ID: 1176281938

View in Genome Browser
Species Human (GRCh38)
Location 20:64318252-64318274
Sequence CAGAGAAAGGAAAAGGAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176281932_1176281938 19 Left 1176281932 20:64318210-64318232 CCAGGAGGATCTGGCTAGCCAAT No data
Right 1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG No data
1176281934_1176281938 1 Left 1176281934 20:64318228-64318250 CCAATGGAGATGAAACACTTCAT No data
Right 1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176281938 Original CRISPR CAGAGAAAGGAAAAGGAACC GGG Intergenic
No off target data available for this crispr