ID: 1176268354

View in Genome Browser
Species Human (GRCh38)
Location 20:64222394-64222416
Sequence CGTGCCCAGCTGCGGCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176268354_1176268363 8 Left 1176268354 20:64222394-64222416 CCCTGAGGCCGCAGCTGGGCACG 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1176268363 20:64222425-64222447 TGGGCTCCATGGCCAAGGCCTGG 0: 1
1: 1
2: 5
3: 33
4: 294
1176268354_1176268366 24 Left 1176268354 20:64222394-64222416 CCCTGAGGCCGCAGCTGGGCACG 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1176268366 20:64222441-64222463 GGCCTGGAATGTACTGCCTTAGG 0: 1
1: 0
2: 2
3: 8
4: 135
1176268354_1176268359 -3 Left 1176268354 20:64222394-64222416 CCCTGAGGCCGCAGCTGGGCACG 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1176268359 20:64222414-64222436 ACGTTCTGCCCTGGGCTCCATGG 0: 1
1: 0
2: 0
3: 18
4: 162
1176268354_1176268360 3 Left 1176268354 20:64222394-64222416 CCCTGAGGCCGCAGCTGGGCACG 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1176268360 20:64222420-64222442 TGCCCTGGGCTCCATGGCCAAGG No data
1176268354_1176268367 25 Left 1176268354 20:64222394-64222416 CCCTGAGGCCGCAGCTGGGCACG 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1176268367 20:64222442-64222464 GCCTGGAATGTACTGCCTTAGGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176268354 Original CRISPR CGTGCCCAGCTGCGGCCTCA GGG (reversed) Intronic
900099560 1:955778-955800 CGTGCCCCGCTGCCTTCTCAGGG + Intronic
900145335 1:1156797-1156819 CGTGTCCAGCTGGGGCCTGTGGG - Intergenic
900366487 1:2313901-2313923 CTTGCCCAGCTCCTGCCCCAGGG - Intergenic
900577885 1:3393317-3393339 AGCCCCCAGCAGCGGCCTCAGGG - Intronic
901058688 1:6461689-6461711 CGGGCCCGGCTGCAGCATCATGG + Exonic
904366331 1:30013175-30013197 CCTGCCCAGCTGACGCCCCAGGG - Intergenic
917788797 1:178486744-178486766 CCAGCCCTGCTGCGGCCTCTCGG - Intergenic
922100072 1:222472397-222472419 CGGGCCCAGCTCCGTCCTCTCGG - Intergenic
922100120 1:222472592-222472614 CAGGCCCAGCTCAGGCCTCACGG - Intergenic
922100477 1:222474025-222474047 CAGGCCCAGCTCCGGCCTCTCGG - Intergenic
922734610 1:227972451-227972473 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
923500361 1:234559327-234559349 TGTGGCCAGCTGGGACCTCAGGG + Intergenic
1066733154 10:38451272-38451294 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1066733200 10:38451434-38451456 CAGGCCCAGCTCCGGCCTCCTGG + Intergenic
1067389372 10:45848932-45848954 CGTGCCCAGCTGAGATCTGATGG - Intronic
1067444880 10:46335612-46335634 CGTGCCCAGCTGAGATCTGATGG + Intergenic
1067502098 10:46814908-46814930 CGTGCCCAGCTGAGATCTGATGG + Intergenic
1067592489 10:47525112-47525134 CGTGCCCAGCTGAGATCTGATGG - Intronic
1067639605 10:48033185-48033207 CGTGCCCAGCTGAGATCTGATGG - Intergenic
1067873891 10:49987123-49987145 CGTGCCCAGCTGAGATCTGATGG + Intronic
1068783438 10:60944733-60944755 CGAGCCCAGCTGCTGACTAAGGG + Intronic
1069876743 10:71567761-71567783 TGCTCCCAGCTGCTGCCTCAGGG + Intronic
1070752478 10:78972471-78972493 TGTGCCCTGCTTCAGCCTCAGGG + Intergenic
1076673129 10:132133952-132133974 CGTGCCCAGCTGGCCCCTCAAGG + Intronic
1076816138 10:132915558-132915580 CGTGCCCAGCTTCTGCCCCGAGG + Intronic
1076816153 10:132915601-132915623 CGTGCCCAGCTTCTGCCCCGAGG + Intronic
1077205446 11:1340387-1340409 CGTGCCCAGGTCTGGCCCCACGG - Intergenic
1077889710 11:6410500-6410522 CATGGCCTGCTGTGGCCTCAGGG + Intronic
1078082115 11:8211632-8211654 AGAGCCTAGCTGAGGCCTCACGG - Intergenic
1081938056 11:46918359-46918381 CGCGCCCCACTGCCGCCTCATGG + Exonic
1081997378 11:47374364-47374386 CGTTCCCAGCTGTGGCCTGGAGG + Intronic
1082260066 11:50071761-50071783 CAGGCCCAGCTCCGGCCTCCCGG - Intergenic
1084209536 11:67614665-67614687 TCTGCCCAGCTGCGCCCCCAGGG + Intergenic
1085026206 11:73238054-73238076 CCAGCCCAGCTGCAGACTCAAGG + Intergenic
1086427840 11:86704293-86704315 TGTGCCCATCTGAAGCCTCACGG - Intergenic
1089884092 11:121802752-121802774 CCTTCCCACATGCGGCCTCAGGG - Intergenic
1090404153 11:126467213-126467235 CCTGCTCAGGTGCCGCCTCAGGG + Intronic
1091718333 12:2795311-2795333 CGTGCCCGGCCGCGGGCTCCGGG - Intronic
1092196980 12:6555601-6555623 GGCGCCCAGCTGCAGCCCCAGGG + Exonic
1104727076 12:131084706-131084728 CGCCCCCACCTGCAGCCTCATGG - Intronic
1106455753 13:29925135-29925157 TGTGCACAGCTGCAGCCTCAAGG - Intergenic
1107976123 13:45690406-45690428 CCTGCCCTGCTGCGGACCCAAGG + Intergenic
1108510206 13:51148798-51148820 CGGGCCCAGCTGGGGCCTGGCGG - Intergenic
1108586912 13:51878137-51878159 CGTGCCCAGCTGAGATCTGATGG - Intergenic
1109936968 13:69299619-69299641 CCTGCCAACCTGGGGCCTCAGGG + Intergenic
1122504344 14:102222197-102222219 CACACCCAGCTGCAGCCTCACGG + Intronic
1122982199 14:105196891-105196913 GAGGCTCAGCTGCGGCCTCAGGG + Intergenic
1123060750 14:105593178-105593200 CATGCAGAGCTGGGGCCTCAGGG - Intergenic
1123085225 14:105714155-105714177 CATGCAGAGCTGGGGCCTCAGGG - Intergenic
1124917199 15:33987509-33987531 CCTCCCCAGCTGCAGCCTCTGGG + Intronic
1125832831 15:42728679-42728701 TGTTCCCAGCTGTGCCCTCACGG - Exonic
1128451178 15:67806745-67806767 AGTGCCCTGCGGCAGCCTCACGG - Exonic
1130224712 15:82047574-82047596 CGTGTGCGGCTGCGGCCGCATGG - Intergenic
1130270757 15:82445756-82445778 GGCGCCCAGTGGCGGCCTCACGG + Intergenic
1130463099 15:84173079-84173101 GGCGCCCAGTGGCGGCCTCACGG + Intronic
1130489575 15:84421709-84421731 GGCGCCCAGTGGCGGCCTCACGG - Intergenic
1130501166 15:84500471-84500493 GGCGCCCAGTGGCGGCCTCACGG - Intergenic
1131120975 15:89823368-89823390 CCTGCCCTGCTGCCACCTCAGGG - Intergenic
1132495019 16:258754-258776 CGGGCCCAGCTGCCCCCTCCGGG - Intronic
1132554045 16:564895-564917 CTTGCCCAGCTGCTCCCGCAGGG - Exonic
1132626158 16:892619-892641 CGTGCCCAGCCCCTGCCACACGG - Intronic
1132657643 16:1048088-1048110 CGTGGTCAGCTGGGGCCTCGAGG - Intergenic
1132676337 16:1122842-1122864 CTTTCCCTGCTGAGGCCTCAGGG + Intergenic
1132745845 16:1436047-1436069 CGTGGCCAGCTCCTGCCGCAGGG + Exonic
1132881628 16:2164095-2164117 CGTCCCGAGCTGGGGTCTCAGGG + Intronic
1133128522 16:3662353-3662375 GGTGCCCCGCTGCTGCCTCCAGG + Exonic
1133139090 16:3731380-3731402 CCTGCTCAGCTGTGACCTCATGG - Exonic
1136375427 16:29862658-29862680 CATGCCCTGCTGCCCCCTCACGG - Exonic
1136591301 16:31219314-31219336 CTTGCCCAGCTGCTCCCCCACGG - Exonic
1136609959 16:31360179-31360201 CTTGCCAAGCTGGGGCCTCTGGG + Intronic
1138222340 16:55263410-55263432 CGTGCCCGGCTGAGGACTCATGG + Intergenic
1139367467 16:66442233-66442255 CTTTCCCAGCTGGGGCCTGATGG - Intronic
1142268516 16:89077345-89077367 CCAGCCCAGCTCCTGCCTCAAGG + Intergenic
1142450676 16:90171516-90171538 CGGGCCCAGCTCCGTCCTCTCGG + Intergenic
1143150768 17:4806859-4806881 CGTGCCCGGCCGCTGCCTCCCGG - Intergenic
1144675521 17:17159061-17159083 TGTGCCCAGCTGTGGCCTGAGGG + Intronic
1145268600 17:21392454-21392476 CTTGAGCAGCTGCAGCCTCATGG - Intronic
1147377546 17:40031963-40031985 ACTGCCCAGCTGGGGCCTGAAGG + Intronic
1148463173 17:47849823-47849845 CCTGCCCAGCTGAGGCACCAGGG - Intronic
1149994019 17:61397434-61397456 GGGGCCCAGCGGAGGCCTCACGG + Intergenic
1151002765 17:70397950-70397972 TGTGCCCAGCCGCGGCCAGAAGG + Intergenic
1151801733 17:76383290-76383312 CGCGCGGAGCTGCGGCCCCAGGG + Intronic
1152307796 17:79531305-79531327 CATGCCCACCTGGGGCCTCTGGG - Intergenic
1152580401 17:81163251-81163273 CCTTCCCTGGTGCGGCCTCAGGG - Intronic
1155216501 18:23647990-23648012 CATGACCAGCTGAGGCCTGAAGG + Intronic
1155541761 18:26876026-26876048 CCTGCCCAGCTGCTTCCGCAGGG + Intergenic
1158090924 18:53712414-53712436 CGAGCCCAGCTTCGGCAACATGG - Intergenic
1160143783 18:76348101-76348123 CGAGCCCTGCTCCGCCCTCAAGG + Intergenic
1160797466 19:952703-952725 CATCCCCAGGTGGGGCCTCATGG + Intronic
1161040822 19:2109997-2110019 CGGGCCCAGCTCAGGGCTCAGGG + Intronic
1161457177 19:4375239-4375261 CTGGCCCAGCTGCCGCCTCTGGG + Intronic
1162015848 19:7846168-7846190 CGGGCCCTGCTCCAGCCTCAGGG + Intronic
1162903473 19:13809158-13809180 CGCGCCCTGCTGCCGCCACAGGG - Exonic
1163743815 19:19033264-19033286 GGTGGCCGGCTGCGGCCTCCCGG - Intronic
1164597631 19:29540485-29540507 TGTGCCTTGCTGCTGCCTCAGGG + Intronic
1166668787 19:44697724-44697746 CGTGCCCAGCTGAGGCTCCCAGG + Intergenic
1167125233 19:47544741-47544763 CGGCCCCTGCAGCGGCCTCAGGG + Exonic
1167619301 19:50552104-50552126 CGTGCCAAGCCGGAGCCTCATGG + Intronic
925339612 2:3127066-3127088 CCTGCCCGGCTGCTGCCTCAGGG - Intergenic
929442103 2:41972653-41972675 CGTACCCTGCTGGGGCCTAATGG - Intergenic
930096893 2:47571883-47571905 CGTTCCCCGCGCCGGCCTCAGGG - Intergenic
932465624 2:71922313-71922335 TGTGCCCAGCTGAGGACCCAGGG - Intergenic
934048457 2:88190762-88190784 CGTGCCCAGGAGCTGCCCCATGG + Intergenic
935765744 2:106366274-106366296 CGTGCTCTGCTGCAGCCTCAGGG - Intergenic
946758358 2:222969105-222969127 CCTGCCCTGCTGGGGCCTCTTGG + Intergenic
946765152 2:223033627-223033649 GGTGCCCCAGTGCGGCCTCAAGG + Intergenic
947625005 2:231613733-231613755 CGTGCCCAGGTCCCGCCCCAGGG - Intergenic
948783698 2:240340197-240340219 CGGGCCCTGCTGCCGCCGCAGGG - Intergenic
949017818 2:241723398-241723420 CATGCCCCACTGTGGCCTCAAGG + Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1174482538 20:50841725-50841747 CCTGCACAGATGCGGCATCATGG + Intronic
1175696227 20:61105271-61105293 AATGCCCATCTGGGGCCTCATGG + Intergenic
1176009998 20:62888105-62888127 GGTGCCCAGCTGTGCCCTCAGGG - Intronic
1176095667 20:63343306-63343328 CGAGCCCAGGTGCGGCCGCCCGG - Intronic
1176119326 20:63446922-63446944 GGTGCCCTGCTGCGGCCTGGTGG - Intronic
1176266151 20:64210404-64210426 CGTGCCCAACACCGGCCTCCTGG - Intronic
1176268354 20:64222394-64222416 CGTGCCCAGCTGCGGCCTCAGGG - Intronic
1176689807 21:9891883-9891905 TGTGCCCAGCTCTAGCCTCAGGG + Intergenic
1176860870 21:14011063-14011085 GGTGCTCATCTGGGGCCTCAGGG - Intergenic
1179934091 21:44591473-44591495 CCAGCCCAGCTGCTGCCGCACGG - Exonic
1179940794 21:44638065-44638087 CCAGCCCAGCTGCTGCCGCACGG + Exonic
1180899158 22:19358435-19358457 CTTGCCCAGCTGAGGGCTAAGGG - Intronic
1181030962 22:20148770-20148792 GGCGCCCAGCAGCAGCCTCAGGG + Exonic
1182877501 22:33704878-33704900 CGTGTCTGGCTGTGGCCTCAGGG - Intronic
1183646624 22:39131055-39131077 AGTGGCCAGCTGCGGCCACCAGG - Exonic
1183903377 22:41022302-41022324 CCGGCCCAGGTGCGGCCTCTGGG - Intergenic
1184128894 22:42505479-42505501 GGTTCCCAGCTGAGGCCCCAAGG - Intergenic
1184137689 22:42558794-42558816 GGTTCCCAGCTGAGGCCCCAAGG - Intronic
1184186216 22:42867018-42867040 CCTGCCCAGGTGGGGACTCAGGG + Intronic
1184486619 22:44783626-44783648 CTTGCACAGCTCTGGCCTCAGGG - Intronic
1185096371 22:48808265-48808287 CGAGCCCAGCTGGTGCCTCCTGG - Intronic
950726912 3:14922609-14922631 CCTGCCCAGCCGGGGGCTCAGGG + Intronic
957845072 3:85721612-85721634 CTGGTCCAGCTGCAGCCTCACGG - Intronic
961455109 3:127020178-127020200 TGTGGCCAGATGCGGCGTCAGGG - Intronic
963112839 3:141701062-141701084 CGTGTGGAGCTGCGGCCCCATGG + Intergenic
965633285 3:170755517-170755539 CGTGCCCAGATGTGGCCCCAGGG + Intronic
966411896 3:179653333-179653355 CGTGCCCAGGTCCGGCGACAGGG + Exonic
968293378 3:197555616-197555638 CTTACCCCGCTGCGGCCGCAGGG + Intronic
969178826 4:5421697-5421719 AGTGCCCAGCTGGGTCCCCATGG - Intronic
972437186 4:39045174-39045196 CACGCCCCGCTGCGGCCTCCCGG + Intronic
974626504 4:64433210-64433232 CCTGGCCAGGTGGGGCCTCAGGG - Intergenic
979175072 4:117652388-117652410 CAAGCCCAGCTGGGGCCCCATGG - Intergenic
979259333 4:118633615-118633637 CAGGCCCAGCTCCGGCCTCTTGG + Intergenic
979259490 4:118634220-118634242 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
979259534 4:118634381-118634403 CAGGCCCAGCTCCGGCCTCCCGG + Intergenic
979259561 4:118634476-118634498 CGGGCCCAGCTCCGGCCTCTTGG + Intergenic
979328812 4:119406148-119406170 CGGGCCCAGCTCCGTCCTCTCGG - Intergenic
979329017 4:119406948-119406970 CAGGCCCAGCTCCGGCCTCTCGG - Intergenic
980017885 4:127674393-127674415 CTGGCCCAGCTGAGGCTTCATGG - Intronic
980353217 4:131709826-131709848 TGTGCCCAGCTCTAGCCTCAGGG + Intergenic
981833562 4:149029246-149029268 CGTCCCCAGCTGAGGGCTGAGGG + Intergenic
982288836 4:153760075-153760097 CCTCCCCAGCAGCGGCCTCGAGG + Exonic
982768043 4:159369916-159369938 CGTGCCCAGATGCAGCGCCAAGG + Intergenic
983729151 4:170971875-170971897 CTTTCCCAGCTGCTGCCTGAGGG - Intergenic
984963137 4:185117441-185117463 CTTCCCCAGCTGTGGCCTAAGGG - Intergenic
985422943 4:189802706-189802728 TGTTCCCAGCTGCTGCTTCAAGG - Intergenic
985829201 5:2215482-2215504 CGTGTTCAGCTGTGGCCTCATGG + Intergenic
987638888 5:20585240-20585262 CAGGCACAGCTGGGGCCTCAGGG - Intergenic
989605681 5:43242354-43242376 CCTGCCCAGCTGCTGCTTCAGGG - Intronic
995342015 5:111070872-111070894 GGTGCCCAGCGGCGACCGCACGG - Intronic
996937431 5:128965265-128965287 CCTGCCCACCTTCGGCCTCCAGG - Exonic
1003339215 6:5203743-5203765 CCTGCCCAGCTGCAGGCTCTCGG - Intronic
1004055975 6:12139248-12139270 CGTGCTCAGCTGCAGCCACACGG + Intronic
1005510133 6:26505273-26505295 CCTGCCCAGATGTGACCTCATGG + Intronic
1007511880 6:42380257-42380279 AGGGCCTAGCTGTGGCCTCAGGG - Intronic
1010221356 6:73451740-73451762 CGTGCCCAGCCCCGGCCTGCCGG - Exonic
1015654157 6:135497906-135497928 CGCGCCCGCCTGCGGCCTGAGGG - Intergenic
1019196898 6:170288401-170288423 CCTGCACAGCAGCGGCCGCACGG - Exonic
1019279596 7:193131-193153 CGTGCCCAGCTGCAGCTAGAGGG + Exonic
1019365934 7:632842-632864 TGTGCCCAGCCACAGCCTCAAGG + Intronic
1019646261 7:2130650-2130672 CGCTCCCAGCTTCGGCCTCCGGG - Intronic
1022091509 7:27110689-27110711 CGTGCCAATGTGCGCCCTCACGG - Exonic
1023401218 7:39793844-39793866 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1023401287 7:39794102-39794124 CGGGCCCAGCTCCGTCCTCTCGG + Intergenic
1024074120 7:45810155-45810177 CGGGCCCAGCTCCTCCCTCACGG + Intergenic
1024074244 7:45810661-45810683 CAGGCCCAGCTCCGGCCTCTCGG + Intergenic
1024219127 7:47273993-47274015 CCTGTCCAGCTGAGGTCTCATGG + Intergenic
1024648326 7:51386579-51386601 CGGGCCCAGCTCCGTCCTCTCGG - Intergenic
1024648397 7:51386837-51386859 CAGGCCCAGCTCCGGCCTCACGG - Intergenic
1024648857 7:51388652-51388674 CGGGCCCAGCTCCGTCCTCTCGG - Intergenic
1024648929 7:51388910-51388932 CAGGCCCAGCTCCGGCCTCACGG - Intergenic
1024649089 7:51389537-51389559 CAGGCCCAGCTCCGGCCTCTCGG - Intergenic
1025052177 7:55741048-55741070 CGGGCCCAGCTCCGTCCTCTCGG - Intergenic
1025053169 7:55744867-55744889 CAGGCCCAGCTCCGGCCTCTCGG - Intergenic
1025129135 7:56366731-56366753 CGGGCCCAGCTCCGTCCTCTCGG - Intergenic
1025130197 7:56370991-56371013 CGCGCCCAGCTTGGGCCTCCTGG - Intergenic
1025130517 7:56372289-56372311 CGCGCCCAGCTTGGGCCTCCTGG - Intergenic
1025130835 7:56373583-56373605 CGCGCCCAGCTTGGGCCTCCTGG - Intergenic
1025176271 7:56803985-56804007 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1025176315 7:56804147-56804169 CAGGCCCAGCTCCGGCCTCCCGG + Intergenic
1025177522 7:56809620-56809642 CGGGCCCAGCTCCGTCCTCTCGG - Intergenic
1025177581 7:56809865-56809887 CAGGCCCAGCTCCGGCCTCCCGG - Intergenic
1025177791 7:56810732-56810754 CAGGCCCAGCTCCGGCCTCTCGG - Intergenic
1025177864 7:56811037-56811059 CAGGCCCAGCTCCTGCCTCACGG - Intergenic
1025178023 7:56811680-56811702 CAGGCCCAGCTCCTGCCTCACGG - Intergenic
1025178132 7:56812140-56812162 CAGGCCCAGCTCTGGCCTCACGG - Intergenic
1025178222 7:56812498-56812520 CAGGCCCAGCTCGGGCCTCATGG - Intergenic
1025178379 7:56813121-56813143 CAGGCCCAGCTCCGGCCTCTCGG - Intergenic
1025178441 7:56813371-56813393 CAGGCCCAGCTCCTGCCTCACGG - Intergenic
1025178562 7:56813879-56813901 CAGGCCCAGCTCTGGCCTCACGG - Intergenic
1025178809 7:56814863-56814885 CAGGCCCAGCTCCGGCCTCTCGG - Intergenic
1025178871 7:56815113-56815135 CAGGCCCAGCTCCTGCCTCACGG - Intergenic
1025179000 7:56815669-56815691 CAGGCCCAGCTCTGGCCTCACGG - Intergenic
1025179092 7:56816030-56816052 CGGGCCCAGCTCAGGCCTCACGG - Intergenic
1025179247 7:56816653-56816675 CAGGCCCAGCTCCGGCCTCTCGG - Intergenic
1025179307 7:56816903-56816925 CAGGCCCAGCTCCTGCCTCACGG - Intergenic
1025179456 7:56817555-56817577 CAGGCCCAGCTCTGGCCTCACGG - Intergenic
1025179547 7:56817916-56817938 CGGGCCCAGCTCAGGCCTCACGG - Intergenic
1025179705 7:56818539-56818561 CAGGCCCAGCTCCGGCCTCTCGG - Intergenic
1025179765 7:56818789-56818811 CAGGCCCAGCTCCTGCCTCACGG - Intergenic
1025179905 7:56819393-56819415 CAGGCCCAGCTCTGGCCTCACGG - Intergenic
1025179997 7:56819754-56819776 CGGGCCCAGCTCAGGCCTCACGG - Intergenic
1025180153 7:56820377-56820399 CAGGCCCAGCTCCGGCCTCTCGG - Intergenic
1025180214 7:56820627-56820649 CAGGCCCAGCTCCTGCCTCACGG - Intergenic
1025180380 7:56821375-56821397 CAGGCCCAGCTCTGGCCTCACGG - Intergenic
1025180470 7:56821736-56821758 CGGGCCCAGCTCAGGCCTCACGG - Intergenic
1025180624 7:56822359-56822381 CAGGCCCAGCTCCGGCCTCTCGG - Intergenic
1025180685 7:56822609-56822631 CAGGCCCAGCTCCTGCCTCACGG - Intergenic
1025180823 7:56823213-56823235 CAGGCCCAGCTCTGGCCTCACGG - Exonic
1025180916 7:56823585-56823607 CAGGCCCAGCTCAGGCCTCACGG - Intronic
1025181069 7:56824206-56824228 CAGGCCCAGCTCCGGCCTCTCGG - Intronic
1025181128 7:56824456-56824478 CAGGCCCAGCTCCTGCCTCACGG - Intronic
1025181250 7:56824964-56824986 CAGGCCCAGCTCTGGCCTCACGG - Intronic
1025181343 7:56825325-56825347 CAGGCCCAGCTCAGGCCTCACGG - Intronic
1025181498 7:56825948-56825970 CAGGCCCAGCTCCGGCCTCTCGG - Intronic
1025181560 7:56826198-56826220 CAGGCCCAGCTCCTGCCTCACGG - Intronic
1025181698 7:56826802-56826824 CAGGCCCAGCTCTGGCCTCACGG - Intronic
1025181789 7:56827163-56827185 CGGGCCCAGCTCAGGCCTCACGG - Intergenic
1025690128 7:63749832-63749854 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1025690358 7:63750782-63750804 CAGGCCCAGCTCCTGCCTCACGG + Intergenic
1025690415 7:63751032-63751054 CAGGCCCAGCTCCGGCCTCTCGG + Intergenic
1025690575 7:63751655-63751677 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1025690807 7:63752605-63752627 CAGGCCCAGCTCCTGCCTCACGG + Intergenic
1025691024 7:63753478-63753500 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1025691247 7:63754380-63754402 CAGGCCCAGCTCCTGCCTCACGG + Intergenic
1025691303 7:63754630-63754652 CAGGCCCAGCTCCGGCCTCTCGG + Intergenic
1025691459 7:63755254-63755276 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1025691685 7:63756204-63756226 CAGGCCCAGCTCCTGCCTCACGG + Intergenic
1025691742 7:63756454-63756476 CAGGCCCAGCTCCGGCCTCTCGG + Intergenic
1025691899 7:63757077-63757099 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1025692132 7:63758027-63758049 CAGGCCCAGCTCCTGCCTCACGG + Intergenic
1025692189 7:63758277-63758299 CAGGCCCAGCTCCGGCCTCTCGG + Intergenic
1025692347 7:63758900-63758922 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1025692580 7:63759850-63759872 CAGGCCCAGCTCCTGCCTCACGG + Intergenic
1025692791 7:63760723-63760745 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1025692994 7:63761529-63761551 CAGGCCCAGCTCCTGCCTCACGG + Intergenic
1025693051 7:63761779-63761801 CAGGCCCAGCTCCGGCCTCTCGG + Intergenic
1025693208 7:63762402-63762424 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1025693440 7:63763352-63763374 CAGGCCCAGCTCCTGCCTCACGG + Intergenic
1025693497 7:63763602-63763624 CAGGCCCAGCTCCGGCCTCTCGG + Intergenic
1025693651 7:63764225-63764247 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1025693960 7:63765504-63765526 CAGGCCCAGCTCCGGCCTCTCGG + Intergenic
1025694134 7:63766212-63766234 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1025694176 7:63766374-63766396 CAGGCCCAGCTCCGGCCTCCCGG + Intergenic
1025694242 7:63766633-63766655 CGGGCCCAGCTCCGTCCTCTCGG + Intergenic
1025695521 7:63772437-63772459 CAGGCCCAGCTCAGGCCTCACGG - Intergenic
1027202668 7:76073287-76073309 CGGGCCCAGCTCTTGCCTCACGG - Intergenic
1030592220 7:111495929-111495951 GGAGCCCAGCTGCAGCCACAAGG + Intronic
1032051716 7:128654209-128654231 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1032051787 7:128654467-128654489 CGGGCCCAGCTCCGTCCTCTCGG + Intergenic
1032543510 7:132723859-132723881 AGTGCACAGCTGTGGCCTCTGGG + Intronic
1034440479 7:151083347-151083369 CGTGCCCTCCTGCGGCTTCGGGG - Intronic
1034639889 7:152594171-152594193 CGCGCCCGGCTGCGGTATCATGG + Intergenic
1034989511 7:155539061-155539083 CCTGCCCAGCTGCGGTCCCTTGG + Intergenic
1035388526 7:158490107-158490129 CGGGCCCAGGGGAGGCCTCAAGG - Intronic
1035751818 8:2001869-2001891 CAGGCTCAGCTGCGGCCCCACGG - Exonic
1035913319 8:3593291-3593313 AGTTCCCAGCTGTGGCCTCATGG + Intronic
1036695536 8:10972150-10972172 CGGGCCCAGCTGGGGCCTCGGGG + Intronic
1036802434 8:11802633-11802655 CGGGGCTAGCTGCGGCCTCGTGG - Intronic
1037648663 8:20816913-20816935 AGTGCCCAGCTTCGTCCTAATGG - Intergenic
1037730138 8:21517288-21517310 CCAGCCCAGCTGAGGCTTCAGGG - Intergenic
1039013628 8:33122823-33122845 CTTGCCCAGCTTCTTCCTCAGGG + Intergenic
1039864757 8:41490853-41490875 CGGCGCCTGCTGCGGCCTCATGG - Exonic
1049229619 8:141475194-141475216 CCTTCCCAGCAGCGGCCCCAGGG - Intergenic
1050387006 9:5101303-5101325 CCTGCCAGGCTGCTGCCTCACGG - Intronic
1053779453 9:41589590-41589612 TGTGCCCAGCTCTAGCCTCAGGG - Intergenic
1054167409 9:61799831-61799853 TGTGCCCAGCTCTAGCCTCAGGG - Intergenic
1054670133 9:67781069-67781091 TGTGCCCAGCTCTAGCCTCAGGG + Intergenic
1055199992 9:73647890-73647912 CGTGCCCAGCTGAGATCTGATGG + Intergenic
1056699804 9:88892859-88892881 CGAGCCCTGCTGCAGCCTCAAGG + Intergenic
1056922292 9:90801670-90801692 CCCGCCCAGCTCCGGGCTCATGG + Intergenic
1057730748 9:97606035-97606057 TGTGCCCACCTGTGGCCACATGG - Intronic
1059320629 9:113465677-113465699 CCTGCCCAGCCATGGCCTCAGGG + Intronic
1059321676 9:113475232-113475254 GGTGCCCAACTGCGATCTCATGG + Intronic
1060051286 9:120380117-120380139 CGTTACCAGCTCTGGCCTCAGGG + Intergenic
1061873134 9:133531238-133531260 GGTGCCCAGAAGGGGCCTCAGGG + Intergenic
1062351519 9:136141984-136142006 CCTGCCCAGCTCTGGCCTCCTGG + Intergenic
1062581938 9:137232603-137232625 CGTGGCCGGCAGCGTCCTCAAGG + Exonic
1186102003 X:6167237-6167259 TGTGCACAGCTGTGGCCTCTAGG - Intronic
1186317160 X:8383548-8383570 CGTGCCCAGTTGCAGCCAAATGG + Intergenic
1190054323 X:47173131-47173153 CGTGGCCAGCTGCAGTCGCACGG + Exonic
1195105775 X:101600418-101600440 AGGACTCAGCTGCGGCCTCACGG - Intergenic
1195107108 X:101613349-101613371 AGGACTCAGCTGCGGCCTCACGG + Intergenic
1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG + Intergenic
1198705838 X:139447139-139447161 CGCGCCCAGCTGCATCCTCCTGG + Intergenic
1201356925 Y:13106857-13106879 CGTGCCCAGCTGCATCATCTAGG - Intergenic
1202372096 Y:24205533-24205555 GGCGCCCAGTGGCGGCCTCACGG - Intergenic
1202381006 Y:24276586-24276608 CAGGCCCAGCTCAGGCCTCACGG + Intergenic
1202489779 Y:25393540-25393562 CAGGCCCAGCTCAGGCCTCACGG - Intergenic
1202498689 Y:25464583-25464605 GGCGCCCAGTGGCGGCCTCACGG + Intergenic