ID: 1176274185

View in Genome Browser
Species Human (GRCh38)
Location 20:64254594-64254616
Sequence ACATAACGTGGTGAAGGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176274176_1176274185 15 Left 1176274176 20:64254556-64254578 CCATGGATCAACAAGAGAAGTGA No data
Right 1176274185 20:64254594-64254616 ACATAACGTGGTGAAGGCACCGG No data
1176274175_1176274185 21 Left 1176274175 20:64254550-64254572 CCAGGACCATGGATCAACAAGAG No data
Right 1176274185 20:64254594-64254616 ACATAACGTGGTGAAGGCACCGG No data
1176274174_1176274185 29 Left 1176274174 20:64254542-64254564 CCGTGGATCCAGGACCATGGATC No data
Right 1176274185 20:64254594-64254616 ACATAACGTGGTGAAGGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176274185 Original CRISPR ACATAACGTGGTGAAGGCAC CGG Intergenic