ID: 1176284393

View in Genome Browser
Species Human (GRCh38)
Location 21:5011814-5011836
Sequence GCGCCGTACACAAGATCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176284393_1176284395 -9 Left 1176284393 21:5011814-5011836 CCCTTCGATCTTGTGTACGGCGC No data
Right 1176284395 21:5011828-5011850 GTACGGCGCCACACCTCCCCTGG No data
1176284393_1176284396 -8 Left 1176284393 21:5011814-5011836 CCCTTCGATCTTGTGTACGGCGC No data
Right 1176284396 21:5011829-5011851 TACGGCGCCACACCTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176284393 Original CRISPR GCGCCGTACACAAGATCGAA GGG (reversed) Intergenic
No off target data available for this crispr