ID: 1176264194

View in Genome Browser
Species Human (GRCh38)
Location 20:64200175-64200197
Sequence ACCTGGTCACCACGAGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264186_1176264194 25 Left 1176264186 20:64200127-64200149 CCATCATGTGGCGCACCAGCATC 0: 1
1: 0
2: 0
3: 15
4: 80
Right 1176264194 20:64200175-64200197 ACCTGGTCACCACGAGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1176264185_1176264194 26 Left 1176264185 20:64200126-64200148 CCCATCATGTGGCGCACCAGCAT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1176264194 20:64200175-64200197 ACCTGGTCACCACGAGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1176264184_1176264194 27 Left 1176264184 20:64200125-64200147 CCCCATCATGTGGCGCACCAGCA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1176264194 20:64200175-64200197 ACCTGGTCACCACGAGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1176264189_1176264194 10 Left 1176264189 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1176264194 20:64200175-64200197 ACCTGGTCACCACGAGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264194 Original CRISPR ACCTGGTCACCACGAGGACC TGG Intronic
900191503 1:1354156-1354178 CCCTGGTCCCCAGGAGGGCCGGG + Intronic
901197105 1:7446513-7446535 GCCTGGCCACCAGGAGGGCCCGG + Intronic
901455979 1:9363066-9363088 AGCTGGTCACTACCAGTACCAGG - Intronic
901632060 1:10652914-10652936 ACCTGGACACCTCCAGGCCCAGG - Intronic
904091667 1:27949288-27949310 AAATGGTCACCATGAAGACCTGG - Intronic
904750779 1:32740636-32740658 TCCTGGTCTCCACGAGGGCAGGG - Intergenic
904971166 1:34420451-34420473 ACCTGATCACCACCATAACCTGG - Intergenic
911101831 1:94101543-94101565 ACCTGGTCAGCACCAGCTCCTGG - Intronic
912420781 1:109540907-109540929 ACCTGGTTTCCACGTGGAGCTGG - Intronic
916788562 1:168104694-168104716 ACAAGGTGACCACGATGACCAGG + Exonic
921806702 1:219463178-219463200 ACCTTGTCAGCAAGAGGATCAGG - Intergenic
923320702 1:232830303-232830325 ACCTGGTCACCATGTTGACCAGG - Intergenic
924541678 1:244986468-244986490 ACCTGGTCTTCACAAAGACCTGG - Intronic
1065233290 10:23621140-23621162 TCCTGGTCATCTCGAGGCCCAGG - Intergenic
1070988538 10:80710279-80710301 ACTTCGTCACCCCGACGACCTGG + Intergenic
1077599939 11:3567524-3567546 GACTGGTCACCATGAGGACCAGG - Intergenic
1082254321 11:50015677-50015699 ACCTGGTCACCAAGAAAGCCTGG + Intergenic
1082266516 11:50124463-50124485 ACCTGGTCACCAACAGGGGCTGG + Intergenic
1082289573 11:50354105-50354127 ACCTGGTCACCAACAGGGGCTGG - Intergenic
1084207293 11:67603080-67603102 AACTGGTCCCCATGAGGAGCTGG - Exonic
1084586118 11:70063730-70063752 ATCAGGTCACCACCAGCACCAGG + Intergenic
1089012591 11:115143108-115143130 ACCTGGTGACCACTCGGGCCAGG - Intergenic
1093068189 12:14680960-14680982 TCTTGGTCACCAGGAGGACTGGG + Intronic
1101150396 12:101877822-101877844 ACCAGGTCACCAAGAGGAAGGGG - Exonic
1102647319 12:114412217-114412239 TCCTGGTCACCATGGCGACCTGG + Intergenic
1102986065 12:117279702-117279724 TTCTGGTGACCACGAGGACAAGG + Intronic
1105858800 13:24392127-24392149 ACCTGGTTCCCAGGAGCACCTGG - Intergenic
1113424284 13:110195076-110195098 CCCTGGTCACCTGGAGGTCCGGG + Exonic
1119267322 14:73270738-73270760 ACCTGGTCACCACGCTGAAATGG + Intronic
1123032447 14:105458352-105458374 ACCGGGCCACCACCAGGAACTGG - Exonic
1125882826 15:43208734-43208756 ACGTGGTCACCACGCGGGCAGGG + Exonic
1128469229 15:67937997-67938019 TCCTGGTCTCCAGGAGGACTGGG - Intergenic
1141644518 16:85360157-85360179 ACCTGGTGGCCACCGGGACCAGG - Intergenic
1144854441 17:18260309-18260331 ACCTGGTCCCCAGAAGGAACGGG + Intergenic
1145950642 17:28814016-28814038 ACCAGGTCACCATGTTGACCAGG - Intronic
1147348366 17:39820776-39820798 AGCTGTTCACCAGAAGGACCTGG + Intronic
1154150903 18:11905679-11905701 ACCTGCTGACCACCAGCACCTGG + Intronic
1156496734 18:37530701-37530723 ACCAGGTCACCACCAGGAGGAGG - Intronic
1160443773 18:78912123-78912145 AGCTGGGCACCAAGAGGGCCTGG - Intergenic
1163962787 19:20712781-20712803 ACCTTGTCACCCCCACGACCTGG - Intronic
1167194757 19:48020653-48020675 TGCTGGTCACCAGGAGCACCTGG - Intronic
1168217925 19:54939907-54939929 TGCTGGTCACCACGCGGCCCAGG - Exonic
1168224188 19:54982693-54982715 TGCTGGTCACCACGCGGCCCAGG + Exonic
1168683647 19:58334982-58335004 ATCTGGTCCACACGAGGCCCTGG + Exonic
927449118 2:23191299-23191321 ACCTGGTCCCCACGTAGGCCTGG - Intergenic
928323707 2:30303345-30303367 ACCTGGTCAGCACCAGGCTCTGG - Intronic
930103433 2:47620219-47620241 ACCTAGTCACCATCAGGACAAGG + Intergenic
934851542 2:97705130-97705152 ACCTGCTGACCACAAGCACCAGG - Intergenic
935362036 2:102253585-102253607 ACCTCCTCACCACCATGACCAGG + Intergenic
935388469 2:102525483-102525505 ACCTGGTCACCATGGGGTCTGGG + Intronic
936052226 2:109233195-109233217 ACCTGGGTACCAAGAGGACAAGG - Intronic
936937040 2:117848540-117848562 GCCTGGTCACCACCAGGTCGCGG - Intergenic
938365501 2:130729994-130730016 ACCTGGTCAGCACCATGTCCAGG - Exonic
942185507 2:173421228-173421250 AGCTGGGAACCACGAGGACGAGG - Intergenic
942816795 2:180061449-180061471 ACTTCGTCACCCCGACGACCTGG + Intergenic
946412570 2:219522548-219522570 ACATGATCAGCACGAGGCCCGGG - Intronic
947144326 2:227050975-227050997 ACCTGGTCACCTGGAAGTCCTGG + Exonic
948263138 2:236619083-236619105 AGCTGGTCCCCACGTGGTCCTGG - Intergenic
948965141 2:241373607-241373629 ACCTGGTCTCAGCGAGGCCCAGG + Intronic
1168750332 20:277439-277461 ACCTGGGCCCCAGGAGGCCCAGG + Intronic
1172225088 20:33300082-33300104 TCCTGGTCACCATTAGGACACGG + Intronic
1172519650 20:35558536-35558558 ACCTGGCCACCAGCAGGAGCAGG + Intergenic
1174509056 20:51037412-51037434 TACTGGTCGCCATGAGGACCTGG + Intergenic
1176264194 20:64200175-64200197 ACCTGGTCACCACGAGGACCTGG + Intronic
1176369999 21:6056833-6056855 CCGTGGTCTCCACGGGGACCAGG - Intergenic
1179615308 21:42579655-42579677 CCGTGGGCACCATGAGGACCTGG - Intronic
1179753520 21:43481708-43481730 CCGTGGTCTCCACGGGGACCAGG + Intergenic
1181038210 22:20179882-20179904 ACCTGGACACCACCCTGACCCGG - Intergenic
1181363357 22:22355531-22355553 ACCTGGACACCCAGAGGATCTGG - Intergenic
1184713651 22:46268112-46268134 ACCGGGCCACCCCCAGGACCCGG - Intronic
1185057799 22:48590090-48590112 ACCTTGTCTCAAGGAGGACCTGG + Intronic
954136620 3:48584908-48584930 ACCGGGTCCCCACGAGGGCCAGG + Exonic
957070763 3:75566184-75566206 CTGTGGTCACCATGAGGACCAGG - Intergenic
961265128 3:125635342-125635364 AGCTGTGCACCACCAGGACCGGG + Intergenic
961939938 3:130626527-130626549 ACCTGCAAGCCACGAGGACCAGG - Exonic
964995194 3:162869765-162869787 ATTTTGTCACCACCAGGACCAGG + Intergenic
968489261 4:881311-881333 CCTTGGTCTCCATGAGGACCTGG - Intronic
969148327 4:5143734-5143756 AACTGGCCAGCATGAGGACCCGG + Intronic
969214344 4:5710576-5710598 ACCCGCTCCCCACTAGGACCAGG - Intergenic
969350608 4:6596113-6596135 ACCTGGACACCACGCCCACCTGG - Intronic
969739594 4:9014572-9014594 CTGTGGTCACCATGAGGACCAGG + Intergenic
980533474 4:134085073-134085095 ACCTGCTCACTAGGAGGAGCGGG - Intergenic
985517642 5:355135-355157 CCCTGGGCACCAGGAGGCCCAGG - Intronic
985542730 5:494305-494327 CCCTGGCCACCACAGGGACCAGG - Intronic
985759212 5:1736343-1736365 GCATGGGCACCACCAGGACCAGG - Intergenic
988512438 5:31876837-31876859 ACCTGGTCACCACCCAGAACTGG - Intronic
995526252 5:113052831-113052853 GGCTGGTCACCAGAAGGACCAGG - Intronic
997408184 5:133669244-133669266 ACCTGCTCACCAGGAAGAGCTGG - Intergenic
1003958713 6:11190077-11190099 TCCTGGTGACCACAAGGCCCAGG - Exonic
1004169391 6:13284179-13284201 GTCTGGTCACCATGAGGAGCTGG + Intronic
1007011519 6:38422906-38422928 ACCTGGTCACTATGTTGACCAGG - Intronic
1007044857 6:38762730-38762752 ACCTTGGCACTACGAAGACCAGG - Intronic
1010514878 6:76760925-76760947 GCCTGGTCACCAAAAAGACCAGG - Intergenic
1011664506 6:89621727-89621749 TCCTGGGCACCACGGGGACTCGG - Intronic
1015332719 6:131999613-131999635 ACCAGGGCACCACGTGGACTTGG + Intergenic
1016870972 6:148816257-148816279 ACATGGTCACCATGAGGAGGAGG + Intronic
1017194110 6:151681891-151681913 ACCTGCTCACCACGAGGTGCTGG + Intronic
1020016341 7:4834248-4834270 GCCTGGGCACCACGAGGCCGAGG - Intronic
1022892326 7:34714194-34714216 ACCTGGGTTCCAAGAGGACCAGG + Intronic
1023656284 7:42424752-42424774 AGCTGGTCTCCTCGAGGAACAGG - Intergenic
1034589757 7:152129145-152129167 ACCTGGGCCCCACCAGGCCCTGG - Intergenic
1035570041 8:666782-666804 ACCAGGTCACCGCGAGGAGGAGG - Intronic
1048680076 8:136831735-136831757 ACCTGGGTACCAAGAGGACAAGG - Intergenic
1050803522 9:9644970-9644992 ACCTGGTTACCAAGAGGGCAGGG + Intronic
1052642357 9:31185131-31185153 ATGTGGGCACCATGAGGACCTGG + Intergenic
1057573497 9:96221204-96221226 CCTTGGTCACCCCGAGTACCTGG + Intergenic
1059459309 9:114419918-114419940 CCCTGGTCCCCACCAGGACTGGG + Intronic
1059505003 9:114790610-114790632 ACTTGGTCCCCATGAGGAGCTGG + Exonic
1059539365 9:115115372-115115394 ACTTGGTGATCACGGGGACCTGG + Intronic
1060412711 9:123410690-123410712 ACCTGGTCACCTGCAGGCCCCGG + Intronic
1061814023 9:133182436-133182458 TCCTGGTCACCAGGCTGACCTGG - Intergenic
1062109652 9:134774892-134774914 ACCTTGACTCCTCGAGGACCTGG - Exonic
1192822460 X:74658988-74659010 ACTTTGTCACCACCACGACCTGG - Intergenic
1196148260 X:112343722-112343744 ACCTGGTCACCACTATAATCTGG + Intergenic
1196719431 X:118839722-118839744 TCCCGGTCACCAGGAGGCCCCGG + Intergenic