTCACCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 79
1176264183_1176264192 26 Left 1176264183 20:64200120-64200142 CCTGGCCCCATCATGTGGCGCAC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1176264192 20:64200169-64200191 GCCTACACCTGGTCACCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 79
1176264185_1176264192 20 Left 1176264185 20:64200126-64200148 CCCATCATGTGGCGCACCAGCAT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1176264192 20:64200169-64200191 GCCTACACCTGGTCACCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 79
1176264184_1176264192 21 Left 1176264184 20:64200125-64200147 CCCCATCATGTGGCGCACCAGCA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1176264192 20:64200169-64200191 GCCTACACCTGGTCACCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 79
1176264189_1176264192 4 Left 1176264189 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1176264192 20:64200169-64200191 GCCTACACCTGGTCACCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264192 Original CRISPR GCCTACACCTGGTCACCACG AGG Intronic
902270988 1:15304911-15304933 CCCTGCACCTGGCCACCAGGTGG - Intronic
910666568 1:89731353-89731375 GCATAGACCTGTTCACCACATGG + Intronic
910852922 1:91666233-91666255 GCCTACACCTGGTCGACTGGAGG + Intergenic
915283911 1:154840992-154841014 GCCTGCCCCTGGTCTCCACCTGG - Intronic
919313334 1:195940038-195940060 GCCTCCACCTTGTGACCAAGAGG - Intergenic
1069574365 10:69516421-69516443 GCCTCCACCTGGGCATCATGTGG + Intergenic
1073552632 10:104417213-104417235 GCCCATGCCTGGTCACCAGGAGG - Intronic
1077497406 11:2892785-2892807 GCCTGCACCTGCCCACCGCGTGG + Intronic
1078874553 11:15379845-15379867 GCCCACACCAGGTCACCCCCAGG + Intergenic
1083082170 11:60105157-60105179 GCCTACACCTGGTCGACTGGAGG + Intergenic
1083151439 11:60794194-60794216 GCCCACACCTGGGCTCCAGGAGG - Intronic
1083709872 11:64541330-64541352 GCCTCCAGCTGTTCACAACGCGG - Intergenic
1092237324 12:6818551-6818573 CCCCACACCTGGTCCCCACAAGG + Intronic
1095940792 12:47725408-47725430 GCCTCCAACTGGGCACCATGAGG - Exonic
1098031443 12:66258820-66258842 GCCTTCACCTTCTCACCATGAGG - Intergenic
1098248430 12:68544175-68544197 GCCCACACCTGGTCAACTGGAGG - Intergenic
1104651753 12:130539800-130539822 TCCTACACCTGGCCACCTCATGG - Intronic
1106100163 13:26687625-26687647 TCCTAGAGCTGGTCACCACTAGG + Exonic
1110653674 13:77972207-77972229 GCCTACGCCTGGTCAACTGGAGG + Intergenic
1112771601 13:102799711-102799733 GCCTCCATCTGGACGCCACGGGG - Intronic
1115102874 14:29724043-29724065 GGCTACATCAGGTCAACACGAGG + Intronic
1124896048 15:33778515-33778537 TCCCACACCTGGCCACCACCTGG + Intronic
1126165152 15:45648654-45648676 GCTTACACCTGGTGCCCAGGTGG - Intronic
1129032807 15:72630593-72630615 CCCCACTCCTGGTCACCATGTGG + Intergenic
1129407601 15:75329413-75329435 CCCTACTCCTGGTCACCATGGGG + Intergenic
1130046152 15:80446535-80446557 GCCTCCGCCTGGGCACCACAAGG + Intronic
1132549204 16:547435-547457 GCCTCCACCTGGCCTCCCCGGGG + Exonic
1141370591 16:83482715-83482737 GTCTACACCATGTCTCCACGTGG - Intronic
1141643748 16:85356544-85356566 GCGTAGAGCTGGTCACCACCAGG + Intergenic
1141987085 16:87587161-87587183 GCCAACACCCGGAAACCACGCGG - Intergenic
1142217018 16:88834801-88834823 GCCTGGACCTGGTCACCCAGGGG - Intronic
1142719101 17:1764379-1764401 GCCTACAGCTGGTCTCCACCCGG - Intronic
1148356538 17:46979167-46979189 GCCTACCCCTGGGCACCGGGCGG + Exonic
1151560125 17:74865581-74865603 GCCTCTGCCTGGGCACCACGGGG + Intronic
1151962655 17:77415184-77415206 GCCTCCACCTGGCCACCTCCTGG - Intronic
1154014100 18:10601181-10601203 GCCTACGCCTGGTCAACTGGAGG + Intergenic
1165700520 19:37933686-37933708 GCCTCCCCCTGGTCACCCAGTGG + Intronic
1167095679 19:47373829-47373851 CCCAACACCTGGTCACCGGGTGG - Intronic
1167562102 19:50232080-50232102 CCCTACCCCTGGCCTCCACGGGG - Intronic
1167983009 19:53291406-53291428 GCCTCCAGCTGGAAACCACGCGG + Exonic
935334075 2:101998813-101998835 GCCTCCACCTGGTTTCCAAGGGG - Intronic
935975402 2:108573596-108573618 GCATACACCTGGTCTCTACCAGG - Intronic
936246557 2:110833445-110833467 GGCTACACACGGTCACCATGAGG + Intronic
942034790 2:172000213-172000235 GCCTAGAACACGTCACCACGTGG + Intronic
942420766 2:175805345-175805367 CCCTCACCCTGGTCACCACGGGG - Intergenic
948101649 2:235379237-235379259 TCCTACAGCTGGTGACCAAGTGG - Intergenic
1172808950 20:37633447-37633469 GCCCACCCCTGGTCTCCAAGAGG + Intergenic
1175965093 20:62656426-62656448 GCCTCCGCCTGGTGACCTCGAGG - Exonic
1176264192 20:64200169-64200191 GCCTACACCTGGTCACCACGAGG + Intronic
1178601893 21:34001480-34001502 GACTACAACTGGACACCACCAGG + Intergenic
1179670845 21:42946537-42946559 GCCCACACCTGGTCAACTGGAGG + Intergenic
1180096809 21:45559420-45559442 GCCTACCGCTGGTCCCCATGGGG - Intergenic
1185382687 22:50517408-50517430 GCCTGCATCTGGTCACCAGGTGG + Exonic
949345442 3:3072165-3072187 GCCTACAGCTGGGCCCCATGAGG - Intronic
949610909 3:5702536-5702558 GCCCACACCTGGTCAACTGGAGG + Intergenic
950892081 3:16413181-16413203 GCCTAGGCCTGGTCACCAGTGGG - Intronic
956843912 3:73165031-73165053 GCATACATCTGGTCACCACTGGG + Intergenic
958636540 3:96753613-96753635 GCCCACACCTGGGCACTACCAGG - Intergenic
962277103 3:134023837-134023859 GCCTACACCTGGTCAACTGGAGG - Intronic
966400092 3:179538959-179538981 GCCTCCATCCCGTCACCACGTGG - Intergenic
967360932 3:188630972-188630994 GAATACACATGGTCACCAAGAGG + Intronic
969211530 4:5691668-5691690 GCCCACACCTGGTAAGCACACGG - Intronic
969725554 4:8916160-8916182 GCCTGCACCTGGTCACAGCTTGG - Intergenic
974988003 4:69053520-69053542 GCCTACGCCTGGTCAACTGGAGG - Intronic
976778167 4:88729354-88729376 GCCTGCTCTTGGCCACCACGCGG + Intronic
978848283 4:113301649-113301671 TCCAACACCTGGTCACCACCAGG + Intronic
997428759 5:133823172-133823194 GCCCAGAGCTGGTCACCACCAGG + Intergenic
997634976 5:135398552-135398574 GCCTACACCTCGGCCCCCCGGGG + Intronic
997817748 5:137034925-137034947 GCCTACACCTGGACCCCTCTGGG - Intronic
1008123508 6:47644386-47644408 GCCCACACCTGGTCAACAGGAGG - Intergenic
1008787152 6:55182438-55182460 GCCAACAGCTGCTCACCACAAGG - Intronic
1010141554 6:72620458-72620480 GCCTGCTCCTGGTCACCAGCAGG - Intergenic
1022567413 7:31417119-31417141 CCCTACCCCTGGTCTCCACGTGG + Intergenic
1023375186 7:39548846-39548868 GCCTAAACCAGGTAACCACTTGG + Intergenic
1023990805 7:45127188-45127210 GCCAGCACATGGTCACCACGGGG - Intergenic
1024812982 7:53235289-53235311 GCCCACACCTGGTCAACTGGAGG - Intergenic
1029659032 7:101946718-101946740 GCCTACCTCTGATGACCACGGGG - Intronic
1041029638 8:53723741-53723763 GCCTAAGCCTGCTCTCCACGTGG + Intronic
1044750176 8:95408194-95408216 GTCCCCTCCTGGTCACCACGGGG - Intergenic
1047889756 8:129294751-129294773 TCCCACCCCTGGTCACCACCTGG - Intergenic
1052508124 9:29381105-29381127 GCCTACACCTGGTCACCTGGAGG - Intergenic
1056824161 9:89865200-89865222 GTCTACACCAGGTCAGCATGAGG + Intergenic
1057185240 9:93053797-93053819 GCCTTTACCTGGCCACCACTGGG - Intergenic
1061543629 9:131291135-131291157 GCCTCCACATGGGCCCCACGTGG - Intronic
1062508376 9:136890222-136890244 TCGTTCAGCTGGTCACCACGGGG + Intronic
1062551605 9:137090020-137090042 GCCTAGTCCTGGGCACCACCAGG + Intronic
1186404874 X:9293054-9293076 GCCCACACCTGGGCCCCACCTGG - Intergenic
1190771255 X:53516659-53516681 GCCTACACCTGGTCGACTGGAGG - Intergenic
1191639272 X:63412919-63412941 GCCCACACCTGGTCAACTGGAGG - Intergenic
1201052750 Y:9955805-9955827 GACTACAGTTGCTCACCACGAGG + Intergenic