ID: 1176274186

View in Genome Browser
Species Human (GRCh38)
Location 20:64254601-64254623
Sequence GTGGTGAAGGCACCGGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176274175_1176274186 28 Left 1176274175 20:64254550-64254572 CCAGGACCATGGATCAACAAGAG No data
Right 1176274186 20:64254601-64254623 GTGGTGAAGGCACCGGCCTTTGG No data
1176274182_1176274186 -7 Left 1176274182 20:64254585-64254607 CCTGGGACCACATAACGTGGTGA No data
Right 1176274186 20:64254601-64254623 GTGGTGAAGGCACCGGCCTTTGG No data
1176274176_1176274186 22 Left 1176274176 20:64254556-64254578 CCATGGATCAACAAGAGAAGTGA No data
Right 1176274186 20:64254601-64254623 GTGGTGAAGGCACCGGCCTTTGG No data
1176274181_1176274186 -6 Left 1176274181 20:64254584-64254606 CCCTGGGACCACATAACGTGGTG No data
Right 1176274186 20:64254601-64254623 GTGGTGAAGGCACCGGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176274186 Original CRISPR GTGGTGAAGGCACCGGCCTT TGG Intergenic