ID: 1176266472

View in Genome Browser
Species Human (GRCh38)
Location 20:64212124-64212146
Sequence CAACACGCACAGAAGGTACT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176266469_1176266472 1 Left 1176266469 20:64212100-64212122 CCAGGGTCACGTGAACAGCAACC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1176266472 20:64212124-64212146 CAACACGCACAGAAGGTACTTGG 0: 1
1: 0
2: 0
3: 4
4: 68
1176266464_1176266472 21 Left 1176266464 20:64212080-64212102 CCCACTCCTGGCTGCACAGGCCA 0: 1
1: 0
2: 0
3: 26
4: 377
Right 1176266472 20:64212124-64212146 CAACACGCACAGAAGGTACTTGG 0: 1
1: 0
2: 0
3: 4
4: 68
1176266468_1176266472 15 Left 1176266468 20:64212086-64212108 CCTGGCTGCACAGGCCAGGGTCA 0: 1
1: 0
2: 1
3: 35
4: 295
Right 1176266472 20:64212124-64212146 CAACACGCACAGAAGGTACTTGG 0: 1
1: 0
2: 0
3: 4
4: 68
1176266463_1176266472 22 Left 1176266463 20:64212079-64212101 CCCCACTCCTGGCTGCACAGGCC 0: 1
1: 0
2: 1
3: 38
4: 417
Right 1176266472 20:64212124-64212146 CAACACGCACAGAAGGTACTTGG 0: 1
1: 0
2: 0
3: 4
4: 68
1176266465_1176266472 20 Left 1176266465 20:64212081-64212103 CCACTCCTGGCTGCACAGGCCAG 0: 1
1: 0
2: 3
3: 59
4: 403
Right 1176266472 20:64212124-64212146 CAACACGCACAGAAGGTACTTGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176266472 Original CRISPR CAACACGCACAGAAGGTACT TGG Exonic
901139267 1:7017900-7017922 CAACACTCACAGAAAGTACCAGG - Intronic
907291888 1:53419878-53419900 CCATAGGCACAGAAGGTACAGGG - Intergenic
907684682 1:56599092-56599114 AAACACTCACAGAATGTATTAGG - Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
916788554 1:168104614-168104636 CAACACGGACAGCAGGAAGTTGG + Exonic
919658924 1:200224097-200224119 CAATATGCAGAGAAGATACTTGG - Intergenic
1064123203 10:12637378-12637400 CAACTCTCACAGAAGGAAGTAGG + Intronic
1068107544 10:52637910-52637932 CAAAACGGCCAGAAGGTACTGGG + Intergenic
1068437170 10:57007586-57007608 CAACACTCAGAGAAGGTAGATGG + Intergenic
1069724087 10:70566355-70566377 CTACACATACAGAAAGTACTGGG - Intronic
1070710109 10:78675177-78675199 CAACATGCGCAGAAGGCATTAGG - Intergenic
1072310748 10:94151781-94151803 CAAGACTCAAAGAAGGTCCTTGG + Intronic
1076353659 10:129836450-129836472 CCACATGCACAGAATCTACTAGG + Exonic
1085015146 11:73169158-73169180 CAGCACTCACAGAAGGTTCTCGG + Intergenic
1094701225 12:32872557-32872579 ACACACGCACACAAGTTACTGGG - Intronic
1095179700 12:39133209-39133231 TAACACACACAGAAGATACATGG + Intergenic
1096077990 12:48816767-48816789 CTCCACCCACAGAAGGTCCTGGG - Intronic
1102035952 12:109770632-109770654 CTCCACGCACAGGAGGTACCCGG - Intergenic
1105821597 13:24085598-24085620 CAACATGCAGAGAAGGCACGTGG - Intronic
1109349669 13:61161994-61162016 CTACAGGCACAGAAGGTTCCTGG + Intergenic
1111524728 13:89453184-89453206 CAACACGCAAAGAAGGCAGATGG - Intergenic
1112446888 13:99472270-99472292 CAGCACCCAAAGAAGGAACTGGG - Intergenic
1118721402 14:68596856-68596878 CAACACACCCAGAAGGTGGTGGG + Intronic
1126434731 15:48624888-48624910 TACCACCCACAGAAGGAACTGGG + Intronic
1134541053 16:15065897-15065919 AAACAGGCACAGAAAGGACTAGG + Intronic
1135436505 16:22430441-22430463 AAACAGGCACAGAAAGGACTAGG + Intronic
1136263752 16:29101474-29101496 AAACAGGCACAGAAAGGACTAGG - Intergenic
1137365473 16:47855863-47855885 CAACACACACAGAAGCTCATGGG - Intergenic
1142733528 17:1879722-1879744 CAACACGCACAGGACCTCCTGGG + Intronic
1142814824 17:2417002-2417024 CCAAATGCACAGAAGGCACTCGG + Exonic
1144710245 17:17396789-17396811 CAAGACCCACAGAAGCTACAAGG + Intergenic
1153421102 18:4906228-4906250 AAACACGGACAGAAGCAACTGGG + Intergenic
1153646202 18:7198252-7198274 CAACACGCAGACATGGAACTGGG + Intergenic
1155819591 18:30358115-30358137 CAACGGGAACAAAAGGTACTAGG + Intergenic
1158425299 18:57334587-57334609 CAGCAAGCACAGAAGGTGCGGGG - Intergenic
1159236243 18:65676854-65676876 GAAAACCCAGAGAAGGTACTGGG - Intergenic
1160244561 18:77146664-77146686 CAACAGGCCCAGAACATACTTGG - Intergenic
1165117090 19:33535130-33535152 CAACAGGGACAGTAGGTGCTGGG + Intergenic
1168418424 19:56184286-56184308 CATGACGCATAGTAGGTACTTGG + Intronic
926002177 2:9342452-9342474 CCACAAGCAAAGAAGGAACTTGG + Intronic
926711565 2:15886289-15886311 CAACAGGCACAGAAACCACTTGG + Intergenic
927330786 2:21861035-21861057 CACTACTCAGAGAAGGTACTTGG + Intergenic
932704508 2:74012648-74012670 CAACATGCAAAGACGGTCCTAGG - Intronic
1171217939 20:23365733-23365755 CAAGACGCACATGAGGTACGCGG + Exonic
1176266472 20:64212124-64212146 CAACACGCACAGAAGGTACTTGG + Exonic
1185066126 22:48632562-48632584 CAAGACGCACAGAACGTGCCGGG + Intronic
1185183844 22:49380759-49380781 CAACACGCACAGGATGCACCTGG + Intergenic
951421325 3:22489176-22489198 CAACACACACACAAAATACTAGG - Intergenic
972626396 4:40803758-40803780 CCACACGCAAAGAAGGAATTTGG - Intronic
975687828 4:76934784-76934806 CAACACTCCCAGAAGGTAGAGGG + Intergenic
978648269 4:110968685-110968707 CAACAAGCCCAAAAGGTAATTGG - Intergenic
984644929 4:182209364-182209386 CCACACGCACACAAGGTGCCTGG - Intronic
985052154 4:186001641-186001663 CATCATACACAGAAGGTGCTGGG + Intergenic
985615929 5:922095-922117 CAGCACCAACAGAAGGTACCTGG - Intergenic
986598705 5:9449770-9449792 CCACACACACAGAAGGTGCCTGG + Intronic
987036784 5:14027085-14027107 CTCCACGGGCAGAAGGTACTAGG + Intergenic
988168984 5:27631163-27631185 CAACAGGCTAAGAAGGTATTTGG - Intergenic
991974597 5:72173838-72173860 CACCACGCCCAGCAGGAACTAGG - Intronic
1016619340 6:146090114-146090136 CTTCACACACAGAAGGTACATGG - Intronic
1018446122 6:163860590-163860612 CATCACTCACAGAAGGTTCTGGG - Intergenic
1021822772 7:24514837-24514859 TAACAGGCACTGTAGGTACTAGG + Intergenic
1022710713 7:32846871-32846893 TAACAGGCAAAGAAGGTACGTGG - Intergenic
1022913949 7:34928058-34928080 TAACAGGCAAAGAAGGTACGTGG + Intergenic
1025606826 7:63045363-63045385 AAACACGCACAGCAGGTAAGAGG + Intergenic
1030666973 7:112289325-112289347 CAACATACACAGAAGGCACATGG - Intronic
1031963343 7:128009230-128009252 GAACATGCAGACAAGGTACTGGG + Intronic
1046899255 8:119506227-119506249 TGACACTCACAGAAGGCACTAGG + Intergenic
1059654164 9:116342105-116342127 CTGCACGCTCAGAAGGTACCTGG - Intronic
1062031038 9:134362122-134362144 CAACCCGCACAGAAGGCCCAGGG - Intronic
1062382323 9:136292398-136292420 CAACACTCCCAGAAGGCACCGGG + Intronic
1062677692 9:137757292-137757314 CGACACCCACAGAAGGTGCCAGG - Intronic
1189463031 X:41257886-41257908 CTAAAGGAACAGAAGGTACTGGG - Intergenic
1190567915 X:51749977-51749999 CTAAACCCACAGAAGCTACTTGG - Intergenic