ID: 1176264715

View in Genome Browser
Species Human (GRCh38)
Location 20:64203150-64203172
Sequence AGGCTGGGGCCGGAAGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 503}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176264704_1176264715 21 Left 1176264704 20:64203106-64203128 CCGCTCCACGCACTTGGGCTCAC 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1176264715 20:64203150-64203172 AGGCTGGGGCCGGAAGGTGCAGG 0: 1
1: 0
2: 2
3: 57
4: 503
1176264707_1176264715 -4 Left 1176264707 20:64203131-64203153 CCGTGTCTCACACCCTCTGAGGC 0: 1
1: 0
2: 0
3: 32
4: 292
Right 1176264715 20:64203150-64203172 AGGCTGGGGCCGGAAGGTGCAGG 0: 1
1: 0
2: 2
3: 57
4: 503
1176264701_1176264715 27 Left 1176264701 20:64203100-64203122 CCTTGTCCGCTCCACGCACTTGG 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1176264715 20:64203150-64203172 AGGCTGGGGCCGGAAGGTGCAGG 0: 1
1: 0
2: 2
3: 57
4: 503
1176264705_1176264715 16 Left 1176264705 20:64203111-64203133 CCACGCACTTGGGCTCACAGCCG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1176264715 20:64203150-64203172 AGGCTGGGGCCGGAAGGTGCAGG 0: 1
1: 0
2: 2
3: 57
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176264715 Original CRISPR AGGCTGGGGCCGGAAGGTGC AGG Intronic
900154140 1:1197377-1197399 AGGCTGGGGCTGGAGGGGGTGGG - Intronic
900322763 1:2093301-2093323 AGGCTGGGGCCAGGGGGTGAGGG - Intronic
900359838 1:2283174-2283196 AGGCTGGGTTCCGAGGGTGCCGG + Intronic
900520720 1:3104330-3104352 GGGGTGGGGTTGGAAGGTGCTGG + Intronic
900595156 1:3477111-3477133 AGGCCGGGAGCGGGAGGTGCCGG + Intronic
901036426 1:6338804-6338826 AGGCTGGGGACGGGAGGTGAGGG - Intronic
901109913 1:6785812-6785834 GGGCTGGGGCCGGAGGGGGCGGG + Intronic
901115977 1:6844434-6844456 AGGCTGAGGCAGGCAGATGCTGG + Intronic
901778450 1:11576637-11576659 AGGCTTGGGCCAGCAGGTGCTGG - Intergenic
902642155 1:17773996-17774018 AGACTGAGGCCAGATGGTGCAGG + Intronic
902642384 1:17775165-17775187 AGGCTGAGGCCAGATGGTGCAGG + Intronic
903329032 1:22587747-22587769 AGGCTGGGGCTGGGTGGTGATGG - Intronic
903576471 1:24342532-24342554 AGGCTGGGCCAGGTAAGTGCTGG + Intronic
903653806 1:24936703-24936725 TGGCTGGGCCCAGAAGCTGCTGG - Intronic
904042086 1:27591014-27591036 AGGCTGGGGCTGGGAGGTGGGGG - Intronic
904584409 1:31571981-31572003 AGGCTGGGGCCGGATCATGCAGG - Intergenic
904599426 1:31665489-31665511 AGGCTGGGGTAGGATGGTCCTGG - Intronic
904771904 1:32885659-32885681 AGGCTGGGGGCAGGAGGAGCTGG + Intergenic
904796249 1:33058433-33058455 AGGGTGGGGCTGGAGGGGGCAGG + Intronic
904811190 1:33164425-33164447 ACTCTGGGACTGGAAGGTGCCGG - Intronic
905655116 1:39682059-39682081 AGGCTGGGGCTGGAAGGGCCAGG + Exonic
905882489 1:41473890-41473912 AGAGTGGTGCAGGAAGGTGCTGG - Intergenic
905935127 1:41817387-41817409 AGGATGGGGCCGGATGGGGCAGG + Intronic
906105996 1:43293007-43293029 AGGCTGGGGCTGGAAGAGGCCGG - Intergenic
906296304 1:44651029-44651051 AGGGTGGGGCAGGGAGGTGGGGG + Exonic
907245500 1:53105937-53105959 AGTCTGGGGGCGGCAGGTGCTGG - Intronic
907488682 1:54794992-54795014 AGGCTGGGGCCAGGTGGGGCGGG - Intronic
909558072 1:76977473-76977495 AGGCTGGGGAAGGTAGGTGTAGG - Intronic
911024252 1:93420154-93420176 AGGCTGAGGCAGGGAGGTGGAGG + Intergenic
911087286 1:93989618-93989640 AGGCTGGTCCCGGATCGTGCAGG - Intergenic
911117751 1:94264352-94264374 AGTCTTGGGACAGAAGGTGCAGG - Intronic
912096997 1:106158174-106158196 AGGCTGAGGCAGGAAGATGAAGG - Intergenic
912354311 1:109042274-109042296 AAGCTGGGGCGGGGAGGGGCGGG + Intergenic
912521275 1:110246548-110246570 AGGCTGGGACCAGACGGTGAAGG - Intronic
913680593 1:121185194-121185216 GGGCTGGGGCGGGAAGGAGAGGG + Intronic
914032424 1:143972836-143972858 GGGCTGGGGCGGGAAGGAGAGGG + Intergenic
914157021 1:145095131-145095153 GGGCTGGGGCGGGAAGGAGAGGG - Intronic
915246243 1:154558308-154558330 TGGCTGGGGCCGGAGGGGCCGGG - Exonic
915316251 1:155030643-155030665 CGGCTGGGGCCAGCAGGTTCAGG + Exonic
915936947 1:160095217-160095239 ATGCTGGGCCCGGGAGGTGCTGG - Exonic
917243252 1:172972300-172972322 AGGTTGGGGCCAGAATGTGTGGG + Intergenic
919767608 1:201137248-201137270 AGGCTGAGGCTGGAAGGGGCAGG - Intronic
919780133 1:201216189-201216211 ACGGTGGGGCCGGGAGGGGCTGG + Intronic
919806065 1:201381697-201381719 AGGCTGGGCTGGGAAGGAGCTGG + Exonic
920051556 1:203167644-203167666 TGGCTGGGGCAGGGAGGTGGGGG - Intergenic
920201063 1:204259899-204259921 AGGCTGGAGCGAGAAGGTGAAGG - Intronic
920307685 1:205029663-205029685 AGGCTGGAGCTAGAAGGAGCAGG - Intergenic
920467902 1:206203720-206203742 GGGCTGGGGCGGGAAGGAGAGGG + Intronic
920685229 1:208104084-208104106 TGGCTGGGGCAGGAGGCTGCTGG + Intronic
921757236 1:218872890-218872912 AGGCTGGGGCCAGAGTGTGCAGG + Intergenic
921978378 1:221227656-221227678 AGGTTGGTGGCGGAAGGGGCTGG + Intergenic
922775703 1:228213393-228213415 GGGGCGGGGCCGGAGGGTGCAGG - Intronic
922790818 1:228309859-228309881 AGGCTTGGGCCCTAAGGTGGAGG + Intronic
922883122 1:228997690-228997712 AGGCAGGGGCCAGATGGTACAGG - Intergenic
923498508 1:234545168-234545190 AGGCTGGGGCAGGAGCGAGCGGG + Intergenic
924567414 1:245210254-245210276 AGGCTGAGGCCAGAGGCTGCGGG - Intronic
924855043 1:247867601-247867623 AGGCTGAGGCAGGGAGGTGGAGG + Intronic
1062954752 10:1532797-1532819 AGGCAGGAGCCTGAATGTGCAGG + Intronic
1065660286 10:27998939-27998961 AGGCTGGGAGCGGAAGGCGGCGG - Intronic
1066590258 10:36986933-36986955 AGGCTGGGGCCAGATTGTGAAGG - Intergenic
1067213644 10:44282129-44282151 TGGTTGGGGCCTGCAGGTGCTGG - Intergenic
1067947523 10:50699402-50699424 AGGCTGGGTGAGGAAGGGGCCGG - Intergenic
1069723676 10:70564528-70564550 AGGCTGAGGCCGAGAGGGGCCGG + Intronic
1070577521 10:77690533-77690555 AGGCTGGGGAGGGCAGGAGCGGG + Intergenic
1070919472 10:80175162-80175184 AGGCTGGGGCCGGGACGGGGAGG - Intronic
1071478363 10:86043532-86043554 AGGCTGGGGCCTGGAGGAGCAGG + Intronic
1072721312 10:97782615-97782637 AGGCTGTGGCCGGCTGGGGCAGG - Intergenic
1072835864 10:98711122-98711144 TGGCTGGAGCTGGAAGGTGCTGG + Intronic
1073079670 10:100851124-100851146 AGTCTGGGGCCTGAAGGAGAGGG - Intergenic
1074088365 10:110225928-110225950 AGGCAGGGGCGGGAGGGGGCGGG + Intronic
1074401841 10:113147895-113147917 AGGTTAGGGCCTCAAGGTGCGGG + Intronic
1074471432 10:113730428-113730450 AGGCCTGGGCAGTAAGGTGCTGG - Exonic
1074867471 10:117553379-117553401 GGGCGCGGGCCGGAAGCTGCGGG - Intergenic
1076544406 10:131235099-131235121 AGGCAGGGTCCTGCAGGTGCAGG + Intronic
1076684331 10:132190309-132190331 AGGCTGGGAGCGGACGGAGCTGG - Intronic
1076727708 10:132421247-132421269 GGGCCGGGGCCGCAGGGTGCAGG - Intergenic
1076836534 10:133023855-133023877 ACCCTGGGGCTGGAAGGAGCAGG - Intergenic
1076836596 10:133024079-133024101 ACCCTGGGGCTGGAAGGAGCAGG - Intergenic
1076995754 11:296797-296819 AGCCTGAGGCAGGGAGGTGCTGG + Intergenic
1077080214 11:721704-721726 GGGACGGGGCCGGCAGGTGCAGG + Intronic
1077145217 11:1041527-1041549 AGGCTGGGGCCCTCAGGAGCGGG + Intergenic
1077228308 11:1447886-1447908 TGTCTGGGGCTGGGAGGTGCGGG - Intronic
1077338836 11:2017135-2017157 TGGCTGGGGAGGGAAGATGCAGG + Intergenic
1077893332 11:6435546-6435568 AGGCTGAGCCCGGAAGGTCGAGG - Intronic
1078066322 11:8081453-8081475 AGGCCGGGGCCCGGAGGGGCCGG - Intronic
1078422658 11:11224886-11224908 GGGCTGGGGCAGGCAGGAGCAGG - Intergenic
1082834114 11:57639545-57639567 GGGCAGGGGCCGGAAGATGGTGG + Intergenic
1083264899 11:61542162-61542184 AGGCTGGGTCAGGGAGGTGGGGG + Intronic
1083546255 11:63551099-63551121 AGGATGGGGGCGGGAGGGGCGGG + Intergenic
1083666420 11:64277305-64277327 AGGCTGAGGCCTACAGGTGCCGG - Intronic
1083932312 11:65852795-65852817 AGGCTGGGGCTGGGGGCTGCGGG - Intronic
1083961458 11:66017030-66017052 AGGCAGGAGCGGGAAGGGGCCGG - Intronic
1084329575 11:68422801-68422823 AGGGTGGGTAGGGAAGGTGCGGG - Intronic
1084515826 11:69637563-69637585 GGGCTGGGGCCGGAAGGCCAGGG + Intergenic
1084599648 11:70137336-70137358 AGGCAGGGGCAGGCAGGGGCAGG - Intronic
1084599652 11:70137346-70137368 AGGCAGGGGCAGGCAGGGGCAGG - Intronic
1084658957 11:70536059-70536081 TGGCTGGGGCCTGGGGGTGCAGG - Intronic
1084714962 11:70867845-70867867 AGGCGGGGGCCGGCCGGTGCAGG - Intronic
1084950400 11:72662144-72662166 AAGCTGGGGCAGGGAGGTGCCGG + Intronic
1085055550 11:73401494-73401516 AGGCTGGGGTCTGGAGATGCTGG + Intronic
1085306142 11:75487125-75487147 AGGCTGGGGCCGGAGAGCACAGG - Intronic
1085897828 11:80661134-80661156 AGGCTGGGGCCAGATTGTGAAGG + Intergenic
1088199693 11:107318759-107318781 AGGCTGAGGCAGGGAGGTGGAGG - Intergenic
1089339991 11:117750823-117750845 GGGCTGGGGCTGGATGGTCCTGG - Intronic
1089351673 11:117824883-117824905 AGGCAGGGGCAGGGAGGAGCTGG + Intronic
1089775788 11:120834877-120834899 AGGCTGGGGGCAGAGGGTCCGGG - Intronic
1090616876 11:128522596-128522618 AGGCAGGGGCGGGAAGGGCCGGG + Intronic
1091268617 11:134289985-134290007 AGGCCGGGGCGGGAAGGAGAGGG + Intronic
1202821820 11_KI270721v1_random:72317-72339 TGGCTGGGGAGGGAAGATGCAGG + Intergenic
1091776258 12:3186834-3186856 AGGAGGGGGCAGGATGGTGCTGG + Intronic
1091837494 12:3595944-3595966 AGGCTGGAGCCTGCAGGTCCTGG - Intergenic
1095646748 12:44556937-44556959 AGGTTGGGGCCAGATGGTGAAGG + Intronic
1096196494 12:49652008-49652030 GGGCTGGAGCCAGAAGGTCCAGG + Exonic
1096628805 12:52912336-52912358 AGGCTGGGGCTGGGAGGAGTGGG - Intronic
1097199401 12:57265702-57265724 AGGCTGAGGCTGTAAGGAGCTGG - Intronic
1097265948 12:57745008-57745030 AGGCAGGGGAGGGACGGTGCAGG + Exonic
1097560530 12:61199371-61199393 GGGCTGGGGCAGGAGGGTGAGGG + Intergenic
1098197062 12:68013293-68013315 AGGTTGGGGCTGCAAGGTGAAGG + Intergenic
1100300054 12:93298520-93298542 AGGCTGGGACGGGTAGGTGGGGG + Intergenic
1100341486 12:93683649-93683671 AGGCTGGCGCCACAAGGGGCAGG - Intronic
1101504170 12:105330952-105330974 AGGCGGGGGCCGGCGGGGGCGGG + Intronic
1101824626 12:108210421-108210443 AGGCAGGGGCAGGACGGTGGTGG - Intronic
1102044827 12:109823172-109823194 AGGCTGGCCAGGGAAGGTGCTGG - Intronic
1102083554 12:110117465-110117487 AGGCTGAGGCCGGGAGGTACAGG + Intergenic
1102482775 12:113235181-113235203 AAGCTGGGGCTGGAGGGTGGAGG + Intronic
1102643291 12:114385381-114385403 AGGCTGGTGGAGGGAGGTGCTGG + Intronic
1103243023 12:119430770-119430792 AGGCTGGAAGCTGAAGGTGCAGG - Intronic
1103253253 12:119519211-119519233 AGGCTGGGGGCTGGATGTGCTGG - Intronic
1103687580 12:122744259-122744281 AGGCTGGGACCGAAAGGTTGAGG + Intergenic
1103920123 12:124395033-124395055 AGGCTGGGGTCCGAAGGCCCTGG + Intronic
1104039745 12:125122058-125122080 GGGCTGAGGCCGAAAGGTTCAGG + Intronic
1104892876 12:132148759-132148781 GGGCGGGGGCCGGCAGGTGGGGG - Intronic
1105407731 13:20145715-20145737 AGGCAGTGGCCGGACGGAGCGGG - Intronic
1106788119 13:33127491-33127513 ATGCTGGGGCCGGCCGGGGCTGG + Exonic
1108029245 13:46211850-46211872 AGGCGGGCGCCGGGAGGGGCAGG - Intronic
1109527464 13:63595936-63595958 AGGCTGGGGCGGGACGTCGCTGG - Intergenic
1112181973 13:97091924-97091946 AGGCTGGGGAGGGAAGGAGGAGG + Intergenic
1112368071 13:98772602-98772624 AGGCTGGGGCCGGAAGGGATGGG + Intergenic
1113085651 13:106567488-106567510 GGGCCGGGGCGGGACGGTGCGGG - Intronic
1113231201 13:108215519-108215541 AAGCTGGCGCCAGAAGATGCCGG + Exonic
1113694362 13:112333305-112333327 AGGCAGGGGCTGGGAGGGGCAGG - Intergenic
1113759969 13:112840355-112840377 AGGCTGAGGCTGGAAGGCACGGG - Intronic
1113928662 13:113954748-113954770 AGGCCAGGGCAGGAAGGGGCTGG + Intergenic
1114423009 14:22600317-22600339 AAGCTGAGGCTGGAAGGTTCAGG + Intronic
1118540105 14:66813965-66813987 AGGCTGGGGAGGGAGCGTGCAGG - Intronic
1118745026 14:68767416-68767438 GGGCTGGGGCATGAAGGTACTGG - Intergenic
1119649270 14:76372159-76372181 AGGCTGGGGTGGGAAAGGGCGGG + Intronic
1122552726 14:102558759-102558781 AGGCAGGGCCCTGAGGGTGCAGG - Intergenic
1122623127 14:103070933-103070955 GGGCTGGTGCAGGAAGGAGCTGG + Intergenic
1122856039 14:104560733-104560755 AGGCTGGGGCAGGGGGGTGAGGG - Intronic
1122905652 14:104800478-104800500 GGGCGGGGGCCGGAGGGGGCGGG - Intergenic
1122981227 14:105193173-105193195 AGGCGGGTGCCGGCAGGAGCAGG - Intergenic
1123412892 15:20074002-20074024 GGGCTGGGGCTGGTAGGTGTTGG + Intergenic
1123522234 15:21081115-21081137 GGGCTGGGGCTGGTAGGTGTTGG + Intergenic
1124008141 15:25810979-25811001 AAGCTGGGGCTGGAAGGAGGCGG + Intronic
1124405053 15:29384753-29384775 AGGCTGGGGCCGGGAGGGCTGGG - Intronic
1124721957 15:32118155-32118177 GGGGAGGGGCCTGAAGGTGCTGG - Intronic
1125510125 15:40288290-40288312 AGCCTGGGGCAGGAGGGTTCGGG + Exonic
1125673066 15:41487197-41487219 AGGCTGGGGCTGGGAGCTGAGGG + Intergenic
1127599619 15:60522471-60522493 AGGCTGAGGCAGGAAGGTGATGG + Intronic
1128139264 15:65287032-65287054 TGGCTGGGGCGCGAAGGGGCGGG - Intronic
1128144819 15:65327204-65327226 CGGCTGGGGCAGGAGGGGGCTGG - Exonic
1128570475 15:68729952-68729974 GGGCGGGGGCCGGGAGGTGGGGG - Intergenic
1129286926 15:74532971-74532993 AGGCAGGACCCGGAAGGTGGAGG + Intergenic
1129670951 15:77607432-77607454 AGGCTGGGGTAGGAAGGAGCTGG + Intergenic
1129854043 15:78811548-78811570 AGGCCGGGGCCGGCCGGGGCGGG - Intronic
1129975029 15:79814989-79815011 AGGCTGGGAACAGAGGGTGCAGG - Intergenic
1130971967 15:88740685-88740707 AGGCTGGGGTTGGAGGGTGGAGG - Intergenic
1132256595 15:100381809-100381831 TGGCTGGGCCTGGAAGCTGCTGG - Intergenic
1132584323 16:699772-699794 AGGCTGTGGCAGGAGGGGGCAGG - Intronic
1132670985 16:1102251-1102273 AGCCAGGGGACGGGAGGTGCTGG + Intergenic
1133309865 16:4838004-4838026 AAGATGGGGCCAGAAGGTGTGGG + Intronic
1133882678 16:9797816-9797838 AGGCCAGGGCCAGAAGATGCAGG - Intronic
1134507901 16:14823028-14823050 AGGCTGGTGGCGGCAGGTTCAGG + Intronic
1134544066 16:15094275-15094297 AGGCTGTGGCTGGAAGGAGCTGG - Exonic
1134695602 16:16221791-16221813 AGGCTGGTGGCGGCAGGTTCAGG + Exonic
1134976227 16:18572895-18572917 AGGCTGGTGGCGGCAGGTTCAGG - Intergenic
1135281883 16:21159381-21159403 AGGCTGGGCCCGGATGGGGAGGG + Exonic
1135361637 16:21820426-21820448 AGGCTGTGGCTGGAAGGAGCTGG - Intergenic
1135753169 16:25073393-25073415 TTGCTGGGGCCGGAGGGTGAGGG - Intergenic
1136260896 16:29074969-29074991 AGGCTGTGGCTGGAAGGAGCTGG + Intergenic
1136428345 16:30183729-30183751 AGGCTGGGCCTGGGAGGCGCGGG + Intronic
1136508683 16:30722706-30722728 AGGCTGAGGCCAGTAGGGGCAGG - Exonic
1137247950 16:46720775-46720797 ATCCTGGGGCCAGGAGGTGCTGG - Intronic
1137375666 16:47949808-47949830 AGGAGAGGGCAGGAAGGTGCCGG - Intergenic
1137563787 16:49520748-49520770 AAGCTGGGGCTGGAAGGCCCTGG - Intronic
1137574763 16:49591897-49591919 GGGCTGGGACAGGAAGGTGCAGG + Intronic
1138339446 16:56279120-56279142 TGGCTGGCCCCGGCAGGTGCTGG - Intronic
1138356794 16:56387932-56387954 AGGGTGGGGCAGGAGGGTGGAGG - Intronic
1139544777 16:67645069-67645091 AGGCCGGGGCGGGGAGGGGCCGG + Exonic
1139778281 16:69330596-69330618 GCGCTGCGGCCGGAAGGGGCGGG - Intronic
1139851474 16:69953281-69953303 AGGCTGGGGCCAGGAGCTGGGGG - Intronic
1139880450 16:70176193-70176215 AGGCTGGGGCCAGGAGCTGGGGG - Intronic
1140219892 16:73036178-73036200 GGGCTGCGGGAGGAAGGTGCAGG + Intronic
1140372060 16:74419324-74419346 AGGCTGGGGCCAGGAGCTGGGGG + Intronic
1140374187 16:74431599-74431621 ATGCAGGGCCCGGAAGATGCTGG - Intergenic
1140476737 16:75242770-75242792 TGGCTGGGGCTGGTAGGTGTTGG + Exonic
1141272087 16:82550138-82550160 GGGGTGGGGGCGGAAGGAGCAGG + Intergenic
1141558897 16:84853849-84853871 AGGCTGGGGCTGGAGGAGGCTGG + Intronic
1141638889 16:85329818-85329840 AGGCTGGGGACGGGAGGGGAGGG + Intergenic
1141692631 16:85605207-85605229 AGCCAGGGGCCGGCAGGGGCTGG + Intergenic
1141803634 16:86327835-86327857 AGGCTGAGGCAGGAAATTGCTGG - Intergenic
1141834955 16:86532364-86532386 AGCCTGGTTCCGGAAGGTGCTGG + Exonic
1142002639 16:87672169-87672191 AGGCTGTGGCCTGTAGGTGAGGG + Intronic
1142287178 16:89176218-89176240 AGGCAGGGGCCGGGACGTGGGGG - Intronic
1142480397 17:215236-215258 GGGCTGGGCCCAGCAGGTGCAGG + Intronic
1142556539 17:782139-782161 AGGCCGGGGCCGACAGGGGCTGG - Intronic
1142684877 17:1571973-1571995 AGGCTCTGGCGGGAAGGAGCAGG - Intronic
1142693770 17:1622142-1622164 AGGCTGGGGCCGGCAGCCTCAGG - Intronic
1143001592 17:3798319-3798341 ATGCTGGGCCCTGGAGGTGCGGG - Intronic
1143591428 17:7887734-7887756 AGGCGGGGGCCGGAGGGCGCAGG - Intronic
1143874619 17:9982132-9982154 AGGCTGGGGCCAGAAGGAGATGG + Intronic
1143984007 17:10895493-10895515 AGCCTGAGGCCTGAAGGTGGTGG - Intergenic
1145281193 17:21468240-21468262 GGGCGGGGGCAGGAAAGTGCTGG - Intergenic
1145396133 17:22496510-22496532 AGGCGGGGGCAGGAAAGTGCTGG + Intergenic
1145976257 17:28986050-28986072 GGGCTGGGGGCGGCAGGCGCTGG - Intronic
1146322675 17:31859039-31859061 AGCCTGGGGCGGGAAGTCGCGGG - Intronic
1146472857 17:33138600-33138622 AAGGTGGGGCAGGAAGGGGCTGG - Intronic
1147360390 17:39926656-39926678 AGGGTGGGGCGGGAAGGAGGGGG - Exonic
1147661900 17:42121235-42121257 GGGCTGGGGACTGAAGGGGCCGG + Exonic
1148142391 17:45338132-45338154 AGGCTGGTGACGGGAGCTGCAGG - Intergenic
1148229163 17:45920489-45920511 ATGCTGGGGCCGGAGGGTCAAGG - Intronic
1150134800 17:62689813-62689835 AGGCGGGGGCAGGAAGGGGCAGG - Intronic
1150483599 17:65529205-65529227 AACCTGGGGCCCGAAGGAGCAGG + Exonic
1151231335 17:72687337-72687359 AGGCAGGAGCCGGAAGGCGGAGG - Intronic
1151318618 17:73338995-73339017 TGGTTGGGGCCGGAAGGCACAGG + Intronic
1151325845 17:73379415-73379437 ATGCTGGGGCCGGACAGGGCGGG + Intronic
1151350025 17:73526228-73526250 ATGATGGGGCTGGAGGGTGCAGG + Intronic
1152073984 17:78147553-78147575 AGGATGGGGCAAGAAAGTGCAGG - Intronic
1152127974 17:78458842-78458864 AGGCAGGGGCCAGATGGTGCCGG - Intronic
1152632062 17:81414788-81414810 AGGCTGGGGGCGGAGGCGGCAGG + Intronic
1152695266 17:81741020-81741042 AGGCTGGGGGAGGGAGGGGCTGG - Intergenic
1152722538 17:81929958-81929980 AGCCTGGGGCGGGAGGATGCCGG - Intergenic
1152722556 17:81930017-81930039 AGCCTGGGGCGGGAGGATGCCGG - Intergenic
1153265110 18:3262151-3262173 AGGCTGTGGCCGGACAGTGGCGG - Intronic
1153281162 18:3415548-3415570 AGGCTGGAGCTGGAGGGTCCTGG - Intronic
1153871020 18:9320243-9320265 AGGCTGGAGCTGGAAGGGGGAGG - Intergenic
1154216764 18:12421172-12421194 AGGCTGGGGGCAGCAGGTGCAGG - Intronic
1154502486 18:15003713-15003735 GGGCTGGGCCCTGCAGGTGCTGG - Intergenic
1155098479 18:22584168-22584190 AGGCAGGGGCCTGATGGGGCAGG - Intergenic
1157232302 18:45929171-45929193 ACTCTGAGGCCGAAAGGTGCAGG + Intronic
1157557144 18:48620288-48620310 AGACTGAGGCAGGAGGGTGCAGG - Intronic
1157568953 18:48699431-48699453 GGGCTGGAGCCGGGTGGTGCAGG + Intronic
1160497748 18:79385063-79385085 AGGCTGGGGCCGTCTGGTGCCGG - Intergenic
1160878821 19:1310455-1310477 AGGCTGGGGGTGGAAGGGGATGG + Intergenic
1160954531 19:1684436-1684458 AGGCTGAGTCCGGGAGGTGGAGG - Intergenic
1161085446 19:2332979-2333001 AGGGTGGGGATGGCAGGTGCGGG + Intronic
1161085484 19:2333100-2333122 AGGGTGGGGATGGCAGGTGCAGG + Intronic
1161085505 19:2333161-2333183 AGGGTGGGGATGGCAGGTGCGGG + Intronic
1161085523 19:2333221-2333243 AGGGTGGGGATGGCAGGTGCGGG + Intronic
1161216417 19:3097032-3097054 GGGCTGGGGCCTCAGGGTGCAGG + Intronic
1161585044 19:5101485-5101507 AGGCTGGAGCTGGAATGTGGTGG - Intronic
1162242076 19:9363168-9363190 AGGCTGGGGCGGGAAGCTGCAGG - Intronic
1162381480 19:10334265-10334287 AGGCTCCAGCCGGGAGGTGCCGG - Exonic
1162403810 19:10461688-10461710 GGGCTGGGGCGGGACGGAGCGGG + Intronic
1162475291 19:10896045-10896067 GGGCTGGTTCCGGAAGGTGCTGG + Intronic
1162647637 19:12061505-12061527 AGGCTGGGGCAGTGAGGTGGAGG + Intergenic
1162741289 19:12775298-12775320 GTGCTGGGGCTGGGAGGTGCGGG - Intronic
1163574819 19:18104510-18104532 TGGAGGGGGCCGGAAGCTGCTGG - Intronic
1163679498 19:18672487-18672509 GTGCTGGGGCGGGAAGGTGAGGG + Intergenic
1163826030 19:19525532-19525554 AGACTGGGGCTGGAAGGATCTGG + Intronic
1164532446 19:29058655-29058677 AGGCAGGGGTCAGCAGGTGCTGG + Intergenic
1165122893 19:33573601-33573623 GGGCTGGGGCAGGAAGGTATGGG + Intergenic
1165340137 19:35205504-35205526 AGGCGGGGGAGGGAAGGGGCAGG + Intergenic
1165359895 19:35329730-35329752 AGGTTGTGGCTGGAGGGTGCTGG + Intronic
1165882518 19:39053790-39053812 AGGGTGGGGTGGGAAGGAGCAGG - Intergenic
1166382265 19:42361274-42361296 AGGCTGAGACCGGAAGCTGGAGG + Intronic
1166856054 19:45783092-45783114 AGGCTGGGGGAGGAAAGTGGTGG + Exonic
1167019218 19:46861426-46861448 GGGCTGGGGCGGGCAGGGGCAGG - Intergenic
928654827 2:33439756-33439778 AGGCTGGGTTCAGAAGGTGGTGG + Intronic
929165249 2:38875524-38875546 AGGTTGGGGCCGGGGGGGGCGGG - Intronic
929779747 2:44949894-44949916 CAGCTGGGGCCGGAAAGGGCCGG - Intergenic
931204781 2:60136664-60136686 AGGCTGGGGCTTCATGGTGCTGG - Intergenic
931668622 2:64627429-64627451 AGGCTGGAGGCGGAAGGGGGAGG - Intergenic
932767860 2:74482593-74482615 AGGCGGGGGCCCGCAGGTGGCGG - Exonic
933772505 2:85753489-85753511 AGGGAGCGGCGGGAAGGTGCCGG + Intronic
934675774 2:96248766-96248788 AGAATGGGGCCTGAAGGTGCAGG - Exonic
935112676 2:100106553-100106575 AGGCTGGGGGTGGAGGGTGGAGG + Intronic
935225467 2:101048370-101048392 AGCCTGGGGCTGAGAGGTGCAGG + Intronic
936505669 2:113103770-113103792 AGGGTGGGGTGGGAAGGTGATGG + Intergenic
937214164 2:120300460-120300482 AGGCTGGGGCGGAAGGGTGTTGG - Intergenic
937242999 2:120474519-120474541 AGGCTGGGACTGGTAGGTGACGG + Intergenic
937244792 2:120485684-120485706 ATGCTGGGGCTGGGAGCTGCAGG - Intergenic
937280795 2:120716046-120716068 AGGCTGGGGCCTGGTGCTGCTGG - Intergenic
937869111 2:126775186-126775208 AGGCTGGCTCCAGAATGTGCTGG - Intergenic
937895838 2:126976395-126976417 TGGCTGGGGCCCGAAAGGGCTGG - Intergenic
937915277 2:127095866-127095888 CGGCTGGGTCTGGAAGGTTCAGG - Intronic
938378322 2:130823026-130823048 GAGCTGAGGCCTGAAGGTGCCGG - Intergenic
939629107 2:144513592-144513614 AGGCTGATGCTGGAAGGTGGCGG + Intronic
941797087 2:169611104-169611126 AGGCTGAGGCAGGAAGGTGGAGG + Intronic
941959476 2:171239483-171239505 AGGCTGAGGCAGGAAGATCCTGG - Intergenic
943702036 2:190997042-190997064 ATGCTGGAGCCTGATGGTGCAGG - Intronic
944310292 2:198225511-198225533 AGGCTGGGGGCAAAAGGTACAGG + Intronic
944889740 2:204105024-204105046 AGGCTGGAGCTGGAGGTTGCTGG + Intergenic
946243337 2:218370389-218370411 AGGCTGGAGCATGAAGGGGCAGG + Intergenic
946784420 2:223227341-223227363 AGGCTGGGGATAGAAGCTGCAGG + Intergenic
946836732 2:223780125-223780147 AGGCTGGGGCCAGGGGGTGGTGG - Intronic
947541862 2:230985412-230985434 AGGCTGGGCAGGGCAGGTGCTGG + Intergenic
947624554 2:231611636-231611658 AGGCTGGGGCAGGATGGCTCTGG + Intergenic
947743685 2:232496879-232496901 AGGCTGGGGGCGGTGGGTGGTGG - Intergenic
948717966 2:239877868-239877890 AGGCTGTGGTGGGAAGGTGGGGG - Intergenic
948771147 2:240251817-240251839 GAGCTGGGGCGGGAAGGTGCAGG - Intergenic
948835158 2:240622843-240622865 AGGCTGGGGGCGGAGGGCCCCGG + Intronic
948874712 2:240820376-240820398 GGGCTGGGGACGGAGGGGGCCGG + Intergenic
948931414 2:241134828-241134850 AGGCTGGGGCCCAAGGGTCCAGG - Intronic
1168790325 20:571953-571975 TGGCTGGGCCAGGAATGTGCCGG - Intergenic
1169539564 20:6584165-6584187 AGGTGGGGGCCAGGAGGTGCAGG - Intergenic
1169784986 20:9350038-9350060 AATCTGGGGTCGGCAGGTGCAGG + Intronic
1170394473 20:15911179-15911201 ACTCTGGGACCGGGAGGTGCAGG + Intronic
1170949845 20:20926615-20926637 AGGGCTGGGCCGGAAGGTCCAGG - Intergenic
1171406372 20:24914842-24914864 AGGATGGGAGGGGAAGGTGCAGG - Intergenic
1171442799 20:25178997-25179019 AGCCTGAGGCAGGAGGGTGCTGG - Intergenic
1171459205 20:25289091-25289113 AGGCCGGGGCCTGGGGGTGCTGG + Intronic
1172093046 20:32447032-32447054 GGGCTGGGGCCAGTAGGGGCAGG - Exonic
1172116963 20:32578848-32578870 AGCATGGGGCGGGAAGGTCCTGG - Intronic
1172587986 20:36098163-36098185 AGCCTGGCCCTGGAAGGTGCAGG + Intronic
1173664334 20:44754174-44754196 AGGCTGGGGGTGGAAGGAGCAGG - Intronic
1174136534 20:48384305-48384327 AGGGTGGGGGCGGAAGGGGCGGG - Intergenic
1174290910 20:49507857-49507879 AGGCTGGGGCAGGCTGGGGCAGG + Exonic
1175076817 20:56382343-56382365 TGGCTGGGGCTGGGAGGGGCAGG - Intronic
1175384087 20:58583181-58583203 AGGCTGGGGCCAGCAGGGCCGGG + Intergenic
1175470377 20:59222988-59223010 AGGCTGGGGTCGTCTGGTGCGGG - Intronic
1175809130 20:61848167-61848189 GGGCTGGGGCCTGCAGGTGTGGG - Intronic
1175868179 20:62192571-62192593 GGGGTGGGGCCGAAAGGTCCAGG + Intronic
1175943946 20:62550213-62550235 AGGGAGGGGCCGGGAGGGGCAGG + Intergenic
1175997139 20:62816964-62816986 AGGCGGGGGCGGGAAGGGGAAGG + Intronic
1176264715 20:64203150-64203172 AGGCTGGGGCCGGAAGGTGCAGG + Intronic
1176302751 21:5106345-5106367 AGCCTGTGGCCGGCAGGAGCCGG - Intergenic
1177288915 21:19085117-19085139 AGGCTGAGGCAGGAAGGAGGTGG - Intergenic
1177380998 21:20344131-20344153 AGGCTGAGGCAGGGAGGTGGAGG + Intergenic
1179048720 21:37870220-37870242 TGGCTGGGGCCGGGGGGTGGGGG - Intronic
1179585226 21:42370313-42370335 AGGCTGGGGCAGGGGGGTGAGGG - Intergenic
1179854273 21:44155578-44155600 AGCCTGTGGCCGGCAGGAGCCGG + Intergenic
1179932984 21:44583218-44583240 TGGCTGGGGGAGGGAGGTGCTGG + Intronic
1180014382 21:45073247-45073269 AGGCTGGGGCTGGGCGGTGGGGG - Intergenic
1180048905 21:45322415-45322437 AGGATGGGGTAGGCAGGTGCAGG - Intergenic
1180096436 21:45557401-45557423 AGGCTGGGGCCACAAGGCACAGG - Intergenic
1180258794 21:46651786-46651808 AGCCTGGGGACGGAAAGTGAAGG - Intronic
1181029689 22:20143755-20143777 AGGTGGGTGCCGGGAGGTGCGGG + Exonic
1181031111 22:20149269-20149291 AGGCTGGGGGTGGAGGGTGTGGG - Intronic
1181534286 22:23533708-23533730 AGGATGGGGAGGGAGGGTGCAGG + Intergenic
1182518090 22:30870250-30870272 AGGCTGGGCCAGGATGGGGCAGG + Intronic
1183007112 22:34912663-34912685 AGGGTGGGGCTAGAATGTGCTGG + Intergenic
1183345336 22:37304317-37304339 AGGGTGGGGCCAGAGGGTCCAGG + Intronic
1183442264 22:37830020-37830042 AGGCAGGGGCAGGAGGGAGCGGG - Intergenic
1183484733 22:38082807-38082829 CGGCTGGGGCTGGGTGGTGCTGG - Exonic
1183708865 22:39491015-39491037 CGGCTGGGGCCGAGAGGGGCTGG - Exonic
1184274902 22:43404631-43404653 AGGCTGGGGCAGGCACCTGCTGG + Intergenic
1185077166 22:48689728-48689750 GGGCTGGGGCCAGACTGTGCAGG + Intronic
1185088915 22:48755269-48755291 AGGCTGGGGCTGGGGGCTGCTGG - Intronic
1185205779 22:49537455-49537477 AGGCTGGGGCCGCAGGGGGAAGG - Intronic
1185212075 22:49575957-49575979 AGGCTGTGGCCGGAGGCTTCAGG - Intronic
1185340529 22:50288928-50288950 AGGCTGGGGCGGGGAGGCTCTGG - Intronic
1185389028 22:50548994-50549016 CGGCCGGGGCCGGGCGGTGCTGG + Exonic
949655780 3:6217355-6217377 AGGCTGGGGCAGGAAAATGGTGG - Intergenic
950220505 3:11191811-11191833 GGGCTGGGCCAGGAATGTGCAGG - Intronic
951872710 3:27382771-27382793 GGGCTGGGGTCGGTGGGTGCTGG - Intronic
952877393 3:37957766-37957788 TGGCTGGTGCAGGACGGTGCTGG - Intronic
953463256 3:43098033-43098055 AGCCTGGGTCTGGCAGGTGCTGG - Intronic
953833918 3:46326929-46326951 AGGCAGGGGTCACAAGGTGCTGG + Intergenic
954317284 3:49807981-49808003 AGGCTTGGGCCTGGAGGTGGAGG - Intronic
954370510 3:50167533-50167555 GGGCTGGGGCCAGCAGGTCCAGG - Intronic
954404448 3:50337638-50337660 AGGCGAGGGCGGGAAGGTGCGGG + Intronic
954440816 3:50521077-50521099 AGGCTGGGGCAGGAAGCAGCTGG + Intergenic
954579696 3:51696595-51696617 GGGCTGGGGATGGAAGGTGAGGG - Intronic
954681845 3:52350169-52350191 GGGCTGGGGCAGGCAGGGGCTGG + Intronic
954847018 3:53568388-53568410 AGAGTGAGGCTGGAAGGTGCTGG - Intronic
955214622 3:56974747-56974769 AGGCTGTGACCTGGAGGTGCAGG - Intronic
955663477 3:61326109-61326131 ATGCTGGGGAGGGAAGGTGGTGG - Intergenic
955985772 3:64572755-64572777 TGGGTGGGGCTGGAAGATGCAGG + Intronic
956735345 3:72233626-72233648 AGGAGGGGGCAGGAAAGTGCTGG - Intergenic
960046127 3:113200321-113200343 AGGCAGGGGCAGGCAGGGGCAGG - Intergenic
960605294 3:119498573-119498595 AGGCCGGGGACTGAAGGTGTGGG + Exonic
960665990 3:120109319-120109341 AGGCTGGGGCAGGTAGTTGCAGG - Intergenic
960666279 3:120112088-120112110 AGGCTGGGGCCTGCAGGTAGAGG - Intergenic
961424739 3:126836171-126836193 AGGCTGGGGCCTAACGGCGCAGG - Intronic
961448665 3:126992624-126992646 GGGCTGGGGGCGGGGGGTGCTGG + Intronic
961467259 3:127089398-127089420 AGGGTGGGGCAGGCAGGAGCTGG - Intergenic
961491200 3:127257847-127257869 AGGCTGGGGGCTGATGGGGCAGG - Intergenic
962597248 3:136959155-136959177 AGGGTGGGGCCTGAATATGCTGG - Intronic
962653197 3:137516841-137516863 AGGCAGGGGCTGGAAGGGGCAGG + Intergenic
963103433 3:141625719-141625741 AGGCCTGGGCCTGGAGGTGCAGG - Intergenic
964636709 3:158865873-158865895 AGGCTGGGGCTGGATGCTTCAGG - Intergenic
964850972 3:161095718-161095740 AGGCTGGGGGCAGCAGGAGCAGG + Intronic
965757576 3:172040735-172040757 GGGCTGGGGCCGGCAGGCGTGGG + Intronic
966911309 3:184561918-184561940 GGGCCGGGGCAGGAGGGTGCAGG - Exonic
966925665 3:184643072-184643094 AGCCTGGGGCCTGAAAGTGTGGG - Intronic
968067190 3:195765152-195765174 AGGCTGGGGCTGCCAGGGGCGGG + Intronic
968092774 3:195908993-195909015 AGGGAGGGGCCGGAAAGTTCCGG - Intronic
968293555 3:197556230-197556252 GGGCTGAGGCCGGAGGGTGAAGG + Intronic
968611106 4:1557555-1557577 TGGGTGGGGCCGGGCGGTGCAGG - Intergenic
968887063 4:3340748-3340770 AGGCAGGTGCAGGCAGGTGCAGG + Intronic
968947047 4:3670612-3670634 AGGCGGGGGCAGGAAAGTGGAGG + Intergenic
969338641 4:6527044-6527066 AGGCTGGTGTCGGGAGCTGCAGG + Intronic
969348930 4:6586932-6586954 AGGATGGGGCCGGGAGGCACAGG + Intronic
969450053 4:7267983-7268005 AAGCTGGAGCCGGAAGATGCAGG + Intronic
969498629 4:7540139-7540161 AGGCAGGGGCGGGGAGGGGCAGG - Intronic
969498656 4:7540195-7540217 AGGCAGGGGCAGGGAGGGGCAGG - Intronic
969661079 4:8528233-8528255 AGGCTGAGGCAGGAAGATCCTGG - Intergenic
970887877 4:21007557-21007579 AGGCTGGGAAGGGAAGTTGCTGG - Intronic
973896521 4:55419221-55419243 AGGCTGAGGCAGGAAGTTTCAGG - Intronic
981914773 4:150021940-150021962 AGGATGGGGCCATATGGTGCAGG - Intergenic
982137261 4:152283432-152283454 ACACTGGGGCCTGCAGGTGCAGG - Intergenic
982253153 4:153427524-153427546 ATACTGGGGCCAGAAGGTGCAGG - Intergenic
982468340 4:155758852-155758874 AGGCGGGGGCGGGAAGGCACTGG + Intergenic
983359337 4:166708844-166708866 AGGCAGGGGTCACAAGGTGCAGG + Intergenic
984756673 4:183331346-183331368 AGGCTGGGGGCCGCAGGTCCCGG - Intergenic
985538210 5:475959-475981 GGGCTGGGGCTGGGAGGTGGTGG + Intronic
985544772 5:504183-504205 CGCCTGGGGAGGGAAGGTGCCGG + Intronic
986068181 5:4256278-4256300 AGGATGGCCCTGGAAGGTGCTGG - Intergenic
986264806 5:6182445-6182467 AGGCTGGGGCAGGAGCGTCCAGG - Intergenic
987099837 5:14581962-14581984 AGCCTGGGGCCGGGCGGGGCGGG + Intronic
991707211 5:69369543-69369565 AGGGAGGAGCCGGAAGGGGCGGG + Exonic
992527965 5:77630154-77630176 AGGCCGGGGCGGGACGGGGCAGG + Exonic
993060791 5:83036449-83036471 GGGCGGGGGCAGGAAGGGGCGGG + Intergenic
994092068 5:95818384-95818406 AGGCTGGGACGGGAAGGGACAGG - Intronic
995590189 5:113691643-113691665 AGCATGGGGTGGGAAGGTGCTGG - Intergenic
997211712 5:132080804-132080826 AGGCTGGGGCAGGGAAGTGGAGG - Intergenic
997247322 5:132360843-132360865 AGGCTGCGGCAGGAAGATGCTGG - Intergenic
997615179 5:135241145-135241167 GGGGTGGGGCCGGCAGGTGGTGG + Intronic
997906565 5:137822995-137823017 AGGCTGGGGCTGGAAAGTAGAGG - Intergenic
997996464 5:138590719-138590741 AGGCTGAGGCAGGAGGGTTCCGG - Intergenic
998053210 5:139053578-139053600 AGGCTGGGGCCAGATACTGCAGG - Intronic
999177839 5:149644101-149644123 AGGCTGGGGCCAGATGCTTCGGG + Intergenic
999281829 5:150371270-150371292 AGGGTGAGGACGGAAGGTGGAGG - Intronic
1000022290 5:157328447-157328469 AGGATGGGGCAGGACGTTGCAGG + Intronic
1001234760 5:170020101-170020123 AGGCTGGAGCCGGGAGGGCCGGG - Intronic
1001240734 5:170067907-170067929 AGGGAGGGGCAGGAAGGGGCAGG + Intronic
1001246018 5:170106199-170106221 GGCCTGGGGCAGGAAGGGGCTGG - Exonic
1001293013 5:170478165-170478187 GGCCTGGGGCGGGAAGGGGCAGG + Intronic
1001452395 5:171836659-171836681 AGGCTGGTGCTGGCAGGGGCAGG + Intergenic
1002421996 5:179153726-179153748 AGCCAGGGGCCGGGATGTGCAGG - Intronic
1002505869 5:179678822-179678844 CGCCTGGGGCTGGAAGGCGCAGG - Exonic
1002557790 5:180057445-180057467 AGGCTGAGGCAGGAAATTGCCGG + Intronic
1002574178 5:180162101-180162123 AGCCTGGGACAGGAAGGTCCTGG + Intronic
1002865311 6:1116430-1116452 GGGCTGGGAGAGGAAGGTGCTGG + Intergenic
1003326694 6:5097448-5097470 AGGCTGGGGCTGGAGGCTGGAGG - Intergenic
1003414977 6:5899235-5899257 GGGCTGGGTCCTGAGGGTGCTGG - Intergenic
1003649025 6:7941246-7941268 GGGCCGGGCCCGGAAGGTGACGG - Intronic
1004205835 6:13591553-13591575 AGGCAGCGTCGGGAAGGTGCAGG - Intronic
1004241713 6:13928899-13928921 AGTCTGGGGCAGGAAGCTGGGGG + Intronic
1004441866 6:15662330-15662352 AGGCTGTGGCCGGAGGGTGCAGG + Intronic
1005495347 6:26383358-26383380 TAGCTGGGGGCGGTAGGTGCGGG + Intronic
1006321655 6:33322841-33322863 AGGTGGGGGCCGGACGGTGCGGG - Exonic
1006516869 6:34550165-34550187 AGGCTGGGGCCCCAAGGGGATGG - Intronic
1006599458 6:35215831-35215853 AGTGTGGGGCTGGAAGGTGTGGG - Intronic
1006665300 6:35688956-35688978 CGGCTGGGGCGGGACGGCGCCGG - Intronic
1006793004 6:36715917-36715939 AGGACAGGGCCGGGAGGTGCAGG - Intronic
1007372132 6:41432733-41432755 TTGCTGGGCCTGGAAGGTGCTGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1007779958 6:44246982-44247004 GGGCTGGTGGCGGCAGGTGCGGG + Intronic
1007953953 6:45899530-45899552 AGGCAGAGGCAGGAAGCTGCGGG - Exonic
1008379265 6:50823678-50823700 AGGCTGGGGCAGGAGAGAGCCGG - Exonic
1011947294 6:92922370-92922392 AGGCTGGAGCTGGAAAGTGGGGG + Intergenic
1012422524 6:99080357-99080379 AGGCTGGGGCCAGGATGTGAAGG - Intergenic
1015997852 6:139013457-139013479 AGGCTGGAGCTGGGAGGAGCAGG + Intergenic
1016755161 6:147676926-147676948 AAGCTGGGGCCAGATGGTGAGGG + Intronic
1018380258 6:163252450-163252472 AGGCAGGGGCCGGAGAGGGCTGG + Intronic
1018607327 6:165611517-165611539 AGGCTGTGCCCAGAAGGGGCGGG + Intronic
1018645077 6:165940723-165940745 CGGCTGCGGCTGGAAGGCGCAGG - Intronic
1018729744 6:166639750-166639772 ATGCTGGGTCTGGAAGATGCTGG - Intronic
1018811868 6:167304238-167304260 GGGCTGGGGCTGGAGGGAGCGGG + Intronic
1018870437 6:167778508-167778530 AGGCTGGAGCAGGCAGGTGGGGG - Intergenic
1019493176 7:1324477-1324499 AGGCAGGGGCTGGGAGGGGCAGG + Intergenic
1019593211 7:1846132-1846154 GGTCTGGGGCCGGATGGGGCTGG - Intronic
1019708101 7:2505938-2505960 GGGCTGAGGCCTGATGGTGCAGG - Intergenic
1020449735 7:8307276-8307298 AGGCTGGGGCAAGAAAGTGAAGG - Intergenic
1022983960 7:35630878-35630900 AGTCCGGGGCTGGAAGGTGCAGG + Intergenic
1023718262 7:43066105-43066127 AGGCTGAGGCCAGAAGGTCAAGG + Intergenic
1023937342 7:44749071-44749093 AGGTGCGGGCCGGCAGGTGCGGG + Intronic
1024643937 7:51355799-51355821 AGAGTGGGGCAGGAAAGTGCTGG - Intergenic
1025187381 7:56871526-56871548 AGGCTGGGGCAGGAGGGAGTGGG + Intergenic
1025683141 7:63695590-63695612 AGGCTGGGGCAGGAGGGAGTGGG - Intergenic
1025684544 7:63705394-63705416 AGGCTGGGGCAGGAGGGAGTGGG - Intergenic
1025755898 7:64340362-64340384 AGGCTATGGCTGGAAGGAGCTGG + Intronic
1026803039 7:73411825-73411847 AGGCTGGGGCCTGAAGAGCCCGG - Intergenic
1026931175 7:74223806-74223828 AGGCTGGGGCTGGGAGCAGCAGG + Intronic
1027133967 7:75611535-75611557 AGCCTGGGGCCGGGAGGGGAAGG - Intronic
1028129454 7:87152728-87152750 AGGCCCTGGCCGGAACGTGCGGG - Exonic
1029453565 7:100655987-100656009 AGTCTGGGGCCGGTGGGAGCTGG + Intronic
1029655127 7:101919132-101919154 GGGCTGTGGCCGGAGTGTGCTGG + Intronic
1031008509 7:116499962-116499984 CCGCTGAGGCCGGGAGGTGCGGG + Intronic
1032013233 7:128360226-128360248 GTGCTGGGGCCTGAAGGTACAGG - Intronic
1032241439 7:130162351-130162373 TGGCGGGGGCCGGGAGGGGCTGG - Intergenic
1033715947 7:144002784-144002806 AAGCCAGGGCCAGAAGGTGCAGG - Intergenic
1034251290 7:149692816-149692838 GGGCTGGGGCCGCACGGGGCCGG - Intergenic
1034461263 7:151199284-151199306 GGGCTGGGGCCGGAGGCTCCAGG - Intronic
1034967089 7:155398269-155398291 AGGCAGGGGACGGGGGGTGCGGG + Intergenic
1035473039 7:159122544-159122566 TGGGTGGGTCCGGAGGGTGCTGG + Intronic
1036398391 8:8387015-8387037 AGGGTGGCGCCGGAGGGAGCAGG + Intergenic
1036414216 8:8531714-8531736 AGGCTGAGGCTGGAAGGACCAGG + Intergenic
1036604342 8:10292829-10292851 AGGCTGGGGACAGCAGGAGCCGG + Intronic
1036686510 8:10914973-10914995 AGGGTGGGGCCGAGATGTGCAGG - Intronic
1037419880 8:18690768-18690790 AGGCTGGGGTCGAAGGGTGACGG - Intronic
1038411786 8:27364676-27364698 AAGGTGGGGCTGGAAGGTTCTGG - Intronic
1038782017 8:30576031-30576053 ACGCTGGGGCTGGAAGGAACGGG + Intergenic
1038828816 8:31034191-31034213 AAGCTGGGGCCGTCAGGGGCGGG - Intronic
1039784339 8:40819463-40819485 AGGCTAGGGGCTGAAGGTGGGGG - Intronic
1040799437 8:51324965-51324987 AGGCTGAGGCAGGAGGTTGCAGG - Intronic
1040879403 8:52189259-52189281 AAGCTGGATCCTGAAGGTGCTGG + Intronic
1041719293 8:60961710-60961732 GGGCTGGGGCTGGGAGGTGCCGG + Intergenic
1042590545 8:70393670-70393692 AGGCTTGGGCAGGAAGGAACTGG - Intronic
1043296216 8:78666298-78666320 AGGCTGGGGCCGAAGGGAACCGG + Intronic
1044302116 8:90596746-90596768 AGGCTGAGGATGGAAGGTGCAGG + Intergenic
1044429843 8:92095715-92095737 AGGATGGGGCCAGAAAGTGGGGG + Intronic
1044523850 8:93229845-93229867 ACACTGGGGCCGGATGGTGCTGG - Intergenic
1045281135 8:100750590-100750612 AGGCTGGGGATGGGTGGTGCTGG + Intergenic
1048214307 8:132481028-132481050 AGGCTGAGGCTGGAACGGGCGGG - Intergenic
1049020344 8:139952679-139952701 AGGATGGGGCCGAGGGGTGCTGG + Intronic
1049479677 8:142815894-142815916 AGACTGGGGCGGGGAGGTGGAGG + Intergenic
1049507917 8:143013728-143013750 AGGCTGGGGCGGGACGGGGCAGG - Intergenic
1049624073 8:143612302-143612324 AGGCTGAGGCAGGGAGGTCCGGG + Intergenic
1049685615 8:143938117-143938139 AGGCGGGGCCCGGAGGGGGCAGG + Intronic
1049785709 8:144449734-144449756 AGGCTTGGGCAGGAAGATCCAGG - Exonic
1050051065 9:1602126-1602148 AGGCTGGAGCCTGAAAGGGCAGG - Intergenic
1051662808 9:19441506-19441528 GGGCTGGGGCTGGCAGGTGCAGG - Intronic
1053022153 9:34702068-34702090 AGGCTGGGGCTGGAGGATGAAGG + Intergenic
1053054042 9:34983459-34983481 AGGGTGGGGAGGGGAGGTGCTGG - Intergenic
1053161100 9:35813925-35813947 AGGGTAGGGCCAGAAGGTGCTGG + Intronic
1053198336 9:36136650-36136672 AGGCGGGGGCCGGGCGGCGCCGG + Intronic
1053345968 9:37378498-37378520 AGGGTGGGGCTGGATGGGGCTGG - Intergenic
1054864954 9:69990307-69990329 AGGCAGAGGCAGGCAGGTGCTGG + Intergenic
1055646605 9:78367319-78367341 AGGGTGGGGAGGGAAGATGCAGG + Intergenic
1056575496 9:87853251-87853273 AGGCTGGGTGAGGAAGGGGCCGG + Intergenic
1056773537 9:89496554-89496576 AGGCTGGGGTGGGAAGATGAGGG - Intronic
1057054177 9:91949079-91949101 AGGCTGGCGGCGGGAGGGGCGGG - Intronic
1057466267 9:95317301-95317323 AGGCGGGAGGCGGAAGGTGGCGG - Intronic
1057525919 9:95801067-95801089 AGGATGTGGCCAGAAGGTGGGGG - Intergenic
1057695005 9:97316958-97316980 AGGCTGGAGAGGGGAGGTGCAGG - Intronic
1057781729 9:98056058-98056080 AGCCTGGGGCTGGGAGGTCCGGG + Intergenic
1057857448 9:98612266-98612288 GGGCTGGGGCAGAAAGCTGCAGG + Intronic
1058486591 9:105448087-105448109 CGGGTGGGGCCGGGCGGTGCCGG + Exonic
1059145648 9:111897057-111897079 GGGGTGGGGACGGAAGGGGCGGG - Exonic
1059784467 9:117565335-117565357 AGGCTGGGGCCAGAATATTCTGG - Intergenic
1060152125 9:121295554-121295576 TGGCTGGGGATGGAAGGGGCGGG + Intronic
1060225310 9:121786701-121786723 AGGCTGGGGAGGAAAGGGGCCGG - Intergenic
1060523952 9:124310017-124310039 AGGCTGGAGCAGGAAGTGGCAGG + Intronic
1061076182 9:128342948-128342970 AGGCTTGGCCTGGAAGGGGCAGG - Intronic
1061824877 9:133251948-133251970 AGGATGGGGCCCGAGGCTGCAGG + Intronic
1061859644 9:133461268-133461290 AGGTTGAGGCAGGAGGGTGCTGG + Intronic
1062235870 9:135507263-135507285 AAGCTGGGGCTGGACGGTGGTGG - Intergenic
1062395029 9:136349407-136349429 TGGCTGGGGCCGGGAGAGGCAGG - Intronic
1062447944 9:136603548-136603570 TGGCTGGGGCTGGGAGGCGCCGG + Intergenic
1062454781 9:136630276-136630298 TGGCTGTGGCCGGCAGGTGGGGG - Intergenic
1062469584 9:136696736-136696758 AGGCTGGGGGGTGGAGGTGCAGG - Intergenic
1062498012 9:136840671-136840693 AGGCTGGGCCCTGCAGGTGCTGG + Exonic
1062623469 9:137432982-137433004 GGGCTGGGGCGGTCAGGTGCTGG - Intronic
1185457078 X:316595-316617 TGGCTGGGGCCTGCAGGGGCAGG + Intronic
1185742673 X:2546394-2546416 AGGGTGGGTGTGGAAGGTGCGGG + Intergenic
1187447688 X:19373190-19373212 AGGAGGGGGCCGGAAGATGCAGG + Intronic
1188583575 X:31745313-31745335 AAGCTGGGGCCAGAATGTGAGGG + Intronic
1189078939 X:37948600-37948622 AGGCTGAGGCGGGGAGGTGGTGG - Intronic
1189304119 X:39973984-39974006 AGGCTGGGGGTGCAAGGTGAGGG + Intergenic
1189358846 X:40332666-40332688 AGGCTGGGGCCAGAAACTGATGG + Intergenic
1193987168 X:88257322-88257344 AGAATGGGGAGGGAAGGTGCAGG + Intergenic
1194035344 X:88863995-88864017 ATGCTGGGGCTGGCACGTGCTGG + Intergenic
1195250772 X:103044387-103044409 AGGCTGGGAACGGTAGTTGCAGG - Intergenic
1195283447 X:103359188-103359210 TGGTAGGGGCCTGAAGGTGCAGG - Intergenic
1196691898 X:118568665-118568687 AGGGTGGTGCAGGAAGGTGCAGG + Intronic
1198243065 X:134803199-134803221 AGGCAGGGGCTGGAGGGAGCTGG + Intronic
1198429867 X:136554455-136554477 AGGCAGGGGCCAGGTGGTGCAGG + Intronic
1200142918 X:153910674-153910696 AGGCTGGGGCCTGAGGCTGGCGG - Intronic
1201594898 Y:15657730-15657752 AGGCTGAGGCAGGAAGGAGGAGG - Intergenic