ID: 1176285237

View in Genome Browser
Species Human (GRCh38)
Location 21:5015928-5015950
Sequence GCCACACTTGTGGCCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176285228_1176285237 21 Left 1176285228 21:5015884-5015906 CCAGGGTTGCTGCTCCACAAAAG No data
Right 1176285237 21:5015928-5015950 GCCACACTTGTGGCCCCTGCAGG No data
1176285226_1176285237 27 Left 1176285226 21:5015878-5015900 CCAGACCCAGGGTTGCTGCTCCA No data
Right 1176285237 21:5015928-5015950 GCCACACTTGTGGCCCCTGCAGG No data
1176285234_1176285237 -9 Left 1176285234 21:5015914-5015936 CCTCTGCTCCAGTGGCCACACTT No data
Right 1176285237 21:5015928-5015950 GCCACACTTGTGGCCCCTGCAGG No data
1176285232_1176285237 -5 Left 1176285232 21:5015910-5015932 CCTCCCTCTGCTCCAGTGGCCAC No data
Right 1176285237 21:5015928-5015950 GCCACACTTGTGGCCCCTGCAGG No data
1176285233_1176285237 -8 Left 1176285233 21:5015913-5015935 CCCTCTGCTCCAGTGGCCACACT No data
Right 1176285237 21:5015928-5015950 GCCACACTTGTGGCCCCTGCAGG No data
1176285230_1176285237 7 Left 1176285230 21:5015898-5015920 CCACAAAAGGCACCTCCCTCTGC No data
Right 1176285237 21:5015928-5015950 GCCACACTTGTGGCCCCTGCAGG No data
1176285227_1176285237 22 Left 1176285227 21:5015883-5015905 CCCAGGGTTGCTGCTCCACAAAA No data
Right 1176285237 21:5015928-5015950 GCCACACTTGTGGCCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176285237 Original CRISPR GCCACACTTGTGGCCCCTGC AGG Intergenic