ID: 1176274180

View in Genome Browser
Species Human (GRCh38)
Location 20:64254582-64254604
Sequence CTCCCTGGGACCACATAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176274172_1176274180 25 Left 1176274172 20:64254534-64254556 CCTCAGGTCCGTGGATCCAGGAC No data
Right 1176274180 20:64254582-64254604 CTCCCTGGGACCACATAACGTGG No data
1176274170_1176274180 28 Left 1176274170 20:64254531-64254553 CCACCTCAGGTCCGTGGATCCAG No data
Right 1176274180 20:64254582-64254604 CTCCCTGGGACCACATAACGTGG No data
1176274174_1176274180 17 Left 1176274174 20:64254542-64254564 CCGTGGATCCAGGACCATGGATC No data
Right 1176274180 20:64254582-64254604 CTCCCTGGGACCACATAACGTGG No data
1176274176_1176274180 3 Left 1176274176 20:64254556-64254578 CCATGGATCAACAAGAGAAGTGA No data
Right 1176274180 20:64254582-64254604 CTCCCTGGGACCACATAACGTGG No data
1176274175_1176274180 9 Left 1176274175 20:64254550-64254572 CCAGGACCATGGATCAACAAGAG No data
Right 1176274180 20:64254582-64254604 CTCCCTGGGACCACATAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176274180 Original CRISPR CTCCCTGGGACCACATAACG TGG Intergenic