ID: 1176274176

View in Genome Browser
Species Human (GRCh38)
Location 20:64254556-64254578
Sequence TCACTTCTCTTGTTGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176274176_1176274180 3 Left 1176274176 20:64254556-64254578 CCATGGATCAACAAGAGAAGTGA No data
Right 1176274180 20:64254582-64254604 CTCCCTGGGACCACATAACGTGG No data
1176274176_1176274186 22 Left 1176274176 20:64254556-64254578 CCATGGATCAACAAGAGAAGTGA No data
Right 1176274186 20:64254601-64254623 GTGGTGAAGGCACCGGCCTTTGG No data
1176274176_1176274185 15 Left 1176274176 20:64254556-64254578 CCATGGATCAACAAGAGAAGTGA No data
Right 1176274185 20:64254594-64254616 ACATAACGTGGTGAAGGCACCGG No data
1176274176_1176274183 9 Left 1176274176 20:64254556-64254578 CCATGGATCAACAAGAGAAGTGA No data
Right 1176274183 20:64254588-64254610 GGGACCACATAACGTGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176274176 Original CRISPR TCACTTCTCTTGTTGATCCA TGG (reversed) Intergenic