ID: 1176282039

View in Genome Browser
Species Human (GRCh38)
Location 20:64318811-64318833
Sequence TCGGTTCTGTTTATTGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176282033_1176282039 0 Left 1176282033 20:64318788-64318810 CCTGCTCATAGCTAGGATTGGGG No data
Right 1176282039 20:64318811-64318833 TCGGTTCTGTTTATTGCCGGGGG No data
1176282031_1176282039 1 Left 1176282031 20:64318787-64318809 CCCTGCTCATAGCTAGGATTGGG No data
Right 1176282039 20:64318811-64318833 TCGGTTCTGTTTATTGCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176282039 Original CRISPR TCGGTTCTGTTTATTGCCGG GGG Intergenic
No off target data available for this crispr