ID: 1176281491

View in Genome Browser
Species Human (GRCh38)
Location 20:64316373-64316395
Sequence TCGCACCATCACACTAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176281490_1176281491 -9 Left 1176281490 20:64316359-64316381 CCAAGGGAATCTACTCGCACCAT No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281475_1176281491 30 Left 1176281475 20:64316320-64316342 CCCCTCCTAGCCGCCCCCGCCTC No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281478_1176281491 25 Left 1176281478 20:64316325-64316347 CCTAGCCGCCCCCGCCTCAATGT No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281479_1176281491 20 Left 1176281479 20:64316330-64316352 CCGCCCCCGCCTCAATGTCCCCT No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281483_1176281491 14 Left 1176281483 20:64316336-64316358 CCGCCTCAATGTCCCCTTCTTCT No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281477_1176281491 28 Left 1176281477 20:64316322-64316344 CCTCCTAGCCGCCCCCGCCTCAA No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281484_1176281491 11 Left 1176281484 20:64316339-64316361 CCTCAATGTCCCCTTCTTCTCCA No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281476_1176281491 29 Left 1176281476 20:64316321-64316343 CCCTCCTAGCCGCCCCCGCCTCA No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281480_1176281491 17 Left 1176281480 20:64316333-64316355 CCCCCGCCTCAATGTCCCCTTCT No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281481_1176281491 16 Left 1176281481 20:64316334-64316356 CCCCGCCTCAATGTCCCCTTCTT No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281488_1176281491 1 Left 1176281488 20:64316349-64316371 CCCTTCTTCTCCAAGGGAATCTA No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281487_1176281491 2 Left 1176281487 20:64316348-64316370 CCCCTTCTTCTCCAAGGGAATCT No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281482_1176281491 15 Left 1176281482 20:64316335-64316357 CCCGCCTCAATGTCCCCTTCTTC No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data
1176281489_1176281491 0 Left 1176281489 20:64316350-64316372 CCTTCTTCTCCAAGGGAATCTAC No data
Right 1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176281491 Original CRISPR TCGCACCATCACACTAGCCC CGG Intergenic
No off target data available for this crispr