ID: 1176274590

View in Genome Browser
Species Human (GRCh38)
Location 20:64256553-64256575
Sequence ATGGCTAAACAGCTCCTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176274586_1176274590 26 Left 1176274586 20:64256504-64256526 CCTCTTTACTCGTGTGACTAGAA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1176274590 20:64256553-64256575 ATGGCTAAACAGCTCCTATCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1176274583_1176274590 29 Left 1176274583 20:64256501-64256523 CCCCCTCTTTACTCGTGTGACTA 0: 1
1: 0
2: 0
3: 4
4: 215
Right 1176274590 20:64256553-64256575 ATGGCTAAACAGCTCCTATCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1176274584_1176274590 28 Left 1176274584 20:64256502-64256524 CCCCTCTTTACTCGTGTGACTAG 0: 1
1: 0
2: 2
3: 2
4: 74
Right 1176274590 20:64256553-64256575 ATGGCTAAACAGCTCCTATCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1176274585_1176274590 27 Left 1176274585 20:64256503-64256525 CCCTCTTTACTCGTGTGACTAGA 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1176274590 20:64256553-64256575 ATGGCTAAACAGCTCCTATCTGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176274590 Original CRISPR ATGGCTAAACAGCTCCTATC TGG Intronic
905941178 1:41864634-41864656 ATGGATAAACTGCTTCTGTCAGG + Intronic
907271117 1:53291677-53291699 AAGCCTAAATAGCTACTATCTGG - Intronic
907772547 1:57480175-57480197 AAGGCAACACAGCTCCCATCTGG - Intronic
917260331 1:173160195-173160217 ATTTCTACACAGCTTCTATCTGG + Intergenic
1063697369 10:8349815-8349837 ATGGCTAAATACCACCTGTCAGG - Intergenic
1064569493 10:16677576-16677598 ATGGGGAAACAGCTCCTTGCAGG - Intronic
1066505362 10:36036730-36036752 CTGGCAAAACCGCTCCTCTCAGG - Intergenic
1068165704 10:53329824-53329846 ATGGATTACCAGTTCCTATCAGG + Intergenic
1069573568 10:69508810-69508832 GTGGCTCAAGAGATCCTATCTGG - Intergenic
1071993693 10:91126445-91126467 ATAGCTTCACAGCTCCTGTCAGG + Intergenic
1079702427 11:23565391-23565413 ATGGCAAATCAGCTCCTCCCTGG + Intergenic
1084863874 11:72040368-72040390 ATGGCAAAAGAGCTGCAATCAGG + Intronic
1088591749 11:111409320-111409342 ATGACTCACCAGCTCCTATTAGG - Intronic
1096559780 12:52427765-52427787 TTGGCTACACAGCTCCTAACTGG + Intronic
1100546321 12:95605966-95605988 ATGGCAAAATATTTCCTATCTGG - Intergenic
1103912505 12:124360171-124360193 ATGGATACACAGCTCCTTCCCGG + Intronic
1105640639 13:22260139-22260161 CTTGCTAAACTGCTCCTTTCTGG + Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1118288125 14:64496010-64496032 ATGGTTGAATAGTTCCTATCAGG - Intronic
1124873880 15:33572532-33572554 ATGGCAAAACAGCTCCAACAGGG - Intronic
1134839385 16:17389531-17389553 CTGGCTAAACAGATCCACTCCGG - Intronic
1135791976 16:25405251-25405273 CTGTCTGAACAGCTACTATCTGG + Intergenic
1140438484 16:74968158-74968180 ATGGGTACAGAGCTCCTATTTGG + Intronic
1140701692 16:77587284-77587306 ATGACTAAAGAGCTCCTTGCAGG - Intergenic
1145734254 17:27215552-27215574 ATCCCTAAACATCTCCTATGGGG + Intergenic
1152110391 17:78354550-78354572 CTGGCTAAACAGCTGCCTTCTGG + Intergenic
1152382967 17:79951789-79951811 ATGGCAAAACTGCTCCTTCCTGG + Intronic
1156006245 18:32445332-32445354 AAGGCTAAAGAGCTATTATCTGG + Intronic
1156195879 18:34773721-34773743 ATGGAAAAACTGCTCCTCTCTGG + Intronic
1156655277 18:39277907-39277929 ATTGCTAAACAGACCCTATGTGG + Intergenic
1160256978 18:77255529-77255551 ATGGCAAATCACCTCCCATCAGG - Intronic
927626209 2:24721687-24721709 ATGGCTGAACAGCTGCTGCCAGG - Intronic
934159747 2:89237562-89237584 ATGGCTAAAAATCTTCTTTCGGG + Intergenic
934207532 2:89944869-89944891 ATGGCTAAAAATCTTCTTTCGGG - Intergenic
939215750 2:139236268-139236290 ATGATCAAACAGCTCCTGTCAGG - Intergenic
939300860 2:140336050-140336072 ATGGTTAAACAGGTGCAATCTGG - Intronic
943831506 2:192469301-192469323 ATAGCTAATCAGGTTCTATCTGG - Intergenic
1170298003 20:14850554-14850576 AGGACTAAACAGCTCCTAAATGG - Intronic
1171484198 20:25475903-25475925 AGGGCTACACAGCCCCCATCAGG + Intronic
1173534223 20:43796930-43796952 ATGACTAAACACCTCCCATGAGG + Intergenic
1174954965 20:55087704-55087726 TTGGCTAAACAGCTACTATTTGG - Intergenic
1176274590 20:64256553-64256575 ATGGCTAAACAGCTCCTATCTGG + Intronic
1178465000 21:32840002-32840024 ATGGCTGATCAGCTGCTCTCTGG - Intergenic
1178661585 21:34511379-34511401 ATGACTAAACACCTCCCATTAGG - Intergenic
1183373727 22:37450134-37450156 ATGGTGAAACAGCTACTATGGGG - Intergenic
954961530 3:54569619-54569641 ATGGCCCAACAGCTCCTTCCTGG + Intronic
957140796 3:76353196-76353218 ATGGCTAAAAAGATCATATCAGG - Intronic
963076422 3:141351523-141351545 ATGACCAGACAGATCCTATCTGG + Intronic
963334856 3:143963129-143963151 TTGACTAAACACCTCCCATCAGG + Intergenic
969604355 4:8194992-8195014 AGGGCCACACAGCTCCTATGTGG - Intronic
978393076 4:108247970-108247992 AAGGCTAATTAGCTCCTAGCTGG - Intergenic
989368950 5:40685060-40685082 AGGGCTAAACAGTTACTATAGGG + Intronic
992445296 5:76827895-76827917 ATGGTTAAAGAGTTCCTATATGG - Intronic
994106765 5:95958617-95958639 ATCCTTAACCAGCTCCTATCAGG - Intronic
1000336502 5:160245400-160245422 ATGTCTACTCAGCTCCTACCTGG - Intergenic
1008271215 6:49492586-49492608 ATTGGTTAACAGCTCATATCAGG + Exonic
1012551194 6:100465809-100465831 TTGTTTAAACAGCTCCTATTAGG - Intergenic
1016667572 6:146659818-146659840 ATGGCTAACCTGCTTCTTTCGGG - Intronic
1028675120 7:93450770-93450792 ATGGCTGAGTAGCTCCTGTCTGG - Intronic
1029372189 7:100157194-100157216 AGTGCTGAACAGCTCCTCTCAGG - Exonic
1039963518 8:42267769-42267791 ATAGCTAAACATGTCTTATCTGG + Intergenic
1042375586 8:68047373-68047395 AGGGATAAACAGATACTATCAGG + Intronic
1055209389 9:73771184-73771206 ATGGCTAAACTGCTACTTTAGGG + Intergenic
1057631473 9:96722344-96722366 ATGGCCAAAAAGCTCCTCCCTGG - Intergenic
1058730965 9:107849630-107849652 ATGGCGAAACATTTCCTAGCTGG - Intergenic
1187476226 X:19613416-19613438 ATGTCTAAACAGCAGCTTTCTGG - Intronic
1191080711 X:56506467-56506489 ACGTCTAAACAGCTCCTGGCTGG - Intergenic
1192711471 X:73594718-73594740 ATGGCTATAGAGTTCCTATTTGG - Intronic
1192737102 X:73860066-73860088 ATGGCCAAAAAGTTCCCATCTGG - Intergenic
1193636631 X:83958299-83958321 TTGGCTATACAGCTCCTTTTTGG - Intergenic
1193639572 X:83995411-83995433 ATGCCTTAAAAGCTCCTACCAGG + Intergenic
1194796783 X:98221326-98221348 ATGAGTACACAGCTCCTATGGGG + Intergenic