ID: 1176264197

View in Genome Browser
Species Human (GRCh38)
Location 20:64200188-64200210
Sequence GAGGACCTGGACTGTCACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264189_1176264197 23 Left 1176264189 20:64200142-64200164 CCAGCATCATGGCAAGGACACGG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1176264197 20:64200188-64200210 GAGGACCTGGACTGTCACTGCGG 0: 1
1: 0
2: 1
3: 15
4: 203
1176264193_1176264197 -5 Left 1176264193 20:64200170-64200192 CCTACACCTGGTCACCACGAGGA 0: 1
1: 0
2: 3
3: 9
4: 136
Right 1176264197 20:64200188-64200210 GAGGACCTGGACTGTCACTGCGG 0: 1
1: 0
2: 1
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264197 Original CRISPR GAGGACCTGGACTGTCACTG CGG Intronic
900407480 1:2498925-2498947 GGCGCCCAGGACTGTCACTGAGG - Intronic
903393597 1:22982448-22982470 GAGAACCTTGGCTGTCCCTGTGG + Intergenic
903777816 1:25804596-25804618 GAGGGGCTGGACTGGCAGTGTGG - Intronic
905146638 1:35892298-35892320 GAGGACCAGCAGTGTCACTTAGG + Intronic
905675512 1:39821985-39822007 GAGGAGCAGGACGGTGACTGTGG + Intergenic
905858691 1:41331609-41331631 GGGGACGTGGACAGTGACTGAGG - Intergenic
906144013 1:43549459-43549481 GAGGGCCTGGCCTGTCAGGGTGG + Intronic
906453194 1:45970309-45970331 GAAGACCTGAACTGTAACTGAGG - Intronic
908322138 1:62988634-62988656 AATGACATGGACTGGCACTGGGG - Intergenic
908596356 1:65692598-65692620 GAGGGCCTGGACTGTGATGGAGG + Intergenic
908616412 1:65927994-65928016 GAGGACCCAAAATGTCACTGTGG - Intronic
912472003 1:109912477-109912499 GAGGATCTGGACAGACAGTGGGG - Intronic
912935815 1:114002962-114002984 GAGGCCTTGGCCTGTCTCTGTGG + Intergenic
921123549 1:212157461-212157483 GAGGACCTGGGCTCTGAGTGAGG - Intergenic
924190623 1:241548401-241548423 GAGGAAGAGGACTGTAACTGGGG + Intronic
1066379040 10:34885720-34885742 GGGGACCTGGACAGTCAGCGTGG + Intergenic
1069748746 10:70732478-70732500 GAGGAGCTGGACTGCCACTGCGG + Intronic
1071628632 10:87199224-87199246 GAGGGCGTGAACTGTCACCGAGG + Intergenic
1073091164 10:100940859-100940881 GAGGTCTTGGTCTGTCACTGAGG + Intronic
1073117981 10:101103039-101103061 GAGAACCTGGCCAGTCACAGTGG - Intronic
1074359724 10:112815667-112815689 GAGGGCTAGGAGTGTCACTGGGG - Exonic
1075171601 10:120120860-120120882 GAAGACCTGAACTGACACAGGGG - Intergenic
1075454400 10:122575879-122575901 GGGGAGCTGGGCTGTCACTCTGG - Intronic
1076226486 10:128780537-128780559 GAGGACCTGCTCTGGCACGGTGG - Intergenic
1076826925 10:132973854-132973876 CAGCACCTGGACTGTCCCTTTGG + Intergenic
1077054958 11:586995-587017 GAGGAGCTGGTCTGGCACTCAGG + Intronic
1077254527 11:1574303-1574325 GAGGGCCTGGGCTGTCCCTGGGG + Intergenic
1077378218 11:2215572-2215594 GAGGACCGGGACGGGCGCTGAGG + Intergenic
1077378295 11:2215777-2215799 GGGGACCAGGACGGCCACTGTGG + Intergenic
1078416245 11:11168616-11168638 AAGGGCCCGGAATGTCACTGAGG - Intergenic
1080637554 11:34137186-34137208 GATGATGTGGCCTGTCACTGAGG - Intronic
1083186347 11:61019982-61020004 GCGGACTTGGAGTGTCTCTGGGG - Exonic
1083827745 11:65212709-65212731 CAGGACCTGGACTCCCAGTGAGG - Intergenic
1083909352 11:65696962-65696984 GTGGACCCGGAATGACACTGTGG - Intergenic
1087203964 11:95374615-95374637 GAGGGACTGGAAGGTCACTGTGG + Intergenic
1088404540 11:109459040-109459062 AAGGACCTGTACTATCTCTGGGG - Intergenic
1089142065 11:116293344-116293366 GAGGATCTAAAATGTCACTGTGG + Intergenic
1090979410 11:131704217-131704239 CAGGAGCTGGCCTGGCACTGGGG - Intronic
1095737351 12:45572236-45572258 GTGGACCTGGAGTGTAAGTGAGG - Intergenic
1097537415 12:60889514-60889536 GAGGAGGTGGATTGCCACTGCGG - Intergenic
1098001109 12:65944394-65944416 GAGCACCAGGACTGTCTTTGTGG - Intronic
1099854915 12:88151740-88151762 GAGTACCTGAAATGTCACTGTGG - Intronic
1104920765 12:132289568-132289590 GAGGAGCTGGGCCTTCACTGTGG + Intronic
1105291809 13:19058272-19058294 GAGGGTCTGGGCTGTCATTGGGG - Intergenic
1107888371 13:44893148-44893170 GAGGACCTGGGTTTTCACTCTGG + Intergenic
1110781903 13:79476068-79476090 GAAGAGCAGCACTGTCACTGAGG - Intergenic
1112169196 13:96952095-96952117 TAGGAAATGGACTTTCACTGGGG - Intergenic
1116757553 14:48966479-48966501 GAGGACCTGGATTAACACAGGGG - Intergenic
1118839101 14:69497724-69497746 GCAGGCCTGGAATGTCACTGAGG + Intronic
1119409787 14:74423326-74423348 GAGGAGCTGGCCTGCTACTGGGG - Intronic
1119705386 14:76779814-76779836 GAGGACCCAGAATGGCACTGAGG + Exonic
1120135745 14:80866256-80866278 TAGGAGCTGGTCTGGCACTGTGG - Intronic
1121998925 14:98630028-98630050 GAGTACTTGGGCTGGCACTGTGG + Intergenic
1122929677 14:104927546-104927568 CCGGACCTGGGCTGCCACTGGGG - Intronic
1127590505 15:60417407-60417429 GAGGACCTGGTATGTTACTTAGG - Intergenic
1128924674 15:71644108-71644130 GAGACCTTGGACAGTCACTGGGG - Intronic
1129235012 15:74218658-74218680 GAGGACCTGTACCGCTACTGTGG + Intergenic
1132869327 16:2108735-2108757 CAGCACCTGGACGGTCACCGTGG + Exonic
1134090980 16:11391656-11391678 GAGGAGCTGGAATGTAAGTGTGG - Exonic
1134718087 16:16366863-16366885 CAGCACCTGGACGGTCACCGTGG - Intergenic
1134956665 16:18385296-18385318 CAGCACCTGGACGGTCACCGTGG + Intergenic
1136077358 16:27826331-27826353 GAGGAGCTGGACTGTCTGTGGGG - Intronic
1137490309 16:48926894-48926916 GAGGACCCTCATTGTCACTGGGG + Intergenic
1138036072 16:53607989-53608011 GAGGACCTGGATGGACACAGGGG + Intronic
1138225763 16:55292943-55292965 GAGCACCTGGAGGGTCAGTGTGG + Intergenic
1138943331 16:61816706-61816728 GAGAACCTGTACTGTCATTTGGG + Intronic
1139282901 16:65785248-65785270 GAGGACCTGGGATGTCACAGGGG - Intergenic
1139402602 16:66695057-66695079 GAGGACCAGGCCTGGCACGGTGG + Intronic
1140834524 16:78780947-78780969 GATGACTTGGACTGTCACCTTGG + Intronic
1142250785 16:88990929-88990951 GAGCACAGGTACTGTCACTGAGG - Intergenic
1142497499 17:314168-314190 CAGGCCCTGGACTGTCCCAGGGG + Intronic
1143139791 17:4735177-4735199 GAGGCACAGGACTGGCACTGTGG + Exonic
1146823303 17:36001709-36001731 GATGACTTGAACTGTCCCTGTGG + Exonic
1146825382 17:36018106-36018128 GATGACTTGGACTGTCCTTGTGG + Intergenic
1147246633 17:39125396-39125418 GAGGATATGGACTGGCATTGGGG + Intronic
1147657502 17:42098979-42099001 GGGGACCTGGGCTGGCGCTGGGG - Intergenic
1147779404 17:42929467-42929489 GCGGAGCTGGAGTGTCACAGGGG - Intergenic
1148784609 17:50139968-50139990 GAGGACAGGGAATGGCACTGTGG + Intronic
1149615565 17:57994889-57994911 CAGGAGCTGTACTGTCACTGGGG + Intronic
1149764216 17:59261520-59261542 AAGGACTTGCTCTGTCACTGAGG + Intronic
1151333016 17:73422367-73422389 CAGGCCCTTGACTGTCACTGAGG + Exonic
1152421254 17:80194297-80194319 GAGGACAGGGACTGTCCTTGGGG - Intronic
1155252944 18:23968769-23968791 GAGGACCTGCATTGCAACTGTGG - Intergenic
1155521257 18:26671340-26671362 GAGGCCTTGGACTATCTCTGAGG - Intergenic
1158935842 18:62363953-62363975 CAGGGACTGGACTGACACTGGGG + Intronic
1159307431 18:66662514-66662536 GAGGAAGTGACCTGTCACTGGGG - Intergenic
1159899821 18:74035775-74035797 GAGGACCTGGCCTTTCTCTCTGG + Intergenic
1160294180 18:77622605-77622627 GTGGCCCTGGACTGTCCCAGGGG + Intergenic
1160588780 18:79928072-79928094 GAGGGGCTGGGCTGTCACCGCGG + Intronic
1161059774 19:2209138-2209160 GAGGACCAGGAGTGACAGTGGGG - Intronic
1162894668 19:13758019-13758041 GAGGACTTGGGCTTTTACTGAGG - Intronic
1163035419 19:14566553-14566575 AGGGACCTGAACTGCCACTGAGG - Intronic
1163924960 19:20331820-20331842 GAGGACTTTGGCTCTCACTGTGG - Intergenic
1164964568 19:32471267-32471289 GAGAACCAGCACTGTCCCTGAGG + Intronic
1165655465 19:37528648-37528670 AAGGAGCAGGACAGTCACTGAGG - Intronic
1165716267 19:38047773-38047795 CAGGATCTGGACTGCCGCTGGGG - Intronic
1165893484 19:39128310-39128332 GAGGGCCTCCACTGTCTCTGAGG - Intronic
1166335727 19:42105796-42105818 TTGGACCAGGACAGTCACTGTGG - Intronic
1166883436 19:45942952-45942974 GAAGATGTGGACTGTCAGTGGGG + Intronic
1168687502 19:58357579-58357601 GAGGACCTGGCCTTCCTCTGGGG + Exonic
925593252 2:5530738-5530760 GAGGACGTAAACTGTCACTTTGG - Intergenic
925735392 2:6959090-6959112 GAGGCCCTGTCCTCTCACTGAGG - Intronic
926809175 2:16741200-16741222 CAGGACCTGGGATGTCATTGAGG + Intergenic
928242235 2:29596620-29596642 GAGGGCCTTGAGTGGCACTGAGG + Intronic
929453652 2:42051836-42051858 GAGGACCTGGAGTGGCTCTGGGG + Intronic
930805927 2:55490568-55490590 GAGCACTTGAAATGTCACTGAGG - Intergenic
931009316 2:57890207-57890229 GAGGACCTGGGCTGTCATCGTGG + Intergenic
932732499 2:74231211-74231233 GAGGTCCTGCACTGTCACCTAGG - Intronic
932947466 2:76252823-76252845 GAGGACCTCAACAGCCACTGAGG + Intergenic
935461400 2:103339645-103339667 GAGGAGCAGAACTGGCACTGTGG + Intergenic
937127498 2:119483836-119483858 GGGGAGCTGGACAGTCCCTGTGG + Intronic
937429312 2:121825188-121825210 GTGGCCCTGGACTGGCACCGAGG - Intergenic
937448070 2:121975498-121975520 GAGGTCCTGGAAGGTCACAGGGG + Intergenic
938158164 2:128959000-128959022 GAGGACATGGACAGACACAGAGG + Intergenic
941646726 2:168048610-168048632 CAGGTCCTGTACTGTCCCTGGGG - Intronic
945876634 2:215284727-215284749 GAGGTCTTGCTCTGTCACTGAGG - Intergenic
946154548 2:217798857-217798879 GAGGACCGTGAGGGTCACTGAGG + Intergenic
948371247 2:237490301-237490323 GAGGTCCTGGTCTGTCGCTCAGG - Intronic
948376952 2:237527158-237527180 GAGGACCTTGCCTGGCATTGTGG - Intronic
948454462 2:238098341-238098363 GAGGACCAGGCCTAGCACTGGGG + Exonic
1171426132 20:25049853-25049875 GAAGAACTGGACTGTTACCGGGG - Intronic
1175863832 20:62164071-62164093 GAGGACCTGCTCGCTCACTGGGG - Intronic
1176019753 20:62956655-62956677 GGGGACATGGACTGTGAATGGGG - Intronic
1176264197 20:64200188-64200210 GAGGACCTGGACTGTCACTGCGG + Intronic
1178763992 21:35432229-35432251 GGGGACCTTAAATGTCACTGTGG - Intronic
1179415337 21:41193823-41193845 GAGGACCCAAAATGTCACTGTGG - Intronic
1179980035 21:44891046-44891068 CAGGACGTGGATTGGCACTGCGG + Intronic
1180706190 22:17811444-17811466 GTGAACCTGGACTGACTCTGGGG + Intronic
1181436733 22:22915514-22915536 GAGGTCCTGCACTGGTACTGGGG + Intergenic
1181729714 22:24835812-24835834 GAGGACTTGGGTTGTCACTCTGG + Intronic
1182695999 22:32199809-32199831 GGGGTCCTGCACTGGCACTGAGG + Intronic
1183638899 22:39081653-39081675 GAGGACCTGGTCTGGAACAGAGG - Intronic
1184437649 22:44489100-44489122 GAGGCCAAGGACTGGCACTGGGG + Intergenic
950315458 3:11998130-11998152 GAGGCCCAGCACTGTCTCTGGGG + Intergenic
951858514 3:27224963-27224985 GAGAACCTGGACTAACACAGTGG - Intronic
951960158 3:28309154-28309176 GAGGCCCTGGACAACCACTGAGG - Intronic
953224932 3:41009989-41010011 CAGGAGCTGGACTGGCACTAGGG + Intergenic
953692248 3:45129577-45129599 GAGGACCATGAAAGTCACTGAGG + Intronic
954590770 3:51779479-51779501 GAGGATCAGGAATGCCACTGGGG - Intergenic
954625294 3:52019202-52019224 GGGGCCCTGGGCTGTGACTGGGG - Intergenic
958523739 3:95225574-95225596 GATGACCTGGACTTTCTCTTTGG + Intergenic
968861268 4:3172580-3172602 GAGGACGAGGTCTGTCACTGTGG + Intronic
969203222 4:5622355-5622377 GAGGACCTCGAATGTCACGCAGG - Intronic
970772584 4:19632710-19632732 GAGGACCTGGATTCTCAGTTTGG + Intergenic
971342352 4:25782130-25782152 GAGGACAGGGACTGTGTCTGGGG + Intronic
971395997 4:26228008-26228030 GAGGTCCTGAGCTGTCCCTGAGG - Intronic
974877631 4:67717558-67717580 GAGAGCCTGGACTGTCACAGAGG - Intergenic
981083727 4:140661435-140661457 CAGCACCAGGCCTGTCACTGTGG - Intronic
981667892 4:147250653-147250675 AAAGACCTGAGCTGTCACTGTGG + Intergenic
981899562 4:149846611-149846633 GAGGACCAGGAATTTGACTGAGG + Intergenic
983516885 4:168666813-168666835 GAGGATCTGGACTGTGGCTTTGG + Intronic
985650233 5:1104154-1104176 GACGCCCTGGGCAGTCACTGGGG - Intronic
988800039 5:34688132-34688154 GATGACCAGGACTTTCACTCTGG - Exonic
988966156 5:36420100-36420122 GGGGCCCCGGACTGTCACTTTGG - Intergenic
990260766 5:54020199-54020221 AGGAACCTGGACTGGCACTGGGG + Intronic
991631352 5:68659448-68659470 GGGAACCTGGATTCTCACTGTGG - Intergenic
996675875 5:126173674-126173696 GGTGACCTGGACTTTCTCTGTGG - Intergenic
999471391 5:151858102-151858124 GTGGACCTGAACTGGCACTTTGG + Intronic
999793122 5:154961710-154961732 GAGGACTTGCTCTGTCACTCAGG + Intronic
1001093460 5:168758563-168758585 GAGGATCATGGCTGTCACTGGGG - Intronic
1001635815 5:173209428-173209450 GAGGTCTTGCACTGTCGCTGAGG - Intergenic
1002866464 6:1126274-1126296 GAGGACATGGAGCATCACTGGGG + Intergenic
1003015387 6:2463381-2463403 GGGGACCTGGACTAACACAGTGG + Intergenic
1004265157 6:14142964-14142986 GAGGGACTGGGCTGTGACTGTGG + Intergenic
1004691152 6:17993102-17993124 GAGGCCCTGGACTGGGGCTGAGG + Intergenic
1005044956 6:21633132-21633154 GTGGACCTGGCCAGTCACGGTGG - Intergenic
1006563751 6:34936273-34936295 AAAGACCTCCACTGTCACTGAGG + Intronic
1006909387 6:37554380-37554402 GAGGTTCTGGTCTGTGACTGAGG + Intergenic
1007168646 6:39847014-39847036 GAGGAGATGGACTGTGCCTGTGG + Intronic
1009788352 6:68367136-68367158 GAAGACCTGGGCTGTCATTCTGG - Intergenic
1011993883 6:93559988-93560010 GTGGACTTGGACTGACACTTGGG + Intergenic
1012093520 6:94930575-94930597 GATGACCTGGACTTTCTCTCTGG + Intergenic
1012250066 6:96970169-96970191 GCAGACCTGGACTGTGGCTGTGG - Intronic
1015475583 6:133656183-133656205 GGGGACCTAAAATGTCACTGTGG + Intergenic
1016161948 6:140893652-140893674 GAGGACCTGGAGTTTCTCTGAGG + Intergenic
1016997609 6:149971165-149971187 CAGGACCTGGGCTGGCTCTGTGG + Intronic
1017010914 6:150063533-150063555 CAGGACCTGGGCTGCCTCTGTGG - Intronic
1019113995 6:169741961-169741983 GGGGACCTGGACTGGCAGAGGGG - Intronic
1019168930 6:170117724-170117746 GAGGGGCTGGTGTGTCACTGCGG - Intergenic
1019432810 7:1007296-1007318 GAGGCCCTGGACTGGGACTCAGG - Intronic
1019593761 7:1848824-1848846 GGGGACCTGGGCTGCCCCTGTGG - Exonic
1021583743 7:22185670-22185692 GGGGATTTGTACTGTCACTGTGG + Intronic
1022251716 7:28615102-28615124 GAGGACCTGGCTTCCCACTGTGG - Intronic
1023700140 7:42883968-42883990 GAGGCCCAGGTCTGTAACTGTGG + Intergenic
1024331628 7:48160796-48160818 GAGAACATTGACTGACACTGAGG + Intergenic
1024670317 7:51588145-51588167 GAGGGCAGGGGCTGTCACTGGGG + Intergenic
1025144909 7:56494315-56494337 GAGGACCTGGCCCTTCACGGTGG + Intergenic
1030566391 7:111163317-111163339 GAGGCCAGGGACTGGCACTGAGG - Intronic
1031879113 7:127176715-127176737 GAGGGTCTGGACTGGTACTGGGG - Intronic
1033728467 7:144147334-144147356 CAGGGCCTGGCCTGGCACTGAGG - Intergenic
1034276710 7:149827001-149827023 AAGGCCCGGGACTGGCACTGAGG + Intergenic
1035268914 7:157708427-157708449 GATGATCTGGACAGTCCCTGTGG - Intronic
1035815767 8:2538484-2538506 GAGGACCAGGAATGTTACAGTGG - Intergenic
1036634918 8:10542580-10542602 GATGACCTGGACAGGCACGGTGG + Intronic
1036752779 8:11453918-11453940 TAGGCTCTGGGCTGTCACTGAGG - Intronic
1037355968 8:18019800-18019822 CAGGCCCTGGACTGGTACTGGGG + Intronic
1037962153 8:23105668-23105690 GAGGACCAGAACTGGGACTGTGG - Intronic
1039411235 8:37357025-37357047 GGGGACAAGTACTGTCACTGTGG - Intergenic
1039953279 8:42188655-42188677 GAGGGCTTGCCCTGTCACTGAGG + Intronic
1040570612 8:48605929-48605951 GAGCATCAGGACTTTCACTGTGG + Intergenic
1042845697 8:73167774-73167796 CTAGCCCTGGACTGTCACTGAGG + Intergenic
1044691526 8:94884575-94884597 GAGGATCTGGCCGGGCACTGTGG - Intronic
1049169841 8:141152958-141152980 GAGGAGCTGGTATCTCACTGTGG + Intronic
1050034256 9:1418439-1418461 AAGGACCTGAACTTTCATTGAGG + Intergenic
1050694041 9:8259730-8259752 GAGGAGCTGGAGTGATACTGGGG - Intergenic
1055404889 9:75964093-75964115 GAGTATCTGGACTGTCATTGTGG + Intronic
1057268545 9:93634318-93634340 GAGGGTCTGGGCTGTCACTGGGG + Intronic
1057825848 9:98371547-98371569 CAGGACCTGGATTCTCACCGTGG - Exonic
1060181651 9:121538501-121538523 GAGGACCTGGCCAGGCACAGTGG + Intergenic
1060587557 9:124795922-124795944 GGGGACCAGGACTGCCCCTGGGG + Intronic
1061131877 9:128713046-128713068 GCGGACCTGCAGTGTCCCTGTGG - Exonic
1061239261 9:129359735-129359757 GGGGACTTGCTCTGTCACTGAGG + Intergenic
1061508872 9:131048578-131048600 GAGGCACTGAACTGGCACTGGGG + Intronic
1189103388 X:38213463-38213485 GAGGGCAAGGACTGACACTGAGG + Intronic
1189948019 X:46200089-46200111 CAGGACCTGGACAGTAATTGCGG - Intergenic
1190292038 X:48999649-48999671 GAGGGCCTGGAAGGTCACTTTGG - Intronic
1192919308 X:75689827-75689849 GATGATCTAGACTGTCAGTGGGG - Intergenic
1193957115 X:87876920-87876942 GGGGACCTAAAATGTCACTGTGG + Intergenic
1198150191 X:133900745-133900767 GAGAACATGGGCTGTAACTGAGG - Intronic
1200139482 X:153891975-153891997 GAGGTCCTGCTCTGTCACTCAGG + Intronic