ID: 1176282224

View in Genome Browser
Species Human (GRCh38)
Location 20:64320123-64320145
Sequence CAGAGCATGGGGCCCTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176282213_1176282224 26 Left 1176282213 20:64320074-64320096 CCTCTAGCCCCTGAAGCTGTGGC No data
Right 1176282224 20:64320123-64320145 CAGAGCATGGGGCCCTTCTCTGG No data
1176282216_1176282224 18 Left 1176282216 20:64320082-64320104 CCCTGAAGCTGTGGCTTAGAGGG No data
Right 1176282224 20:64320123-64320145 CAGAGCATGGGGCCCTTCTCTGG No data
1176282218_1176282224 17 Left 1176282218 20:64320083-64320105 CCTGAAGCTGTGGCTTAGAGGGA No data
Right 1176282224 20:64320123-64320145 CAGAGCATGGGGCCCTTCTCTGG No data
1176282214_1176282224 19 Left 1176282214 20:64320081-64320103 CCCCTGAAGCTGTGGCTTAGAGG No data
Right 1176282224 20:64320123-64320145 CAGAGCATGGGGCCCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176282224 Original CRISPR CAGAGCATGGGGCCCTTCTC TGG Intergenic
No off target data available for this crispr