ID: 1176274409

View in Genome Browser
Species Human (GRCh38)
Location 20:64255676-64255698
Sequence CTGCGCATGCGCCGCGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 141}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176274409_1176274417 10 Left 1176274409 20:64255676-64255698 CCAGGCCCGCGGCGCATGCGCAG 0: 1
1: 1
2: 0
3: 25
4: 141
Right 1176274417 20:64255709-64255731 GTGCGCAGGCGCAGAGGCGGCGG 0: 1
1: 0
2: 5
3: 34
4: 308
1176274409_1176274413 -4 Left 1176274409 20:64255676-64255698 CCAGGCCCGCGGCGCATGCGCAG 0: 1
1: 1
2: 0
3: 25
4: 141
Right 1176274413 20:64255695-64255717 GCAGTCAGGCCGTTGTGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1176274409_1176274416 7 Left 1176274409 20:64255676-64255698 CCAGGCCCGCGGCGCATGCGCAG 0: 1
1: 1
2: 0
3: 25
4: 141
Right 1176274416 20:64255706-64255728 GTTGTGCGCAGGCGCAGAGGCGG 0: 1
1: 0
2: 1
3: 19
4: 190
1176274409_1176274414 4 Left 1176274409 20:64255676-64255698 CCAGGCCCGCGGCGCATGCGCAG 0: 1
1: 1
2: 0
3: 25
4: 141
Right 1176274414 20:64255703-64255725 GCCGTTGTGCGCAGGCGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 128
1176274409_1176274421 22 Left 1176274409 20:64255676-64255698 CCAGGCCCGCGGCGCATGCGCAG 0: 1
1: 1
2: 0
3: 25
4: 141
Right 1176274421 20:64255721-64255743 AGAGGCGGCGGCGGCGGCGGCGG 0: 11
1: 236
2: 1771
3: 2711
4: 5121
1176274409_1176274418 13 Left 1176274409 20:64255676-64255698 CCAGGCCCGCGGCGCATGCGCAG 0: 1
1: 1
2: 0
3: 25
4: 141
Right 1176274418 20:64255712-64255734 CGCAGGCGCAGAGGCGGCGGCGG 0: 1
1: 2
2: 3
3: 74
4: 562
1176274409_1176274422 25 Left 1176274409 20:64255676-64255698 CCAGGCCCGCGGCGCATGCGCAG 0: 1
1: 1
2: 0
3: 25
4: 141
Right 1176274422 20:64255724-64255746 GGCGGCGGCGGCGGCGGCGGCGG 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
1176274409_1176274423 28 Left 1176274409 20:64255676-64255698 CCAGGCCCGCGGCGCATGCGCAG 0: 1
1: 1
2: 0
3: 25
4: 141
Right 1176274423 20:64255727-64255749 GGCGGCGGCGGCGGCGGCGGCGG 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
1176274409_1176274420 19 Left 1176274409 20:64255676-64255698 CCAGGCCCGCGGCGCATGCGCAG 0: 1
1: 1
2: 0
3: 25
4: 141
Right 1176274420 20:64255718-64255740 CGCAGAGGCGGCGGCGGCGGCGG 0: 1
1: 23
2: 383
3: 2184
4: 3827
1176274409_1176274419 16 Left 1176274409 20:64255676-64255698 CCAGGCCCGCGGCGCATGCGCAG 0: 1
1: 1
2: 0
3: 25
4: 141
Right 1176274419 20:64255715-64255737 AGGCGCAGAGGCGGCGGCGGCGG 0: 1
1: 2
2: 39
3: 275
4: 1578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176274409 Original CRISPR CTGCGCATGCGCCGCGGGCC TGG (reversed) Intronic
900162773 1:1232216-1232238 GTGCGCAGGCGCCGCCGGCTCGG - Intergenic
900301552 1:1980528-1980550 CTGCGCAGGCGCTGAGGACCGGG + Intronic
901109761 1:6785412-6785434 CTGTGCGTGGGCCGCGGGGCGGG + Exonic
904160414 1:28518577-28518599 CTGCGCGGGCGCCGCGGTGCGGG - Intronic
904160426 1:28518614-28518636 CTGCGCGAGCGCGGCGGGCCGGG + Intronic
904190168 1:28737208-28737230 CTGCCCAGGAGCGGCGGGCCCGG - Intronic
904267273 1:29325218-29325240 CTGCGCCTGCGCCACGGTCCTGG + Exonic
905183188 1:36178850-36178872 GGGCGCGGGCGCCGCGGGCCGGG + Intronic
914710988 1:150213629-150213651 CTGCGCATGCGCGGGGGCGCAGG - Intergenic
916786335 1:168089746-168089768 CTGCCCATGCGCCTCTGCCCAGG + Intronic
919796831 1:201325877-201325899 CTGCTCATGAGCAGAGGGCCTGG + Intronic
920912620 1:210232863-210232885 CTGCGGGTGCGCGGCGGGCAAGG - Exonic
1064086523 10:12349743-12349765 CTGCGCCCGCGCCGCGCCCCCGG + Exonic
1066094141 10:32056446-32056468 CTGCGCAGGCGCAGTGGGCCAGG + Intergenic
1067474427 10:46556631-46556653 CGGCGCTTGCTCCGCGGGCCGGG - Intergenic
1067972793 10:50991678-50991700 CAGCCTCTGCGCCGCGGGCCGGG - Intronic
1070152284 10:73812020-73812042 CTGCGCAGGCGACGCGGGGCGGG - Intergenic
1072059815 10:91798726-91798748 CTGCGCGAGCGCCGCGGCCGAGG + Exonic
1072638886 10:97196236-97196258 CTGCCCCGACGCCGCGGGCCGGG - Intronic
1073104295 10:101023466-101023488 CGGCGCATGGGCCGTGTGCCGGG - Exonic
1075054625 10:119207995-119208017 CGGCGCGTCCGCCGCGGGCCAGG + Intronic
1076639079 10:131901512-131901534 CCGCCCGTGCCCCGCGGGCCGGG - Intronic
1076893279 10:133295649-133295671 CTGCGGAGGCGGCGCTGGCCAGG + Intronic
1077549510 11:3193820-3193842 CTGTGCATGCGTCGGGGGCTGGG - Intergenic
1085266728 11:75241818-75241840 CAGCGCAGGCGCCGCGAGTCGGG - Exonic
1089515856 11:119030897-119030919 CTGCGCAAGCGCGGCCGGCGGGG + Exonic
1094841193 12:34343333-34343355 CTGCGCATGCGCGGCAGGGGAGG - Intergenic
1094844780 12:34356646-34356668 CTGCGCATGTGCGGGGGACCAGG - Intergenic
1103786319 12:123436038-123436060 CCCCGCAGGCGCCGTGGGCCCGG + Intronic
1103894153 12:124262087-124262109 CAGCACATGCCCCCCGGGCCCGG - Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1108363829 13:49691315-49691337 CTGCGCCTGGGCCGCGGGCAGGG - Exonic
1112402474 13:99087702-99087724 CTGAGCATGCGCCGCGGGCCTGG - Intergenic
1113654827 13:112061492-112061514 CGGCGGATGCGCCGAGCGCCCGG - Intergenic
1113820278 13:113208730-113208752 CTGCGCACCCGCGGCGGGGCCGG - Intronic
1114490051 14:23094897-23094919 CTGCGCCTGCGCCGCGGCAGAGG + Exonic
1122081808 14:99272045-99272067 CTCCCCTGGCGCCGCGGGCCCGG + Intergenic
1123630743 15:22258206-22258228 GCGCGCGGGCGCCGCGGGCCGGG - Intergenic
1124363731 15:29056791-29056813 CTGCCCACGTGCAGCGGGCCTGG - Intronic
1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG + Intronic
1129682985 15:77668598-77668620 CTGCGCATGCGTCGTGACCCTGG - Intronic
1133032900 16:3020239-3020261 CTGAGCGGGCGCCGCGGGGCGGG + Intronic
1133259421 16:4538555-4538577 CCGCCCAGGCGCCGCGGGCGGGG + Intronic
1135562274 16:23486046-23486068 CTGAGCATGTACCGCAGGCCAGG - Exonic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1137788230 16:51153946-51153968 CTGCGCACGCGGCGCGCACCAGG - Intergenic
1138360639 16:56425037-56425059 CCGCCCCTGCCCCGCGGGCCCGG + Intronic
1139140907 16:64261203-64261225 CTGCGCCTGGGCCGCGGGCGGGG - Intergenic
1140481751 16:75265991-75266013 CGGCGCATGCGCGGCGCGGCTGG - Exonic
1141972302 16:87492367-87492389 GCGCGCGGGCGCCGCGGGCCGGG + Intergenic
1142468338 17:148309-148331 CTGGGCCTCCGCCGGGGGCCAGG + Intronic
1142989942 17:3723819-3723841 CTGCGCATGCGCACCTCGCCAGG - Intronic
1143582667 17:7835784-7835806 TTGCGCCTGCGCGGCGAGCCGGG + Intergenic
1150802435 17:68292217-68292239 GTGCGCGCGCGCCCCGGGCCGGG - Intronic
1151890412 17:76947960-76947982 CCGCGCACGCCCTGCGGGCCTGG + Exonic
1152801614 17:82333444-82333466 CTGAGCGTGCGTCGCAGGCCAGG - Intronic
1153984495 18:10340539-10340561 CTGCACATGCGGTGAGGGCCAGG + Intergenic
1156331683 18:36129387-36129409 CTGCGCATGCCCTGCAGTCCTGG - Intergenic
1157522087 18:48352368-48352390 CTGCGGATGCCCCCAGGGCCTGG - Intronic
1160566238 18:79788245-79788267 CAGCGCAGGCCCCGCCGGCCCGG + Intergenic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160739652 19:680040-680062 CTGCGCCTGCGCTGGGGGGCGGG - Intronic
1160824918 19:1074988-1075010 CCGCGCATGCGCAGGAGGCCGGG - Intronic
1161279078 19:3435284-3435306 CTGCGCGGGCGCCGCGGGGCAGG + Intronic
1161959555 19:7516208-7516230 CGGCGCGGGCGCGGCGGGCCGGG + Exonic
1162046702 19:8005225-8005247 GTGGGCATGCGCCGGGGGGCCGG - Intronic
1162457898 19:10796836-10796858 CCGCGCCAACGCCGCGGGCCTGG + Intronic
1162817866 19:13207368-13207390 CTGGCCAGGCCCCGCGGGCCGGG - Exonic
1162890783 19:13731754-13731776 TTGCGCATGCGCCTCGGAGCTGG + Exonic
1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG + Intronic
1162937068 19:13986629-13986651 CTGGGCATGCGCAGGAGGCCAGG + Intronic
1163606858 19:18280416-18280438 CCGCGCATGCGCCCCGCGCGCGG + Exonic
1163672500 19:18637096-18637118 CGGCGCTTTCGGCGCGGGCCCGG + Exonic
1165090913 19:33388038-33388060 GTGCGCAGGCTCCGCAGGCCGGG + Exonic
1165996338 19:39846449-39846471 CTGCGCGTGCGCCGAGCTCCGGG - Intergenic
1166791674 19:45402556-45402578 CGGGGAATGCGCAGCGGGCCCGG + Intronic
1166984146 19:46649581-46649603 CTGCGCAGGCGCCGCCGCCGGGG - Exonic
1167017558 19:46850795-46850817 CTGCCCAGTCGCCGCGGGACCGG - Exonic
1167517054 19:49929552-49929574 CTGCGCATGCGCACTGGGCCCGG + Intronic
1168146835 19:54424380-54424402 CAGCGCATGCCCCGCGGGCAGGG - Intronic
1168151134 19:54449457-54449479 CTGCGCCTGCGCACCGGGCCTGG + Intronic
1168320076 19:55503845-55503867 ATGCGCAGGCGCGGTGGGCCCGG + Intronic
925084482 2:1097240-1097262 CTGCACCTGCACCGCTGGCCGGG + Intronic
925364484 2:3302668-3302690 CTGTGGATCCGCAGCGGGCCTGG - Intronic
927290748 2:21402611-21402633 CTTCGCATTCGCAGAGGGCCAGG + Intergenic
928097199 2:28412077-28412099 CTGCGCATGGGCTGCAGCCCAGG - Exonic
933718154 2:85377231-85377253 CTGCTCATGCTCCGCTAGCCTGG + Intronic
934857629 2:97739011-97739033 CTGTGCATGCACCTGGGGCCAGG - Intronic
937320870 2:120959972-120959994 CTGTGCAGGCGCAGGGGGCCTGG + Intronic
937329348 2:121016147-121016169 CTGCACACCAGCCGCGGGCCTGG + Intergenic
938934764 2:136118197-136118219 CGGCGCATGCGCCGCTGGGGCGG + Intergenic
942947134 2:181683670-181683692 CTGAGCGCGCGGCGCGGGCCGGG + Intergenic
946339176 2:219057379-219057401 CTGCCCATGCCCTGCGGCCCCGG + Intronic
1170150470 20:13221620-13221642 CAGCGCCAGCCCCGCGGGCCCGG + Intergenic
1171968820 20:31550387-31550409 CTGCGCGTGCCCCCCGGGCTGGG - Intronic
1172016760 20:31880130-31880152 CTGCGCAAGTCCCGCGAGCCCGG + Intronic
1172775900 20:37406728-37406750 ATGCGCATGCGCGGCGCGGCAGG + Intergenic
1172978966 20:38926847-38926869 CTTCGCCAGCGCCGCGGGGCTGG - Exonic
1173243505 20:41317873-41317895 TGGCGCATGCGCCGGGGGCAAGG - Intergenic
1175873759 20:62220104-62220126 CAGCGCATGGTCCGCGGGGCCGG + Exonic
1175994325 20:62805375-62805397 CTGCGCAGGCCCCGCGGCCTGGG + Intronic
1176092063 20:63322552-63322574 CAGCGCATGCGCGGCGTGCAGGG + Intronic
1176274409 20:64255676-64255698 CTGCGCATGCGCCGCGGGCCTGG - Intronic
1176510554 21:7744870-7744892 GTGCGCAGGCGCAGTGGGCCCGG - Intergenic
1178314904 21:31559393-31559415 CAGCGGAGGCGCGGCGGGCCGGG + Intronic
1178644667 21:34375399-34375421 GTGCGCAGGCGCAGTGGGCCCGG - Intergenic
1179495017 21:41766245-41766267 CCGCGCAAGCGCCGGGCGCCCGG + Intronic
1179673233 21:42964277-42964299 CTGCACAGGCCCCCCGGGCCTGG - Intergenic
1179893663 21:44350167-44350189 CCGAGCGTGCGCCGCGTGCCCGG - Intronic
1180256847 21:46635596-46635618 CTGCGCCTGCGCGGGGCGCCGGG + Intronic
1183258186 22:36776519-36776541 CGGCGCCTGCGCAGTGGGCCAGG + Intergenic
1184609930 22:45596429-45596451 CTGCGCATGCTACGTGTGCCTGG - Intronic
1184662593 22:45972262-45972284 CTGAACAGGCTCCGCGGGCCGGG + Intronic
1184853809 22:47135815-47135837 CTGAGCACGCGCCACGTGCCAGG + Intronic
1185270455 22:49927168-49927190 CTGCACATGCGCTGCTGTCCTGG + Intronic
951611340 3:24495134-24495156 CGGAGCAGGCGCCCCGGGCCCGG - Intronic
952970931 3:38649703-38649725 CTGGGCAGGCGGCGCGGGCTCGG + Intergenic
953909234 3:46883390-46883412 CAGCGCATGGGCCCCGCGCCGGG + Exonic
955228282 3:57078783-57078805 CTGCGGGTGCCCCGCGGGGCTGG + Intronic
960120840 3:113947798-113947820 CGGCGCCAGGGCCGCGGGCCAGG + Intergenic
961858279 3:129893764-129893786 TTGCGCGTGCGCCGCCGGCCGGG - Intergenic
964862886 3:161221501-161221523 CTGCGTGAGCGCCGCGTGCCCGG + Intronic
973293381 4:48490881-48490903 CTGCTCGCCCGCCGCGGGCCCGG - Exonic
977525785 4:98143586-98143608 GTGCGCATGCTCCGAGGGCTCGG - Intergenic
985565276 5:612318-612340 CGGCGCCTGCGCGGCGGGCGGGG - Exonic
985988389 5:3536078-3536100 GTGCGCATGCGCGGCCTGCCGGG - Intergenic
989613007 5:43313301-43313323 CTGCGGAGGTGCCGCGGGCGGGG - Intronic
992067403 5:73120508-73120530 CTGCGCGGGCGCGGCGGCCCGGG - Exonic
992812940 5:80407922-80407944 GTGCGCAAGCGCCCCGGGCCTGG + Intergenic
1001653279 5:173329845-173329867 CTGCCCAGGCGACGCGGCCCTGG + Intergenic
1002304456 5:178275020-178275042 CTGCACATGAGCAGCAGGCCAGG + Intronic
1006089554 6:31620528-31620550 CTCCGCATGCTCCGCGCGCCCGG + Intergenic
1009975555 6:70667706-70667728 CGGCGCATGCGCAGCGCGCTCGG + Intergenic
1012401359 6:98844990-98845012 CAGCGCTAGAGCCGCGGGCCTGG + Intergenic
1012454998 6:99393996-99394018 CTGCGCATGCGCCGGGGGTGGGG - Intronic
1016010655 6:139135150-139135172 CCGCGCGGGCGCCGCGGGCCCGG - Exonic
1017679040 6:156845294-156845316 CTCCGAATGCGCAGCGGGCCAGG - Intronic
1018872998 6:167797141-167797163 CAGCGCGTGCGCCGCGGCCAGGG - Intergenic
1019437207 7:1028366-1028388 CTGCGCATGCCCGGCCGGCCCGG + Intronic
1019485956 7:1289246-1289268 CTGCCCATGCGCCGGTGACCAGG - Intergenic
1020225010 7:6272752-6272774 CAGCGCAGACGCCGCCGGCCCGG - Intergenic
1023030363 7:36085344-36085366 CTTCGCATGCACCGCGTGCCCGG - Exonic
1024539330 7:50463282-50463304 CTGCCCATGTGCAGCGGGCCTGG - Exonic
1024578322 7:50782461-50782483 CTGCGTGTGCGCCGCCGGCCCGG + Intronic
1030727183 7:112939700-112939722 CTGCTCGTGCGCAGAGGGCCGGG - Exonic
1034438935 7:151076876-151076898 GTGAGGATGCGCCACGGGCCAGG + Intronic
1037788880 8:21919598-21919620 CTGCGCAGGCCCCGGCGGCCCGG - Intergenic
1037803907 8:22049123-22049145 CCTCGCCTGCGCCTCGGGCCTGG - Intronic
1037947728 8:22999709-22999731 CAGCGCCTTCGCCGCGGGCCCGG + Intronic
1039936600 8:42051647-42051669 CGGCGCGCGGGCCGCGGGCCGGG + Intronic
1043889607 8:85642232-85642254 CTGCGCCTGCGCCGGGGGTGGGG + Intergenic
1045111073 8:98940135-98940157 CTCGGCGTGCGGCGCGGGCCTGG + Intronic
1045277735 8:100722318-100722340 TTGCGCAGGCGCCGCGGCCGGGG + Exonic
1048833375 8:138497062-138497084 CTGCGCCCGCGCCGCTGGGCTGG + Intergenic
1049801096 8:144517865-144517887 ATGCGGATGCGCGGCGGGCCGGG + Intergenic
1050537787 9:6645450-6645472 CTGCGCCTGGGCCGCGGGGTCGG - Exonic
1051079627 9:13279399-13279421 CTGGGCGGGCGCCGCGAGCCGGG - Exonic
1056643180 9:88388303-88388325 CTGCGCAGGCGCAGTGGGGCGGG - Intergenic
1060547190 9:124468443-124468465 CTGGGCATGGGCCGCGGGGCTGG + Intronic
1060656645 9:125376656-125376678 CTGAGGATCCGCCGCAGGCCCGG + Intergenic
1060822113 9:126667456-126667478 GTGCGCATGTGCCGCGTGACGGG + Intronic
1061257402 9:129460632-129460654 CTGCTCGGCCGCCGCGGGCCCGG + Intergenic
1061859353 9:133460213-133460235 GAGCGCATGCGCGGCGGGGCCGG - Intronic
1185747477 X:2584244-2584266 TTGCGGATGCGGCGCGGGGCCGG - Intergenic
1186496505 X:10015720-10015742 CCGCGCCGCCGCCGCGGGCCCGG + Exonic
1187181463 X:16946993-16947015 CTGTGCCGGCGCCGCGGGCGGGG + Exonic
1200209825 X:154342266-154342288 CGGCGCATGCCCCGCAGGGCCGG - Intergenic
1200221027 X:154389826-154389848 CGGCGCATGCCCCGCAGGGCCGG + Intergenic